Precise detection of pH inside large unilamellar vesicles using membrane-impermeable dendritic porphyrin-based nanoprobes

Accurate real-time measurements of proton concentration gradients are pivotal to mechanistic studies of proton translocation by membrane-bound enzymes. Here we report a detailed characterization of the pH-sensitive fluorescent nanoprobe Glu³, which is well suited for pH measurements in microcompartmentalized biological systems. The probe is a polyglutamic porphyrin dendrimer in which multiple carboxylate termini ensure its high water solubility and prevent its diffusion across phospholipid membranes. The probe’s pK is in the physiological pH range, and its protonation can be followed ratiometrically by absorbance or fluorescence in the ultraviolet-visible spectral region. The usefulness of the probe was enhanced by using a semiautomatic titration system coupled to a charge-coupled device (CCD) spectrometer, enabling fast and accurate titrations and full spectral coverage of the system at millisecond time resolution. The probe’s pK was measured in bulk solutions as well as inside large unilamellar vesicles in the presence of physiologically relevant ions. Glu³ was found to be completely membrane impermeable, and its distinct spectroscopic features permit pH measurements inside closed membrane vesicles, enabling quantitative mechanistic studies of membrane-spanning proteins. Performance of the probe was demonstrated by monitoring the rate of proton leakage through the phospholipid bilayer in large vesicles with and without the uncoupler gramicidin present. Overall, as a probe for biological proton translocation measurements, Glu³ was found to be superior to the commercially available pH indicators.     

Automated screening for metabolites in complex mixtures using 2D COSY NMR spectroscopy

One of the greatest challenges in metabolomics is the rapid and unambiguous identification and quantification of metabolites in a biological sample. Although one-dimensional (1D) proton nuclear magnetic resonance (NMR) spectra can be acquired rapidly, they are complicated by severe peak overlap that can significantly hinder the automated identification and quantification of metabolites. Furthermore, it is currently not reasonable to assume that NMR spectra of pure metabolites are available a priori for every metabolite in a biological sample. In this paper we develop and report on tests of methods that assist in the automatic identification of metabolites using proton two-dimensional (2D) correlation spectroscopy (COSY) NMR. Given a database of 2D COSY spectra for the metabolites of interest, our methods provide a list sorted by a heuristic likelihood of the metabolites present in a sample that has been analyzed using 2D COSY NMR. Our models attempt to correct the displacement of the peaks that can occur from one sample to the next, due to pH, temperature and matrix effects, using a statistical and chemical model. The correction of one peak can result in an implied correction of others due to spin–spin coupling. Furthermore, these displacements are not independent: they depend on the relative position of functional groups in the molecule. We report experimental results using defined mixtures of amino acids as well as real complex biological samples that demonstrate that our methods can be very effective at automatically and rapidly identifying metabolites.     

An NMR method towards the routine chiral determination of natural products

State-of-the-art structure elucidation and dereplication of natural products is incomplete without the determination of enantiomeric purity, especially when compounds are to be biologically evaluated. An NMR procedure is presented in order to distinguish and determine enantiomers in natural product samples. The method is also of value in the structure elucidation process by providing information, which is otherwise of a non-routine nature. Using enantiomeric 1-acetoxychavicol acetates and carvones as model compounds, this study presents a chiral NMR procedure that allows distinction and determination of chiral antipodes of natural products in a routine set-up.     

The revised NMR chemical shift data of carrageenans

A new set of (13)C and (1)H NMR chemical shifts of most common carrageenan types is given relative to DSS as the internal standard according to the IUPAC recommendations. Moreover, the chemical shifts of characteristic signals for pyruvate acetal and floridean starch are reported. Additionally, chemical shifts of common internal standards, such as methanol, DMSO and acetone, were measured at different temperatures and pH values.     

Observation of carbon labelling in cell metabolites using proton spin echo NMR

A heteronuclear spin echo experiment is described which allows detection of both ¹²C and ¹³C labelled species in a ¹H spectrum. Fractional labelling of ¹³C labelled metabolites can thus be observed. The method is illustrated with a study of the exchange of ¹³C label between the methyl groups of alanine and pyruvate catalysed by the enzyme alanine aminotransferase (E.C. 2.6.1.2) both in the human erythrocyte and $\text{in}\text{,}\text{vitro}$.     

NMR spectroscopy of hydroxyl protons in aqueous solutions of peptides and proteins

Summary Hydroxyl groups of serine and threonine, and to some extent also tyrosine are usually located on or near the surface of proteins. NMR observations of the hydroxyl protons is therefore of interest to support investigations of the protein surface in solution, and knowledge of the hydroxyl NMR lines is indispensable as a reference for studies of protein hydration in solution. In this paper, solvent suppression schemes recently developed for observation of hydration water resonances were used to observe hydroxyl protons of serine, threonine and tyrosine in aqueous solutions of small model peptides and the protein basic pancreatic trypsin inhibitor (BPTI). The chemical shifts of the hydroxyl protons of serine and threonine were found to be between 5.4 and 6.2 ppm, with random-coil shifts at 4°C of 5.92 ppm and 5.88 ppm, respectively, and those of tyrosine between 9.6 and 10.1 ppm, with a random-coil shift of 9.78 ppm. Since these spectral regions are virtually free of other polypeptide¹H NMR signals, cross peaks with the hydroxyl protons are usually well separated even in homonuclear two-dimensional¹H NMR spectra. To illustrate the practical use of hydroxyl proton NMR in polypeptides, the conformations of the side-chain hydroxyl groups in BPTI were characterized by measurements of nuclear Overhauser effects and scalar coupling constants involving the hydroxyl protons. In addition, hydroxyl proton exchange rates were measured as a function of pH, where simple first-order rate processes were observed for both acid- and base-catalysed exchange of all but one of the hydroxyl-bearing residues in BPTI. For the conformations of the individual Ser, Thr and Tyr side chains characterized in the solution structure with the use of hydroxyl proton NMR, both exact coincidence and significant differences relative to the corresponding BPTI crystal structure data were observed.[/p]     

Chemical shift assignments and secondary structure of the Grb2 SH2 domain by heteronuclear NMR spectroscopy

Summary The growth factor receptor-bound protein-2 (Grb2) is an adaptor protein that mediates signal transduction pathways. Chemical shift assignments were obtained for the SH2 domain of Grb2 by heteronuclear NMR spectroscopy, employing the uniformly ¹³C-/¹⁵N-enriched protein as well as the protein containing selectively ¹⁵N-enriched amino acids. Using the Chemical Shift Index (CSI) method, the chemical shift indices of four nuclei, ¹H, ¹³C, ¹³C and ¹³CO, were used to derive the secondary structure of the protein. Nuclear Overhauser enhancements (NOEs) were then employed to confirm the secondary structure. The CSI results were compared to the secondary structural elements predicted for the Grb2 SH2 domain from a sequence alignment [Lee et al. (1994) Structure, 2, 423–438]. The core structure of the SH2 domain contains an antiparallel -sheet and two -helices. In general, the secondary structural elements determined from the CSI method agree well with those predicted from the sequence alignment.Abbreviations crk viral p47^gag-crk - EGF epidermal growth factor - GAP GTPase-activating protein - PI3K phosphatidylinositol-3-kinase - PLC- phospholipase-C-, shc, src homologous and collagen - src sarcoma family of nonreceptor tyrosine kinase     

Complete H and C NMR chemical shift assignments of mono-, di-, and trisaccharides as basis for NMR chemical shift predictions of polysaccharides using the computer program casper

The computer program casper uses ¹H and ¹³C NMR chemical shift data of mono- to trisaccharides for the prediction of chemical shifts of oligo- and polysaccharides. In order to improve the quality of these predictions the ¹H and ¹³C, as well as ³¹P when applicable, NMR chemical shifts of 30 mono-, di-, and trisaccharides were assigned. The reducing sugars gave two distinct sets of NMR resonances due to the α- and β-anomeric forms. In total 35 ¹H and ¹³C NMR chemical shift data sets were obtained from the oligosaccharides. One- and two-dimensional NMR experiments were used for the chemical shift assignments and special techniques were employed in some cases such as 2D ¹H,¹³C-HSQC Hadamard Transform methodology which was acquired approximately 45 times faster than a regular t₁ incremented ¹H,¹³C-HSQC experiment and a 1D ¹H,¹H-CSSF-TOCSY experiment which was able to distinguish spin-systems in which the target protons were only 3.3 Hz apart. The ¹H NMR chemical shifts were subsequently refined using total line-shape analysis with the PERCH NMR software. The acquired NMR data were then utilized in the casper program (http://www.casper.organ.su.se/casper/) for NMR chemical shift predictions of the O-antigen polysaccharides from Klebsiella O5, Shigella flexneri serotype X, and Salmonella arizonae O62. The data were compared to experimental data of the polysaccharides from the two former strains and the lipopolysaccharide of the latter strain showing excellent agreement between predicted and experimental ¹H and ¹³C NMR chemical shifts.     

Changes in C NMR chemical shifts of DNA as a tool for monitoring drug interactions

The antibiotic drug, netropsin, was complexed with the DNA oligonucleotide duplex [d(GGTATACC)]₂ to explore the effects of ligand binding on the ¹³C NMR chemical shifts of the DNA base and sugar carbons. The binding mode of netrospin to TA-rich tracts of DNA has been well documented and served as an attractive model system. For the base carbons, four large changes in resonance chemical shifts were observed upon complex formation: −0.64 ppm for carbon 4 of either Ado4 or Ado6, 1.36 ppm for carbon 2 of Thd5, 1.33 ppm for carbon 5 of Thd5 and 0.94 for carbon 6 of Thd5. AdoC4 is covalently bonded to a heteroatom that is hydrogen bonded to netropsin; this relatively large deshielding is consistent with the known hydrogen bond formed at AdoN3. The three large shielding increases are consistent with hydrogen bonds to water in the minor groove being disrupted upon netropsin binding. For the DNA sugar resonances, large changes in chemical shifts were observed upon netropsin complexation. The 2′, 3′ and 5′ ¹³C resonances of Thd3 and Thd5 were shielded whereas those of Ado4 and Ado6 were deshielded; the ¹³C resonances of 1′ and 4′ could not be assigned. These changes are consistent with alteration of the dynamic pseudorotational states occupied by the DNA sugars. A significant alteration in the pseudorotational states of Ado4 or Ado6 must occur as suggested by the large change in chemical shift of −1.65 ppm of the C3′ carbon. In conclusion, ¹³C NMR may serve as a practical tool for analyzing structural changes in DNA-ligand complexes.     

Prospects for resonance assignments in multidimensional solid-state NMR spectra of uniformly labeled proteins

Summary The feasibility of assigning the backbone ¹⁵N and ¹³C NMR chemical shifts in multidimensional magic angle spinning NMR spectra of uniformly isotopically labeled proteins and peptides in unoriented solid samples is assessed by means of numerical simulations. The goal of these simulations is to examine how the upper limit on the size of a peptide for which unique assignments can be made depends on the spectral resolution, i.e., the NMR line widths. Sets of simulated three-dimensional chemical shift correlation spectra for artificial peptides of varying length are constructed from published liquid-state NMR chemical shift data for ubiquitin, a well-characterized soluble protein. Resonance assignments consistent with these spectra to within the assumed spectral resolution are found by a numerical search algorithm. The dependence of the number of consistent assignments on the assumed spectral resolution and on the length of the peptide is reported. If only three-dimensional chemical shift correlation data for backbone ¹⁵N and ¹³C nuclei are used, and no residue-specific chemical shift information, information from amino acid side-chain signals, and proton chemical shift information are available, a spectral resolution of 1 ppm or less is generally required for a unique assignment of backbone chemical shifts for a peptide of 30 amino acid residues.     

Molecular conformations of a disaccharide investigated using NMR spectroscopy

The molecular structure of -l-Rhap-(1→ 2)--l-Rhap-OMe has been investigated using conformation sensitive NMR parameters: cross-relaxation rates, scalar ³ J _CH couplings and residual dipolar couplings obtained in a dilute liquid crystalline phase. The order matrices of the two sugar residues are different, which indicates that the molecule cannot exist in a single conformation. The conformational distribution function, , related to the two glycosidic linkage torsion angles and was constructed using the APME method, valid in the low orientational order limit. The APME approach is based on the additive potential (AP) and maximum entropy (ME) models. The analyses of the trajectories generated in molecular dynamics and Langevin dynamics (LD) computer simulations gave support to the distribution functions constructed from the experimental NMR parameters. It is shown that at least two conformational regions are populated on the Ramachandran map and that these regions exhibit very different molecular order.Electronic Supplementary Material Supplementary material is available for this article at and is accessible for authorized users.     

Determination of choline in erythrocytes using high-resolution proton nuclear magnetic resonance spectroscopy: Comparison with a choline oxidase method

Detailed operating conditions are reported for the determination of choline in human erythrocytes using proton nuclear magnetic resonance spectroscopy in conjunction with the inversion-recovery spin-echo pulse sequence. The results of the NMR method were in excellent agreement with those obtained using an enzymatic (choline oxidase) assay; however, they were approximately three times higher than those reported using gas chromatography/mass spectrometry techniques. The differences may be partly due to the method of preparing or sampling cells since there is a distribution of choline in cells of different ages. However, choline levels were not affected by the methods used in the present study for storing or preparing cells.     

Interaction of local anesthetics with small phospholipid vesicles investigated by proton NMR spectroscopy

The effects of the local anesthetics tetracaine, procaine (both charged at pH 6), and benzocaine (uncharged) on phospholipid liposomes have been investigated by 500 MHz ¹H NMR Spectroscopy. All the drugs reverse the Pr³⁺ induced shifts of phospholipid resonances in the same sequence as they are shifted by addition of Pr³⁺: choline POCH₂- > choline-CH₂N > choline-N(CH₃)₃ > glycerol > glycerol > acyl C₂ > acyl C₃. The drug effects result from incorporation of positive charges (tetracaine and procaine) and from the induction of a conformational change of the phospholipid head group via an action on the lipid glycerol backbone (benzocaine). From titration experiments with tetracaine on liposomes containing Pr³⁺ inside and outside is derived that the drug passes the bilayer by transverse diffusion. Tetracaine partitions outside/inside at a ratio of 21. Changes in linewidths of the drug resonances when incorporated into the liposomes allow the conclusion that the tetracaine molecule is located in an elongated way between the lipid acyl chains with its nitrogen group near the glycerol backbone. Benzocaine, showing strong effects on the line shapes of the protons on C₂ and C₃ of the lipid acyl chains is also located near the glycerol backbone, the region with the strongest hydrophobic forces.This work was supported by the Deutsche Forschungsgemeinschaft (SFB 30), Cardiology.     

NMR secondary structure of the plasminogen activator protein staphylokinase

Staphylokinase (Sak) is a 15.5 kDa protein secreted by several strains of Staphylococcusaureus. Due to its ability to convert plasminogen, the inactive proenzyme of the fibrinolyticsystem, into plasmin, Sak is presently undergoing clinical trials for blood clot lysis in thetreatment of thrombovascular disorders. With a view to developing a better understanding ofthe mode of action of Sak, we have initiated a structural investigation of Sak viamultidimensional heteronuclear NMR spectroscopy employing uniformly 15N- and 15N,13C-labelled Sak. Sequence-specific resonance assignments have been made employing 15N-editedTOCSY and NOE experiments and from HNCACB, CBCA(CO)NH, HBHA(CBCACO)NHand CC(CO)NH sets of experiments. From an analysis of the chemical shifts,3JHNH scalar coupling constants, NOEs and HN exchange data, the secondary structural elements of Sakhave been characterized.     

Changing proton concentrations at the surfaces of gravistimulated Phleum roots

The pH patterns at the surfaces of both vertically growing roots of Phleum pratense L. and roots tilted by 45° were recorded using H ⁺-sensitive microelectrodes. During vertical growth the root cap exhibited lower pH values than the meristematic zone. The highest pH values were found at the border between meristematic and elongation zones. In the apical part of the elongation zone the values strongly decreased basipetally. They reached a minimum value of pH 5.4–5.5 (medium pH of about 6.0) at a distance of 700 m from the root tip. This region of strongest acidification usually coincided with that of the highest relative rates of elongation. The region of the first visible curvature following gravistimulation was positioned at 100–200 m more apically. The pH values increased in the basal elongation zone towards the mature zone. The H⁺-flux pattern around a vertically growing Phleum root was characterized by high influxes in the meristematic zone and smaller effluxes in the elongation zone. Tilting the root by 45° induced changes in the pH values of the upper and lower sides of a Phleum root. At a distance of 300–500 m from the root tip, the upper side was strongly acidified while the pH of the lower side slightly increased compared with the values during vertical orientation. pH differences of up to 0.9 pH units between the two sides of a root were detected. These differences decreased basipetally and could not be measured more distant than 700–800 m from the tip. Compared with a vertically growing root, the H⁺-flux pattern of a Phleum root tilted by 45° exhibited effluxes on the entire upper organ flank while the pattern was scarcely altered on the lower side. The curvature-initiating zone in Phleum roots is positioned within that section of the root in which pH changes occur after tilting. The region of highest pH differences, however, is nearer to the apex of the root than the curvature-initiating zone. The pH changes began 8.2 min after a root had been tilted. The bending process started after 17.2 min, i.e. after double the time needed for differential acidification. After reorienting a root, which had just begun to bend, to its previous vertical position the inversion of the pH gradient could be measured within the same mean time of about 8 min. This is again significantly earlier than the beginning of the rebending process. The results indicate that, during the graviresponse, ionic movements occur much earlier than the changes in hormonal activities reported in the literature.Abbreviation CIZ curvature-initiating zone A preliminary report was presented at the 29th Plenary Meeting of the Committee on Space Research (COSPAR) in Washington D.C., USA, 28 Aug – 5 Sept 1992 (Zieschang and Sievers 1993)This work was supported by the Deutsche Forschungsgemeinschaft. We thank Professor H. Felle (Botanisches Institut, Universität Gießen, Gießen, FRG) for practical instructions concerning the method of H⁺-sensitive microelectrodes and Professor W. Simonis (Botanisches Institut, Universität Würzburg, Würzburg, FRG) for allowing to use the microelectrode amplifier.     

Application of γ-cyclodextrin to enantiomeric purity determination of a new 2-amino-tetralin derivative by 1H-NMR spectroscopy

γ-Cyclodextrin was used to perform chiral discrimination of (±)-5,6-diisobutyroyl-2-methylaminotetralin hydrochloride by ¹H-NMR; the 95% enantiomeric excess of the (–)-isomer was determined successfully. © 1992 Wiley-Liss, Inc.     

Intermolecular interaction of voriconazole analogues with model membrane by DSC and NMR,and their antifungal activity using NMR based metabolic profiling

The development of novel antifungal agents with high susceptibility and increased potency can be achieved by increasing their overall lipophilicity. To enhance the lipophilicity of voriconazole, a second generation azole antifungal agent, we have synthesized its carboxylic acid ester analogues, namely p-methoxybenzoate (Vpmb), toluate (Vtol), benzoate (Vbz) and p-nitrobenzoate (Vpnb). The intermolecular interactions of these analogues with model membrane have been investigated using nuclear magnetic resonance (NMR) and differential scanning calorimetric (DSC) techniques. The results indicate varying degree of changes in the membrane bilayer’s structural architecture and physico-chemical characteristics which possibly can be correlated with the antifungal effects via fungal membrane. Rapid metabolite profiling of chemical entities using cell preparations is one of the most important steps in drug discovery. We have evaluated the effect of synthesized analogues on Candida albicans. The method involves real time ¹H NMR measurement of intact cells monitoring NMR signals from fungal metabolites which gives Metabolic End Point (MEP). This is then compared with Minimum Inhibitory Concentration (MIC) determined using conventional methods. Results indicate that one of the synthesized analogues, Vpmb shows reasonably good activity.     

Determination of heteronuclear long-range couplings to heteronuclei in natural abundance by two- and three-dimensional NMR spectroscopy

Summary A method to determine heteronuclear long-range couplings to carbon and nitrogen at natural abundance is presented and applied to two cyclic hexapeptides and the peptidomacrolide FK506. The method is applicable for proton-bearing heteronuclei. By introduction of heteronuclear half-filters in two- or three-dimensional experiments the spectra exhibit an E.COSY pattern when executed without heteronuclear decoupling. The extraction of the heteronuclear coupling constants is therefore independent of linewidth.Incyclo(-Ala-Ala-Ala-Pro-Ala-Pro-) a¹³C-_I-half-filtered TOCSY spectrum yields the³J(H^N-C) coupling constant, which can be used to remove ambiguity in the angle determination from³J(H^N-H). Incyclo(-d-Pro-Phe-Phe-Lys(Z)-Trp-Phe-) a¹⁵N-_I-half-filtered TOCSY was applied to individually assign the diastereotopic -methylene protons via the³J(H-N). In FK506 a 3D-HMQC-TOCSY without heteronuclear decoupling is used to obtain a number of heteronuclear coupling constants to carbons. These values have been applied for the assignment of diastereotopic methylene protons and determination of dihedral angles in the cyclic portion of the molecule.Dedicated to the memory of Professor V.F. Bystrov     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.Correspondence to: A. N. Lane     

Resolving nitrogen-15 and proton chemical shifts for mobile segments of elastin with two-dimensional NMR spectroscopy

In this study, one- and two-dimensional NMR experiments are applied to uniformly (15)N-enriched synthetic elastin, a recombinant human tropoelastin that has been cross-linked to form an elastic hydrogel. Hydrated elastin is characterized by large segments that undergo "liquid-like" motions that limit the efficiency of cross-polarization. The refocused insensitive nuclei enhanced by polarization transfer experiment is used to target these extensive, mobile regions of this protein. Numerous peaks are detected in the backbone amide region of the protein, and their chemical shifts indicate the completely unstructured, "random coil" model for elastin is unlikely. Instead, more evidence is gathered that supports a characteristic ensemble of conformations in this rubber-like protein.