Molecular cloning and characterization of the platelet-activating factor receptor gene expressed in the human heart.

PAF decreases cardiac contractility and blood pressure. To characterize the cardiac PAF receptor, we screened a human ventricular cDNA library in a low stringency condition, using a PCR product derived from guinea pig lung PAF receptor as a probe. Four clones were obtained and named HV1-4. In Xenopus oocytes injected with cRNA derived from HV3 or 4 but not from HV1 or 2, PAF elicited a Ca(2+)-activated Cl- current. HV3 and HV4 were duplicate clones, encoding a 342 amino-acid polypeptide which was identical to that of the human leukocyte PAF receptor. However, a portion of the 5' untranslated region of HV3 (or 4) was different from that of the leukocyte receptor cDNA. Northern blotting of human ventricles and atria using the HV3 insert showed a single band of approximately 4 kb. These results suggest a tissue-specific translational mechanism responsible for regulation of the expression of the PAF receptor mRNA in these tissues.     

Molecular cloning, functional expression and pharmacological characterization of a human bradykinin B2 receptor gene.

The gene encoding a putative G protein-coupled receptor (HG10) was cloned from human genomic DNA by low stringency PCR and found to be homologous to the recently described rat bradykinin B2 receptor. The receptor was expressed in xenopus oocytes and stably transfected CHO cell lines. Binding studies demonstrated that HG10 encodes a high affinity BK receptor with an apparent Kd of 150 pM. Displacement by BK agonists and antagonists allowed the characterization of the receptor as a B2 subtype. Functional coupling to the Ca(2+)-phosphatidylinositol cascade was demonstrated in transfected CHO cells where inositol phosphates accumulation and intracellular calcium concentration were elevated in response to BK stimulation. The agonistic and antagonistic properties of BK analogs do not match strictly the pharmacological profile described for the rat or guinea pig B2 receptor subtypes or the putative B3 subtype. This discrepancy is attributed either to species variability or to differences in the coupling efficiency of receptors to the transduction cascade in different cell types. From our results, the existence of B3 receptors and of B2 subtypes appears questionable.     

Molecular cloning and expression of a murine homolog of the human poliovirus receptor gene.

The poliovirus receptor (Pvr) is a member of the immunoglobulin superfamily of proteins, but its function in the cell is not known. Southern blot hybridization analysis indicated that the murine genome contains a sequence homolog of pvr. As a first step toward using the murine pvr homolog (mph) to study the function of Pvr, murine genomic and cDNA clones encoding mph were isolated. mph encodes a polypeptide with extensive sequence similarity to the extracellular domains of the human PVR. mph mRNAs of 2.0 and 3.0 kb are transcribed in the adult mouse brain, the spinal cord, the spleen, the kidney, the heart, and the liver. The Mph protein does not function as a receptor for poliovirus. However, substitution of domain 1 of the Mph protein with the corresponding sequence from pvr produced a chimeric receptor that could bind poliovirus and lead to productive infection. By constructing pvr-mph chimeras, it will be possible to identify the contact points of poliovirus within domain 1 of Pvr. Identification of the ligand and the cellular function of the Mph protein may help us understand the role of Pvr in the cell.     

Molecular cloning and expression of the human interferon-gamma receptor

A cDNA encoding the human interferon-gamma receptor was isolated from a lambda gt11 expression library using a polyclonal antireceptor antiserum. The gene for this receptor was identified in a cosmid library and transfected into mouse cells. The human interferon-gamma receptor expressed in mouse cells displayed the same binding properties as in human cells. However, transfected cells were not sensitive to human IFN-gamma, suggesting the need for species-specific cofactors in receptor function. As inferred from the cDNA sequence, the human interferon-gamma receptor shows no similarities to known proteins and represents a novel transmembrane receptor. It is most likely the product of a single mRNA and a gene located on chromosome 6q.     

Identification, cloning, and characterization of a novel soluble receptor that binds IL-22 and neutralizes its activity

With the use of a partial sequence of the human genome, we identified a gene encoding a novel soluble receptor belonging to the class II cytokine receptor family. This gene is positioned on chromosome 6 in the vicinity of the IFNGR1 gene in a head-to-tail orientation. The gene consists of six exons and encodes a 231-aa protein with a 21-aa leader sequence. The secreted mature protein demonstrates 34% amino acid identity to the extracellular domain of the IL-22R1 chain. Cross-linking experiments demonstrate that the protein binds IL-22 and prevents binding of IL-22 to the functional cell surface IL-22R complex, which consists of two subunits, the IL-22R1 and the IL-10R2c chains. Moreover, this soluble receptor, designated IL-22-binding protein (BP), is capable of neutralizing IL-22 activity. In the presence of the IL-22BP, IL-22 is unable to induce Stat activation in IL-22-responsive human lung carcinoma A549 cells. IL-22BP also blocked induction of the suppressors of cytokine signaling-3 (SOCS-3) gene expression by IL-22 in HepG2 cells. To further evaluate IL-22BP action, we used hamster cells expressing a modified IL-22R complex consisting of the intact IL-10R2c and the chimeric IL-22R1/gammaR1 receptor in which the IL-22R1 intracellular domain was replaced with the IFN-gammaR1 intracellular domain. In these cells, IL-22 activates biological activities specific for IFN-gamma, such as up-regulation of MHC class I Ag expression. The addition of IL-22BP neutralizes the ability of IL-22 to induce Stat activation and MHC class I Ag expression in these cells. Thus, the soluble receptor designated IL-22BP inhibits IL-22 activity by binding IL-22 and blocking its interaction with the cell surface IL-22R complex.     

Molecular cloning, structural characterization and functional expression of the human substance P receptor.

A cDNA encoding the human substance P receptor (SPR) was isolated and the primary structure of the protein was deduced by nucleotide sequence analysis. This SPR consists of 407 residues and is a member of the G-protein coupled receptor superfamily. Comparison of rat and human SPR sequences demonstrated a 94.5% identity. The receptor was expressed in a COS-7 cell line and displayed a Kd for Tyr-1-SP binding of 0.24 nM. Ligand displacement by naturally occurring tachykinin peptides was SP much greater than neurokinin A greater than neurokinin B. SP stimulation of transfected cells resulted in a rapid and transient inositol 1,4,5-trisphosphate response. RNA blot hybridization and solution hybridization demonstrated that SPR mRNA was about 4.5 Kb in size, and was expressed in IM-9 lymphoblast and U373-MG astrocytoma cells, as well as in spinal cord and lung but not in liver.     

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.     

Molecular cloning and characterization of a chromosomal gene for human eosinophil peroxidase

Using human myeloperoxidase cDNA as a probe, a chromosomal gene related to myeloperoxidase was isolated from a human gene library. Comparison of the amino acid sequence deduced from the nucleotide sequence of the cloned gene with that of human eosinophil peroxidase purified from buffy coats has indicated that the isolated gene is the chromosomal gene for human eosinophil peroxidase. Like human myeloperoxidase gene, human eosinophil peroxidase gene consists of 12 exons and 11 introns spanning about 12 kilobases. The gene can code for a protein of 715 amino acids with a calculated Mr of 81,036. The heavy chain and the light chain of eosinophil peroxidase were located on the COOH and NH2 terminus of the protein, respectively. The coding sequences of eosinophil peroxidase and myeloperoxidase show homologies of 72.4% at the nucleotide and 69.8% at the amino acid level, while little homology was found in the 5'-flanking region. Northern hybridization and S1 mapping analysis of RNA from human leukemic cells have indicated that the eosinophil peroxidase gene is expressed in the eosinophilic subline of human HL-60 cells but not in the neutrophilic subline or in parental HL-60 cells.     

Molecular cloning and characterization of the human beta-like globin gene cluster

The genes encoding human embryonic (epsilon), fetal (G gamma, A gamma) and adult (delta, beta) beta-like globin polypeptides were isolated as a set of overlapping cloned DNA fragments from bacteriophage lambda libraries of high molecular weight (15-20 kb) chromosomal DNA. The 65 kb of DNA represented in these overlapping clones contains the genes for all five beta-like polypeptides, including the embryonic epsilon-globin gene, for which the chromosomal location was previously unknown. All five genes are transcribed from the same DNA strand and are arranged in the order 5'-epsilon-(13.3 kb)-G gamma-(3.5 kb)-A gamma-(13.9 kb)-delta-(5.4 kb)-beta-3'. Thus the genes are positioned on the chromosome in the order of their expression during development. In addition to the five known beta-like globin genes, we have detected two other beta-like globin sequences which do not correspond to known polypeptides. One of these sequences has been mapped to the A gamma-delta intergenic region while the other is located 6-9 kb 5' to the epsilon gene. Cross hybridization experiments between the intergenic sequences of the gene cluster have revealed a nonglobin repeat sequence (*) which is interspersed with the globin genes in the following manner: 5'-**epsilon-*G gamma-A gamma*-**delta-beta*-3'. Fine structure mapping of the region located 5' to the delta-globin gene revealed two repeats with a maximum size of 400 bp, which are separated by approximately 700 bp of DNA not repeated within the cluster. Preliminary experiments indicate that this repeat family is also repeated many times in the human genome.