Differential effects of mutant SOD1 on protein structure of skeletal muscle and spinal cord of familial amyotrophic lateral sclerosis: Role of chaperone network

Protein misfolding is considered to be a potential contributing factor for motor neuron and muscle loss in diseases like Amyotrophic lateral sclerosis (ALS). Several independent studies have demonstrated using over-expressed mutated Cu/Zn-superoxide dismutase (mSOD1) transgenic mouse models which mimic familial ALS (f-ALS), that both muscle and motor neurons undergo degeneration during disease progression. However, it is unknown whether protein conformation of skeletal muscle and spinal cord is equally or differentially affected by mSOD1-induced toxicity. It is also unclear whether heat shock proteins (Hsp′s) differentially modulate skeletal muscle and spinal cord protein structure during ALS disease progression. We report three intriguing observations utilizing the f-ALS mouse model and cell-free in vitro system; (i) muscle proteins are equally sensitive to misfolding as spinal cord proteins despite the presence of low level of soluble and absence of insoluble G93A protein aggregate, unlike in spinal cord, (ii) Hsp′s levels are lower in muscle compared to spinal cord at any stage of the disease, and (iii) G93ASOD1 enzyme-induced toxicity selectively affects muscle protein conformation over spinal cord proteins. Together, these findings strongly suggest that differential chaperone levels between skeletal muscle and spinal cord may be a critical determinant for G93A-induced protein misfolding in ALS.     

Divalent cations stabilize GroEL under conditions of oxidative stress

The divalent cations Mg²⁺, Mn²⁺, Zn²⁺, Ca²⁺, and Ni²⁺ were found to protect against proteolysis a form of GroEL (ox-GroEL) prepared by exposing GroEL for 16 h to 6 mM hydrogen peroxide (H₂O₂). K⁺ and other monovalent cations did not have any effect. Divalent cations also induced a conformational change of ox-GroEL that led to the decrease of its large exposed hydrophobic surfaces (exposed with H₂O₂). Ox-GroEL incubated with a divalent cation behaved like N-GroEL in that it could transiently interact with H₂O₂-inactivated rhodanese (ox-rhodanese), whereas ox-GroEL alone could strongly interact with ox-rhodanese. Although, ox-GroEL incubated with a divalent cation could not recover the ATPase activity (66%) lost with H₂O₂, it could facilitate the reactivation of ox-rhodanese (>86% of active rhodanese recovered), without requiring ATP or the co-chaperonin, GroES. This is the first report to demonstrate a role for the divalent cations on the structure and function of ox-GroEL.     

Trimethylamine N-oxide suppresses the activity of the actomyosin motor

Background

During actomyosin interactions, the transduction of energy from ATP hydrolysis to motility seems to occur with the modulation of hydration. Trimethylamine N-oxide (TMAO) perturbs the surface of proteins by altering hydrogen bonding in a manner opposite to that of urea. Hence, we focus on the effects of TMAO on the motility and ATPase activation of actomyosin complexes.

Methods

Actin and heavy meromyosin (HMM) were prepared from rabbit skeletal muscle. Structural changes in HMM were detected using fluorescence and circular dichroism spectroscopy. The sliding velocity of rhodamine-phalloidin-bound actin filaments on HMM was measured using an in vitro motility assay. ATPase activity was measured using a malachite green method.

Results

Although TMAO, unlike urea, stabilized the HMM structure, both the sliding velocity and ATPase activity of acto-HMM were considerably decreased with increasing TMAO concentrations from 0–1.0 M. Whereas urea-induced decreases in the structural stability of HMM were recovered by TMAO, TMAO further decreased the urea-induced decrease in ATPase activation. Urea and TMAO were found to have counteractive effects on motility at concentrations of 0.6 M and 0.2 M, respectively.

Conclusions

The excessive stabilization of the HMM structure by TMAO may suppress its activities; however, the counteractive effects of urea and TMAO on actomyosin motor activity is distinct from their effects on HMM stability.

General significance

The present results provide insight into not only the water-related properties of proteins, but also the physiological significance of TMAO and urea osmolytes in the muscular proteins of water-stressed animals.     

GAPDH is conformationally and functionally altered in association with oxidative stress in mouse models of amyotrophic lateral sclerosis

It is proposed that conformational changes induced in proteins by oxidation can lead to loss of activity or protein aggregation through exposure of hydrophobic residues and alteration in surface hydrophobicity. Because increased oxidative stress and protein aggregation are consistently observed in amyotrophic lateral sclerosis (ALS), we used a 4,4′-dianilino-1,1′-binaphthyl-5,5′-disulfonic acid (BisANS) photolabeling approach to monitor changes in protein unfolding in vivo in skeletal muscle proteins in ALS mice. We find two major proteins, creatine kinase (CK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), conformationally affected in the ALS G93A mouse model concordant with a 43% and 41% reduction in enzyme activity, respectively. This correlated with changes in conformation and activity that were detected in CK and GAPDH with in vitro oxidation. Interestingly, we found that GAPDH, but not CK, is conformationally and functionally affected in a longer-lived ALS model (H46R/H48Q), exhibiting a 22% reduction in enzyme activity. We proposed a reaction mechanism for BisANS with nucleophilic amino acids such as lysine, serine, threonine, and tyrosine, and BisANS was found to be primarily incorporated to lysine residues in GAPDH. We identified the specific BisANS incorporation sites on GAPDH in nontransgenic (NTg), G93A, and H46R/H48Q mice using liquid chromatography-tandem mass spectrometry analysis. Four BisANS-containing sites (K52, K104, K212, and K248) were found in NTg GAPDH, while three out of four of these sites were lost in either G93A or H46R/H48Q GAPDH. Conversely, eight new sites (K2, K63, K69, K114, K183, K251, S330, and K331) were found on GAPDH for G93A, including one common site (K114) for H46R/H48Q, which is not found on GAPDH from NTg mice. These data show that GAPDH is differentially affected structurally and functionally in vivo in accordance with the degree of oxidative stress associated with these two models of ALS.     

The role of resveratrol and melatonin in the nitric oxide and its oxidation products mediated functional and structural modifications of two glycolytic enzymes: GAPDH and LDH

Background

Nitric oxide is a well-known gaseous signaling molecule and protein modifying agent. However, at higher concentrations or during oxidative stress nitric oxide may exert some deleterious effects on protein structure and function. Here we investigated the influence of nitric oxide and products of its oxidation on two glycolytic enzymes: GAPDH and LDH under in vitro nitrosative stress conditions. Secondly, we applied natural antioxidants: melatonin and resveratrol to examine their effects on the enzymes under studied conditions.

Effect of phosphorylation on alpha B-crystallin: differences in stability, subunit exchange and chaperone activity of homo and mixed oligomers of alpha B-crystallin and its phosphorylation-mimicking mutant

Phosphorylation appears to be one of the modulators of chaperone functions of small heat shock proteins. However, the role of phosphorylation is not completely understood. We have investigated the structural and functional consequences of a phosphorylation-mimicking mutation in αB-crystallin, a small heat shock protein with chaperone activity. We have used a phosphorylation-mimicking mutant, 3DαB-crystallin, in which all the three phosphorylatable serine residues are replaced with aspartic acid. 3DαB-Crystallin showed enhanced chaperone-like activity towards DTT-induced aggregation of insulin, heat-induced aggregation of citrate synthase and SDS-induced amyloid fibril formation of α-synuclein. Fluorescence and circular dichroism spectroscopic studies showed that 3DαB-crystallin exhibits lower stability towards urea-induced denaturation compared to αB-crystallin. Subunit exchange studies using fluorescence resonance energy transfer showed that 3DαB-crystallin exhibits an observable increase in subunit exchange compared to αB-crystallin. Since only part of αB-crystallin is phosphorylated in vivo, our subunit exchange studies indicate that formation of mixed oligomers between the unphosphorylated and phosphorylated subunits are likely to play a role in vivo. Our study shows that mixed-oligomer formation modulates the chaperone-like activity. We propose that the degree of phosphorylation of the αB-crystallin oligomers and temperature are key modulators to achieve a wide range of chaperone capabilities of the small heat shock protein, αB-crystallin.     

The type II Ca/calmodulin-dependent protein kinases are involved in the regulation of cell wall integrity and oxidative stress response in Candida albicans

The type II Ca²⁺/calmodulin-dependent protein kinases (CaMKs) are thought to play a vital role in cellular regulation in mammalian cells. Two genes CMK1 and CMK2 in the Candida albicans genome encode homologues of mammalian CaMKs. In this work, we constructed the cmk1Δ/Δ, the cmk2Δ/Δ and the cmk1Δ/Δcmk2Δ/Δ mutants and found that CaMKs function in cell wall integrity (CWI) and cellular redox regulation. Loss of either CMK1 or CMK2, or both resulted in increased expression of CWI-related genes under Calcofluor white (CFW) treatment. Besides, CaMKs are essential for the maintenance of cellular redox balance. Disruption of either CMK1 or CMK2, or both not only led to a significant increase of intracellular ROS levels, but also led to a decrease of the mitochondrial membrane potential (MMP), suggesting the important roles that CaMKs play in the maintenance of the mitochondrial function.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.     

Rescue of the neuroblastoma mutant of the human nucleoside diphosphate kinase A/nm23-H1 by the natural osmolyte trimethylamine-N-oxide

The point mutation S120G in human nucleoside diphosphate kinase A, identified in patients with neuroblastoma, causes a protein folding defect. The urea-unfolded protein cannot refold in vitro, and accumulates as a molten globule folding intermediate. We show here that the trimethylamine-N-oxide (TMAO) corrects the folding defect and stimulated subunit association. TMAO also substantially increased the stability to denaturation by urea of both wild-type and S120G mutant. A non-native folding intermediate accumulated in the presence of 4.5-7 M urea and of 2 M TMAO. It was inactive, monomeric, contained some secondary structure but no tertiary structure and displayed a remarkable stability to denaturation.     

StarD4-mediated translocation of 7-hydroperoxycholesterol to isolated mitochondria: Deleterious effects and implications for steroidogenesis under oxidative stress conditions

StAR family proteins, including StarD4, play a key role in steroidogenesis by transporting cholesterol (Ch) into mitochondria for conversion to pregnenolone. Using a model system consisting of peroxidized cholesterol (7α-OOH)-containing liposomes as donors, we showed that human recombinant StarD4 accelerates 7α-OOH transfer to isolated liver mitochondria, and to a greater extent than Ch transfer. StarD4 had no effect on transfer of non-oxidized or peroxidized phosphatidylcholine, consistent with sterol ring specificity. StarD4-accelerated 7α-OOH transfer to mitochondria resulted in greater susceptibility to free radical lipid peroxidation and loss of membrane potential than in a non-StarD4 control. The novel implication of these findings is that in oxidative stress states, inappropriate StAR-mediated trafficking of peroxidized Ch in steroidogenic tissues could result in damage and dysfunction selectively targeted to mitochondria.     

Oxidizing substrate specificity of Mycobacterium tuberculosis alkyl hydroperoxide reductase E: kinetics and mechanisms of oxidation and overoxidation

Alkyl hydroperoxide reductase E (AhpE), a novel subgroup of the peroxiredoxin family, comprises Mycobacterium tuberculosis AhpE (MtAhpE) and AhpE-like proteins present in many bacteria and archaea, for which functional characterization is scarce. We previously reported that MtAhpE reacted ~ 10³ times faster with peroxynitrite than with hydrogen peroxide, but the molecular reasons for that remained unknown. Herein, we investigated the oxidizing substrate specificity and the oxidative inactivation of the enzyme. In most cases, both peroxidatic thiol oxidation and sulfenic acid overoxidation followed a trend in which those peroxides with the lower leaving-group pK_a reacted faster than others. These data are in agreement with the accepted mechanisms of thiol oxidation and support that overoxidation occurs through sulfenate anion reaction with the protonated peroxide. However, MtAhpE oxidation and overoxidation by fatty acid-derived hydroperoxides (~ 10⁸ and 10⁵ M^− 1 s^− 1, respectively, at pH 7.4 and 25 °C) were much faster than expected according to the Brønsted relationship with leaving-group pK_a. A stoichiometric reduction of the arachidonic acid hydroperoxide 15-HpETE to its corresponding alcohol was confirmed. Interactions of fatty acid hydroperoxides with a hydrophobic groove present on the reduced MtAhpE surface could be the basis of their surprisingly fast reactivity.