A mutant Shiga-like toxin IIe bound to its receptor Gb(3): structure of a group II Shiga-like toxin with altered binding specificity

BACKGROUND: Shiga-like toxins (SLTs) are produced by the pathogenic strains of Escherichia coli that cause hemorrhagic colitis and hemolytic uremic syndrome. These diseases in humans are generally associated with group II family members (SLT-II and SLT-IIc), whereas SLT-IIe (pig edema toxin) is central to edema disease of swine. The pentameric B-subunit component of the majority of family members binds to the cell-surface glycolipid globotriaosyl ceramide (Gb(3)), but globotetraosyl ceramide (Gb(4)) is the preferred receptor for SLT-IIe. A double-mutant of the SLT-IIe B subunit that reverses two sequence differences from SLT-II (GT3; Gln65-->Glu, Lys67-->Gln, SLT-I numbering) has been shown to bind more strongly to Gb(3) than to Gb(4). RESULTS: To understand the molecular basis of receptor binding and specificity, we have determined the structure of the GT3 mutant B pentamer, both in complex with a Gb(3) analogue (2.0 A resolution; R = 0.155, R(free) = 0.194) and in its native form (2.35 A resolution; R = 0.187, R(free) = 0.232). CONCLUSIONS: These are the first structures of a member of the medically important group II Shiga-like toxins to be reported. The structures confirm the previous observation of multiple binding sites on each SLT monomer, although binding site 3 is not occupied in the GT3 structure. Analysis of the binding properties of mutants suggests that site 3 is a secondary Gb(4)-binding site. The two mutated residues are located appropriately to interact with the extra betaGalNAc residue on Gb(4). Differences in the binding sites provide a molecular basis for understanding the tissue specificities and pathogenic mechanisms of members of the SLT family.     

A mutational analysis of the globotriaosylceramide-binding sites of verotoxin VT1.

Escherichia coli verotoxin, also known as Shiga-like toxin, binds to eukaryotic cell membranes via the glycolipid Gb(3) receptors which present the P(k) trisaccharide Galalpha(1-4)Galbeta(1-4)Glcbeta. Crystallographic studies have identified three P(k) trisaccharide (P(k)-glycoside) binding sites per verotoxin 1B subunit (VT1B) monomer while NMR studies have identified binding of P(k)-glycoside only at site 2. To understand the basis for this difference, we studied binding of wild type VT1B and VT1B mutants, defective at one or more of the three sites, to P(k)-glycoside and pentavalent P(k) trisaccharide (pentaSTARFISH) in solution and Gb(3) presented on liposomal membranes using surface plasmon resonance. Site 2 was the key site in terms of free trisaccharide binding since mutants altered at sites 1 and 3 bound this ligand with wild type affinity. However, effective binding of the pentaSTARFISH molecule also required a functional site 3, suggesting that site 3 promotes pentavalent binding of linked trisaccharides at site 1 and site 2. Optimal binding to membrane-associated Gb(3) involved all three sites. Binding of all single site mutants to liposomal Gb(3) was weaker than wild type VT1B binding. Site 3 mutants behaved as if they had reduced ability to enter into high avidity interactions with Gb(3) in the membrane context. Double mutants at site 1/site 3 and site 2/site 3 were completely inactive in terms of binding to liposomal Gb(3,) even though the site 1/site 3 mutant bound trisaccharide with almost wild type affinity. Thus site 2 alone is not sufficient to confer high avidity binding to membrane-localized Gb(3). Cytotoxic activity paralleled membrane glycolipid binding. Our data show that the interaction of verotoxin with the Gb(3) trisaccharide is highly context dependent and that a membrane environment is required for biologically relevant studies of the interaction.     

The identification of three biologically relevant globotriaosyl ceramide receptor binding sites on the Verotoxin 1 B subunit.

The Verotoxin 1 (VT1) B subunit binds to the glycosphingolipid receptor globotriaosylceramide (Gb3). Receptor-binding specificity is associated with the terminally linked Galalpha(1-4) Galbeta disaccharide sequence of the receptor. Recently, three globotriose (Galalpha[1-4] Galbeta [1-4] Glcbeta) binding sites per B-subunit monomer were identified by crystallography. Two of these sites (sites I and II) are located adjacent to phenylalanine-30. Site I was originally predicted as a potential Gb3 binding site on the basis of sequence conservation, and site II was additionally predicted based on computer modelling and receptor docking. The third (site III) was also identified by crystallography and is located at the N-terminal end of the alpha-helix. To determine the biological significance of sites II and III, and to support our previous findings of the significance of site I, we examined the binding properties and cytotoxicity of VT1 mutants designed to block Gb3 binding at each site selectively. The Scatchard analysis of saturation-binding data for each mutant revealed that only the amino acid substitutions predicted to affect site I (D-17E) or site II (G-62T) caused reductions in the binding affinity and capacity of VT1 for Gb3. Similarly, those mutations at sites I and II also caused significant reductions in both Vero and MRC-5 cell cytotoxicity (by seven and five logs, respectively, for G-62T and by four and two logs, respectively, for D-17E). In contrast, the substitution of alanine for W-34 at site III did not reduce the high-affinity binding of the B subunit, despite causing a fourfold reduction in the receptor-binding capacity. The corresponding mutant W-34A holotoxin had a two-log reduction in cytotoxicity on Vero cells and no statistically significant reduction on MRC-5 cells. We conclude that the high-affinity receptor binding most relevant for cell cytotoxicity occurs at sites I and II. In contrast, site III appears to mediate the recognition of additional Gb3 receptor epitopes but with lower affinity. Our results support the significance of the indole ring of W-34 for binding at this site.     

Apparent cooperativity in multivalent verotoxin-globotriaosyl ceramide binding: kinetic and saturation binding studies with [(125)I]verotoxin

Verotoxin (VT) binding to the trisaccharide portion of globotriaosyl ceramide (Gb(3)) is believed to be a crucial step in the development of hemolytic uremic syndrome (HUS) commonly known as 'Hamburger disease'. This interaction is the initial step in the binding process and defines the specificity of verotoxin binding to cellular membranes. Although molecular modeling, co-crystallization and co-NMR studies with VT and the trisaccharide moiety of Gb(3) have indicated potential multiple sites for Gb(3) binding, little is known about their direct effects on kinetic and equilibrium binding. Here we describe how the binding of radiolabeled VT ([(125)I]VT1) to Gb(3) in a microtiter well format, is driven by two different association rate constants (k(+1a)=0.0075 and k(+1b)=0.275 min(-1) nM(-1)) with the high affinity site representing 15% of the total specific binding sites. Binding was reversible at room temperature, reached equilibrium after 2-3 h, and non-specific binding was less than 5%. Equilibrium binding studies defined by [(125)I]VT1 saturation binding to 15, 30, 60 and 120 ng Gb(3)/well, showed the presence of a single site with dissociation constants (K(d)s) ranging between 0.5 and 3 nM. However, the maximum density of specific [(125)I]VT1 binding sites (B(max)) did not directly correlate with the Gb(3) concentration per well: the most[(125)I]VT1 binding was observed for 60 ng Gb(3) (B(max)=1.28 nM; compared to 0. 23 nM for 30 ng Gb(3) and 0.65 nM for 120 ng Gb(3)). Furthermore, while Hill coefficients (n(H)) for 15, 30 and 120 ng Gb(3) were close to unity indicating single interactions, for the saturation isotherm for 60 ng Gb(3)/well n(H) was 1.4. Subsequent Scatchard analysis yielded a concave downward curve for [(125)I]VT1 binding to 60 ng Gb(3)/well, suggesting positive co-operativity. We present, for the first time, conclusive binding data confirming the presence of at least two discrete Gb(3) binding sites: these multivalent interactions between verotoxin VT-1 and Gb(3) were described by association reactions driven by two distinct rate constants, as well as by the positive co-operativity governing binding at a restricted receptor concentration. These results imply that the concentration of Gb(3) on the surface of target cells can have a complex, non-linear effect on verotoxin binding and thereby, on sensitivity to cytotoxicity.     

Solution structure of a phage-derived peptide antagonist in complex with vascular endothelial growth factor

Vascular endothelial growth factor (VEGF) is a potent endothelial cell-specific mediator of angiogenesis and vasculogenesis. VEGF is involved pathologically in cancer, proliferative retinopathy and rheumatoid arthritis, and as such represents an important therapeutic target. Three classes of disulfide-constrained peptides that antagonize binding of the VEGF dimer to its receptors, KDR and Flt-1, were identified previously using phage display methods. NMR studies of a representative peptide from the most potent class of these peptide antagonists, v107 (GGNECDAIRMWEWECFERL), were undertaken to characterize its interactions with VEGF. v107 has no defined structure free in solution, but binding to VEGF induces folding of the peptide. The solution structure of the VEGF receptor-binding domain-v107 complex was determined using 3940 (1970 per VEGF monomer) internuclear distance and 476 (238 per VEGF monomer) dihedral angle restraints derived from NMR data obtained using samples containing either (13)C/(15)N-labeled protein plus excess unlabeled peptide or (13)C/(15)N-labeled peptide plus excess unlabeled protein. Residual dipolar coupling restraints supplemented the structure determination of the complex and were found to increase significantly both the global precision of VEGF in the complex and the agreement with available crystal structures of VEGF. The calculated ensemble of structures is of high precision and is in excellent agreement with the experimental restraints. v107 has a turn-helix conformation with hydrophobic residues partitioned to one face of the peptide and polar or charged residues at the other face. Contacts between two v107 peptides and the VEGF dimer are mediated by primarily hydrophobic side-chain interactions. The v107-binding site on VEGF overlaps partially with the binding site of KDR and is similar to that for domain 2 of Flt-1. The structure of the VEGF-v107 complex provides new insight into how binding to VEGF can be achieved that may be useful for the design of small molecule antagonists.     

Localization of the binding site for modified Gb3 on verotoxin 1 using fluorescence analysis.

Verotoxins (VTs) from Escherichia coli elicit human vascular disease as a consequence of specific binding to globotriaosylceramide (Gb3) receptors on endothelial cell surfaces. Molecular models based on the VT1 crystal structure were used previously to investigate the structural basis for receptor recognition by VT1 and other verotoxins. Interestingly, these model-based predictions of glycolipid binding to VT1 differ somewhat from recently published structural data from cocrystals of the VT1 B-subunit (VT1B) and an analogue of the sugar moiety of Gb3. In this study, fluorescence spectroscopy was used to test model-based predictions of the location of Gb3 binding on the B-subunit pentamer of VT1. Resonance energy transfer was used to calculate the distance from a coumarin probe used to replace the acyl tail of Gb3 and the single tryptophan residue (Trp34) present within each VT1B monomer. The observed energy transfer efficiency (greater than 95%) suggests that these two moieties are approximately 13.3 A apart when a single distance is assumed. This distance is consistent with proposed models for the fit of Gb3 within the "cleft site" of the VT1 B-subunit. When the distances from Trp34 to the other coumarinGb3 molecules (bound to each of the four remaining monomers within the VT1B pentamer) are taken into consideration, it appears likely that the coumarin-modified Gb3 analogue used in this study associates with the previously proposed receptor binding site II of VT1. This is consistent with an observed binding preference of VT2c for coumarinGb3. To provide additional information on the association of Gb3 with the VT1 B-subunit, the influence of Gb3 glycolipid binding on the accessibility of Trp34 to different quenching agents in solution was then examined. Taken together, the data suggest that coumarin-labeled Gb3 preferentially binds to site II on VT1 in a position that is consistent with the previously described molecular models.     

Two-dimensional structures of the Shiga toxin B-subunit and of a chimera bound to the glycolipid receptor Gb3

The B-subunit of Shiga toxin has been demonstrated as a powerful vector for carrying attached peptides into cells for intracellular transport studies and for medical research. We have investigated the structure of the B-subunit and of a chimera bearing a peptide extension, bound to the membranous lipidic receptor, the globotriaosylceramide (Gb3). Two-dimensional crystals of both B-subunits have been obtained by the lipid layer method and projection maps have been calculated at 8.5A resolution from ice-embedded samples. The B-subunits as the chimera are organized in a pentameric form similar to the X-ray structure of the B-subunit not bound to Gb3. A difference map of both proteins has been calculated in which no density could be attributed to the peptide extension. Cross-correlations with projections of the B-subunit X-ray structure revealed that pentamers in the 2D crystals were oriented with their binding sites pointing to the lipid layer. Thus, it is likely that the peptide extension was disordered and confined to the surface of the pentamer opposite to the Gb3 binding sites. This location confirms the hypothesis that addition of peptide extension to the C-terminus conserves the ability of the modified B-subunit to bind the membranous receptor Gb3.     

Rotational resonance determination of the structure of an enzyme-inhibitor complex: phosphorylation of an (aminoalkyl)phosphinate inhibitor of D-alanyl-D-alanine ligase by ATP

We have used a newly developed solid-state NMR method, rotational resonance, to establish the structure of an inhibited complex formed upon reaction of D-alanyl-D-alanine ligase, ATP, and the aminoalkyl dipeptide analogue [1(S)-aminoethyl][2-carboxy-2(R)-methyl-1- ethyl]phosphinic acid (Ib). Analogue Ib was determined to be an ATP-dependent, slow-binding inhibitor of the D-Ala-D-Ala ligase from Salmonella typhimurium, with an enzyme-inhibitor half-life of 17 days at 37 degrees C. The inhibited complex shows a 31P NMR spectrum which is very different from that which would arise from a mixture of the free inhibitor and ATP. Four well-resolved lines were observed: two (at -8 and -14 ppm) are assignable as the phosphates of ADP, the third is assignable to an inhibitor resonance (at 53 ppm) that shifts by approximately 19 ppm on binding, and the fourth is assignable to a resonance (at -3 ppm) due to a polyphosphate or phosphate ester moiety. At rotational resonance the spectrum shows evidence for strong dipolar couplings between the phosphinate phosphorus and a phosphate ester species. The dipolar coupling between the phosphorus signals at 53 and -3 ppm was measured at rotational resonance by use of numerical simulations of both the line shape of the signal and the profile of magnetization transfer between the two sites. The measured coupling, 1.0 +/- 0.2 kHz, indicates that the two species are bridged in a P-O-P linkage, with a P-P through-space distance of 2.7 +/- 0.2 A. This proves that the mechanism of inactivation involves phosphorylation of the enzyme-bound inhibitor by ATP to form a phosphoryl-phosphinate adduct.     

Assessment of the number of nucleotide binding sites on chloroplast coupling factor 1 by the continuous variation method

The method of continuous variation (Job plot analysis) and difference absorbance spectroscopy were used to investigate the binding of 2'(3')-(trinitrophenyl)-ADP and -ATP to chloroplast coupling factor 1 (CF1). Experiments performed at a low total concentration (30 microM) of nucleotide and enzyme binding sites (assuming three or four binding sites per CF1) could be interpreted in terms of approximately three nucleotide binding sites per CF1. At higher total concentrations (100 and 400 microM), the number of apparent binding sites increased to almost four. Computer-generated Job plots, using a protein-ligand complex formation scheme of n independent, nonequivalent binding sites, gave good fits to the experimental data at all concentrations when four binding sites were modeled. The dissociation constant of the fourth site was estimated to be approximately 20 microM. Additional nucleotide binding sites were not directly observed by this method and, if they exist, have very weak binding affinities (dissociation constants greater than approximately 1 mM).     

The structural basis for molecular recognition by the vitamin B 12 RNA aptamer

Previous solution structures of ligand-binding RNA aptamers have shown that molecular recognition is achieved by the folding of an initially unstructured RNA around its cognate ligand, coupling the processes of RNA folding and binding. The 3 A crystal structure of the cyanocobalamin (vitamin B12) aptamer reported here suggests a different approach to molecular recognition in which elements of RNA secondary structure combine to create a solvent-accessible docking surface for a large, complex ligand. Central to this structure is a locally folding RNA triplex, stabilized by a novel three-stranded zipper. Perpendicular stacking of a duplex on this triplex creates a cleft that functions as the vitamin B12 binding site. Complementary packing of hydrophobic surfaces, direct hydrogen bonding and dipolar interactions between the ligand and the RNA appear to contribute to binding. The nature of the interactions that stabilize complex formation and the possible uncoupling of folding and binding for this RNA suggest a strong mechanistic similarity to typical protein-ligand complexes.     

The Structure of the Catalytic Domain of a Plant Cellulose Synthase and Its Assembly into Dimers

Cellulose microfibrils are para-crystalline arrays of several dozen linear (1→4)-β-d-glucan chains synthesized at the surface of the cell membrane by large, multimeric complexes of synthase proteins. Recombinant catalytic domains of rice (Oryza sativa) CesA8 cellulose synthase form dimers reversibly as the fundamental scaffold units of architecture in the synthase complex. Specificity of binding to UDP and UDP-Glc indicates a properly folded protein, and binding kinetics indicate that each monomer independently synthesizes single glucan chains of cellulose, i.e., two chains per dimer pair. In contrast to structure modeling predictions, solution x-ray scattering studies demonstrate that the monomer is a two-domain, elongated structure, with the smaller domain coupling two monomers into a dimer. The catalytic core of the monomer is accommodated only near its center, with the plant-specific sequences occupying the small domain and an extension distal to the catalytic domain. This configuration is in stark contrast to the domain organization obtained in predicted structures of plant CesA. The arrangement of the catalytic domain within the CesA monomer and dimer provides a foundation for constructing structural models of the synthase complex and defining the relationship between the rosette structure and the cellulose microfibrils they synthesize.     

Synthesis of an artificial glycoconjugate polymer carrying Pk-antigenic trisaccharide and its potent neutralization activity against Shiga-like toxin.

Fluorescence-labeled glycoconjugate polymers carrying carbohydrate segments of a globotriaosyl ceramide (Gb3) were synthesized and subjected to biological assays using Escherichia coli O-157 strains and Shiga-like toxins (Stx-I and Stx-II). For the fluorescence labeling, a new polymerizable fluorescent monomer with a TBMB carbonyl chromophore (Ex. 325 nm, Em. 410 nm) was designed. A glycosyl monomer of the trisaccharide segment of Gb3 was prepared from p-nitrophenyl beta-lactoside and copolymerized with acrylamide and the fluorescent monomer to prepare a fluorescence-labeled glycoconjugate copolymer carrying [alpha-D-galactopyranosyl-(1-->4)-beta-D-galactopyranosyl]-(1-->4)-beta- D-glucopyranoside. The polymer showed potent neutralization activity against Stx-I and also binding activity onto E. coli O-157 strains.     

Carbohydrate Conformation and Lipid Condensation in Monolayers Containing Glycosphingolipid Gb3: Influence of Acyl Chain Structure

Globotriaosylceramide (Gb3), a glycosphingolipid found in the plasma membrane of animal cells, is the endocytic receptor of the bacterial Shiga toxin. Using x-ray reflectivity (XR) and grazing incidence x-ray diffraction (GIXD), lipid monolayers containing Gb3 were investigated at the air-water interface. XR probed Gb3 carbohydrate conformation normal to the interface, whereas GIXD precisely characterized Gb3’s influence on acyl chain in-plane packing and area per molecule (APM). Two phospholipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), were used to study Gb3 packing in different lipid environments. Furthermore, the impact on monolayer structure of a naturally extracted Gb3 mixture was compared to synthetic Gb3 species with uniquely defined acyl chain structures. XR results showed that lipid environment and Gb3 acyl chain structure impact carbohydrate conformation with greater solvent accessibility observed for smaller phospholipid headgroups and long Gb3 acyl chains. In general, GIXD showed that Gb3 condensed phospholipid packing resulting in smaller APM than predicted by ideal mixing. Gb3’s capacity to condense APM was larger for DSPC monolayers and exhibited different dependencies on acyl chain structure depending on the lipid environment. The interplay between Gb3-induced changes in lipid packing and the lipid environment’s impact on carbohydrate conformation has broad implications for glycosphingolipid macromolecule recognition and ligand binding.     

Effect of anthraquinone dyes and evaluation of the kinetic mechanism of yeast phosphoglycerate kinase.

Cibacron Blue 3G-A (CB3G-A, I) was investigated as a ternary complex analogue of lactate dehydrogenase and phosphoglycerate kinase as had been suggested earlier (Stellwagen, E. (1977) Accts. Chem. Res. 10, 92-98). CB3G-A and Procion Brilliant Blue (PBB, II), a structural isomer of the Cibacron dye without the sulfonated benzoyl moiety, were attached covalently to Sepharose CL-6B. The two enzymes were adsorbed to the columns and then eluted by substrates in various combinations. CB3G-A and PBB interact similarly with the two enzymes in spite of the structural differences between the dyes indicating that the specific structure of CB3G-A is not a ternary complex analogue. Inhibition studies of phosphoglycerate kinase by CB3G-A suggest that 2 molecules of dye bind per monomer and are consistent with multiple substrate binding sites. It is suggested that the kinetic mechanism of phosphoglycerate kinase is best described as steady state random.     

Carbohydrate Conformation and Lipid Condensation in Monolayers Containing Glycosphingolipid Gb3: Influence of Acyl Chain Structure

Globotriaosylceramide (Gb3), a glycosphingolipid found in the plasma membrane of animal cells, is the endocytic receptor of the bacterial Shiga toxin. Using x-ray reflectivity (XR) and grazing incidence x-ray diffraction (GIXD), lipid monolayers containing Gb3 were investigated at the air-water interface. XR probed Gb3 carbohydrate conformation normal to the interface, whereas GIXD precisely characterized Gb3’s influence on acyl chain in-plane packing and area per molecule (APM). Two phospholipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), were used to study Gb3 packing in different lipid environments. Furthermore, the impact on monolayer structure of a naturally extracted Gb3 mixture was compared to synthetic Gb3 species with uniquely defined acyl chain structures. XR results showed that lipid environment and Gb3 acyl chain structure impact carbohydrate conformation with greater solvent accessibility observed for smaller phospholipid headgroups and long Gb3 acyl chains. In general, GIXD showed that Gb3 condensed phospholipid packing resulting in smaller APM than predicted by ideal mixing. Gb3’s capacity to condense APM was larger for DSPC monolayers and exhibited different dependencies on acyl chain structure depending on the lipid environment. The interplay between Gb3-induced changes in lipid packing and the lipid environment’s impact on carbohydrate conformation has broad implications for glycosphingolipid macromolecule recognition and ligand binding.     

Solution structure of the 30 kDa polysulfide-sulfur transferase homodimer from Wolinella succinogenes

The periplasmic polysulfide-sulfur transferase (Sud) protein encoded by Wolinella succinogenes is involved in oxidative phosphorylation with polysulfide-sulfur as a terminal electron acceptor. The polysulfide-sulfur is covalently bound to the catalytic Cys residue of the Sud protein and transferred to the active site of the membranous polysulfide reductase. The solution structure of the homodimeric Sud protein has been determined using heteronuclear multidimensional NMR techniques. The structure is based on NOE-derived distance restraints, backbone hydrogen bonds, and torsion angle restraints as well as residual dipolar coupling restraints for a refinement of the relative orientation of the monomer units. The monomer structure consists of a five-stranded parallel beta-sheet enclosing a hydrophobic core, a two-stranded antiparallel beta-sheet, and six alpha-helices. The dimer fold is stabilized by hydrophobic residues and ion pairs found in the contact area between the two monomers. Similar to rhodanese enzymes, Sud catalyzes the transfer of the polysulfide-sulfur to the artificial acceptor cyanide. Despite their similar functions and active sites, the amino acid sequences and structures of these proteins are quite different.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

Determination of the free-energy coupling between ATP and an affinity label attached to rabbit muscle phosphofructokinase

The smallest enzymatically active form of rabbit muscle phosphofructokinase is a tetramer of four identical or nearly identical monomers. The enzyme is inhibited by ATP, and this inhibition by ATP is relieved by the activating adenine nucleotides adenosine cyclic 3',5'-phosphate, AMP, and ADP. Each monomer contains one binding site specific for the inhibitor ATP and another site specific for the activating adenine nucleotides. The enzyme can also be activated by covalently labeling the activating adenine nucleotide binding sites with the affinity label 5'-[p-(fluorosulfonyl)benzoyl]adenosine. These activator binding sites on the enzyme have been covalently labeled to various degrees, ranging from an average value of less than one label per tetramer to four labels per tetramer, and the free-energy coupling, delta Gxy, between the covalently bound affinity label and ATP binding at the inhibitory site was determined. For enzyme preparations containing four labels per tetramer, delta Gxy is approximately 1 kcal/mol at pH 6.95 and 25 degrees C. A very significant free-energy coupling is observed in those preparations containing an average of one label per tetramer and less, and the change in delta Gxy in going from native tetramers to ones containing an average of two labels per tetramer is twice as great as the change in delta Gxy observed in going from tetramers containing an average of two labels per tetramer to ones containing four labels per tetramer, suggesting that modification of the final two monomers in the tetramer contributes much less to the antagonistic effect on ATP binding than does modification of the first two monomers in the tetramer.     

Domain-swapped structure of the potent antiviral protein griffithsin and its mode of carbohydrate binding

The crystal structure of griffithsin, an antiviral lectin from the red alga Griffithsia sp., was solved and refined at 1.3 A resolution for the free protein and 0.94 A for a complex with mannose. Griffithsin molecules form a domain-swapped dimer, in which two beta strands of one molecule complete a beta prism consisting of three four-stranded sheets, with an approximate 3-fold axis, of another molecule. The structure of each monomer bears close resemblance to jacalin-related lectins, but its dimeric structure is unique. The structures of complexes of griffithsin with mannose and N-acetylglucosamine defined the locations of three almost identical carbohydrate binding sites on each monomer. We have also shown that griffithsin is a potent inhibitor of the coronavirus responsible for severe acute respiratory syndrome (SARS). Antiviral potency of griffithsin is likely due to the presence of multiple, similar sugar binding sites that provide redundant attachment points for complex carbohydrate molecules present on viral envelopes.