首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 46 毫秒
1.
2.
Riboflavin significantly enhanced the efficacy of simulated solar disinfection (SODIS) at 150 watts per square meter (W m−2) against a variety of microorganisms, including Escherichia coli, Fusarium solani, Candida albicans, and Acanthamoeba polyphaga trophozoites (>3 to 4 log10 after 2 to 6 h; P < 0.001). With A. polyphaga cysts, the kill (3.5 log10 after 6 h) was obtained only in the presence of riboflavin and 250 W m−2 irradiance.Solar disinfection (SODIS) is an established and proven technique for the generation of safer drinking water (11). Water is collected into transparent plastic polyethylene terephthalate (PET) bottles and placed in direct sunlight for 6 to 8 h prior to consumption (14). The application of SODIS has been shown to be a simple and cost-effective method for reducing the incidence of gastrointestinal infection in communities where potable water is not available (2-4). Under laboratory conditions using simulated sunlight, SODIS has been shown to inactivate pathogenic bacteria, fungi, viruses, and protozoa (6, 12, 15). Although SODIS is not fully understood, it is believed to achieve microbial killing through a combination of DNA-damaging effects of ultraviolet (UV) radiation and thermal inactivation from solar heating (21).The combination of UVA radiation and riboflavin (vitamin B2) has recently been reported to have therapeutic application in the treatment of bacterial and fungal ocular pathogens (13, 17) and has also been proposed as a method for decontaminating donor blood products prior to transfusion (1). In the present study, we report that the addition of riboflavin significantly enhances the disinfectant efficacy of simulated SODIS against bacterial, fungal, and protozoan pathogens.Chemicals and media were obtained from Sigma (Dorset, United Kingdom), Oxoid (Basingstoke, United Kingdom), and BD (Oxford, United Kingdom). Pseudomonas aeruginosa (ATCC 9027), Staphylococcus aureus (ATCC 6538), Bacillus subtilis (ATCC 6633), Candida albicans (ATCC 10231), and Fusarium solani (ATCC 36031) were obtained from ATCC (through LGC Standards, United Kingdom). Escherichia coli (JM101) was obtained in house, and the Legionella pneumophila strain used was a recent environmental isolate.B. subtilis spores were produced from culture on a previously published defined sporulation medium (19). L. pneumophila was grown on buffered charcoal-yeast extract agar (5). All other bacteria were cultured on tryptone soy agar, and C. albicans was cultured on Sabouraud dextrose agar as described previously (9). Fusarium solani was cultured on potato dextrose agar, and conidia were prepared as reported previously (7). Acanthamoeba polyphaga (Ros) was isolated from an unpublished keratitis case at Moorfields Eye Hospital, London, United Kingdom, in 1991. Trophozoites were maintained and cysts prepared as described previously (8, 18).Assays were conducted in transparent 12-well tissue culture microtiter plates with UV-transparent lids (Helena Biosciences, United Kingdom). Test organisms (1 × 106/ml) were suspended in 3 ml of one-quarter-strength Ringer''s solution or natural freshwater (as pretreated water from a reservoir in United Kingdom) with or without riboflavin (250 μM). The plates were exposed to simulated sunlight at an optical output irradiance of 150 watts per square meter (W m−2) delivered from an HPR125 W quartz mercury arc lamp (Philips, Guildford, United Kingdom). Optical irradiances were measured using a calibrated broadband optical power meter (Melles Griot, Netherlands). Test plates were maintained at 30°C by partial submersion in a water bath.At timed intervals for bacteria and fungi, the aliquots were plated out by using a WASP spiral plater and colonies subsequently counted by using a ProtoCOL automated colony counter (Don Whitley, West Yorkshire, United Kingdom). Acanthamoeba trophozoite and cyst viabilities were determined as described previously (6). Statistical analysis was performed using a one-way analysis of variance (ANOVA) of data from triplicate experiments via the InStat statistical software package (GraphPad, La Jolla, CA).The efficacies of simulated sunlight at an optical output irradiance of 150 W m−2 alone (SODIS) and in the presence of 250 μM riboflavin (SODIS-R) against the test organisms are shown in Table Table1.1. With the exception of B. subtilis spores and A. polyphaga cysts, SODIS-R resulted in a significant increase in microbial killing compared to SODIS alone (P < 0.001). In most instances, SODIS-R achieved total inactivation by 2 h, compared to 6 h for SODIS alone (Table (Table1).1). For F. solani, C. albicans, ands A. polyphaga trophozoites, only SODIS-R achieved a complete organism kill after 4 to 6 h (P < 0.001). All control experiments in which the experiments were protected from the light source showed no reduction in organism viability over the time course (results not shown).

TABLE 1.

Efficacies of simulated SODIS for 6 h alone and with 250 μM riboflavin (SODIS-R)
OrganismConditionaLog10 reduction in viability at indicated h of exposureb
1246
E. coliSODIS0.0 ± 0.00.2 ± 0.15.7 ± 0.05.7 ± 0.0
SODIS-R1.1 ± 0.05.7 ± 0.05.7 ± 0.05.7 ± 0.0
L. pneumophilaSODIS0.7 ± 0.21.3 ± 0.34.8 ± 0.24.8 ± 0.2
SODIS-R4.4 ± 0.04.4 ± 0.04.4 ± 0.04.4 ± 0.0
P. aeruginosaSODIS0.7 ± 0.01.8 ± 0.04.9 ± 0.04.9 ± 0.0
SODIS-R5.0 ± 0.05.0 ± 0.05.0 ± 0.05.0 ± 0.0
S. aureusSODIS0.0 ± 0.00.0 ± 0.06.2 ± 0.06.2 ± 0.0
SODIS-R0.2 ± 0.16.3 ± 0.06.3 ± 0.06.3 ± 0.0
C. albicansSODIS0.2 ± 0.00.4 ± 0.10.5 ± 0.11.0 ± 0.1
SODIS-R0.1 ± 0.00.7 ± 0.15.3 ± 0.05.3 ± 0.0
F. solani conidiaSODIS0.2 ± 0.10.3 ± 0.00.2 ± 0.00.7 ± 0.1
SODIS-R0.3 ± 0.10.8 ± 0.11.3 ± 0.14.4 ± 0.0
B. subtilis sporesSODIS0.3 ± 0.00.2 ± 0.00.0 ± 0.00.1 ± 0.0
SODIS-R0.1 ± 0.10.2 ± 0.10.3 ± 0.30.1 ± 0.0
SODIS (250 W m−2)0.1 ± 0.00.1 ± 0.10.1 ± 0.10.0 ± 0.0
SODIS-R (250 W m−2)0.0 ± 0.00.0 ± 0.00.2 ± 0.00.4 ± 0.0
SODIS (320 W m−2)0.1 ± 0.10.1 ± 0.00.0 ± 0.14.3 ± 0.0
SODIS-R (320 W m−2)0.1 ± 0.00.1 ± 0.10.9 ± 0.04.3 ± 0.0
A. polyphaga trophozoitesSODIS0.4 ± 0.20.6 ± 0.10.6 ± 0.20.4 ± 0.1
SODIS-R0.3 ± 0.11.3 ± 0.12.3 ± 0.43.1 ± 0.2
SODIS, naturalc0.3 ± 0.10.4 ± 0.10.5 ± 0.20.3 ± 0.2
SODIS-R, naturalc0.2 ± 0.11.0 ± 0.22.2 ± 0.32.9 ± 0.3
A. polyphaga cystsSODIS0.4 ± 0.10.1 ± 0.30.3 ± 0.10.4 ± 0.2
SODIS-R0.4 ± 0.20.3 ± 0.20.5 ± 0.10.8 ± 0.3
SODIS (250 W m−2)0.0 ± 0.10.2 ± 0.30.2 ± 0.10.1 ± 0.2
SODIS-R (250 W m−2)0.4 ± 0.20.3 ± 0.20.8 ± 0.13.5 ± 0.3
SODIS (250 W m−2), naturalc0.0 ± 0.30.2 ± 0.10.1 ± 0.10.2 ± 0.1
SODIS-R (250 W m−2), naturalc0.1 ± 0.10.2 ± 0.20.6 ± 0.13.4 ± 0.2
Open in a separate windowaConditions are at an intensity of 150 W m−2 unless otherwise indicated.bThe values reported are means ± standard errors of the means from triplicate experiments.cAdditional experiments for this condition were performed using natural freshwater.The highly resistant A. polyphaga cysts and B. subtilis spores were unaffected by SODIS or SODIS-R at an optical irradiance of 150 W m−2. However, a significant reduction in cyst viability was observed at 6 h when the optical irradiance was increased to 250 W m−2 for SODIS-R only (P < 0.001; Table Table1).1). For spores, a kill was obtained only at 320 W m−2 after 6-h exposure, and no difference between SODIS and SODIS-R was observed (Table (Table1).1). Previously, we reported a >2-log kill at 6 h for Acanthamoeba cysts by using SODIS at the higher optical irradiance of 850 W m−2, compared to the 0.1-log10 kill observed here using the lower intensity of 250 W m−2 or the 3.5-log10 kill with SODIS-R.Inactivation experiments performed with Acanthamoeba cysts and trophozoites suspended in natural freshwater gave results comparable to those obtained with Ringer''s solution (P > 0.05; Table Table1).1). However, it is acknowledged that the findings of this study are based on laboratory-grade water and freshwater and that differences in water quality through changes in turbidity, pH, and mineral composition may significantly affect the performance of SODIS (20). Accordingly, further studies are indicated to evaluate the enhanced efficacy of SODIS-R by using natural waters of varying composition in the areas where SODIS is to be employed.Previous studies with SODIS under laboratory conditions have employed lamps delivering an optical irradiance of 850 W m−2 to reflect typical natural sunlight conditions (6, 11, 12, 15, 16). Here, we used an optical irradiance of 150 to 320 W m−2 to obtain slower organism inactivation and, hence, determine the potential enhancing effect of riboflavin on SODIS.In conclusion, this study has shown that the addition of riboflavin significantly enhances the efficacy of simulated SODIS against a range of microorganisms. The precise mechanism by which photoactivated riboflavin enhances antimicrobial activity is unknown, but studies have indicated that the process may be due, in part, to the generation of singlet oxygen, H2O2, superoxide, and hydroxyl free radicals (10). Further studies are warranted to assess the potential benefits from riboflavin-enhanced SODIS in reducing the incidence of gastrointestinal infection in communities where potable water is not available.  相似文献   

3.
4.
Feeding high levels of zinc oxide to piglets significantly increased the relative abundance of ileal Weissella spp., Leuconostoc spp., and Streptococcus spp., reduced the occurrence of Sarcina spp. and Neisseria spp., and led to numerical increases of all Gram-negative facultative anaerobic genera. High dietary zinc oxide intake has a major impact on the porcine ileal bacterial composition.Zinc oxide (ZnO) is used as a feed additive for diarrhea prophylaxis in piglets (23). However, the mode of action of ZnO is not fully understood. Besides its effects on the host (10, 30, 31), high dietary zinc levels may affect the diversity of intestinal microbial communities (2, 11, 20). The prevention of postweaning diarrhea in piglets due to high dietary ZnO intake may not be directly related to a reduction of pathogenic E. coli (8) but, rather, to the diversity of the coliform community (15). Studies on the impact of high ZnO levels on the porcine ileal bacterial community are scarce but nevertheless important, as bacterial diarrhea is initiated in the small intestine (9, 17). The small intestine is a very complex habitat with many different factors shaping the bacterial community. Studies on the ecophysiology (22) and maturation of the porcine ileal microbiota (13, 27) indicate a drastic impact directly after weaning and a gradual decline of modifications during the following 2 weeks. Thus, the time point for analysis chosen in this study (14 days postweaning) does reflect a more stable period of the ileal porcine microbiota. In this study, we used bar-coded pyrosequencing of 16S rRNA genes to gain further insight into the mode of action of pharmacological levels of ZnO in the gastrointestinal tract of young pigs.Total DNA was extracted from the ileal digesta of 40- to 42-day-old piglets using a commercial kit (Qiagen stool kit; Qiagen, Hilden, Germany) and PCR amplified with unique bar-coded primer sets targeting the V1-to-V3 and the V6-to-V8 hypervariable regions (see the supplemental material for detailed methods). The rationale behind this approach was derived from the fact that no single “universal” primer pair can completely cover a complex bacterial habitat (4, 24, 32, 33). Furthermore, these studies also show that in silico information on the coverage of selected primer sets diverges from empirical results, and hence, two hypervariable regions were chosen in this study to maximize the detection of phylogenetically diverse bacterial groups.Equimolar dilutions of all samples were combined into one master sample. Pyrosequencing was performed by Agowa (Berlin, Germany) on a Roche genome sequencer FLX system using a Titanium series PicoTiterPlate. The resulting data files were uploaded to the MG-RAST server (http://metagenomics.nmpdr.org/) (19) and processed with its SEED software tool using the RDP database (5) as the reference database. After automated sequence analysis, all sequences with less than five identical reads per sample were deleted in order to increase the confidence of sequence reads and reduce bias from possible sequencing errors (12, 16). Thus, 0.43% of all sequences were not considered (1,882 of 433,302 sequences). These sequences were assigned to a total of 238 genera, of which most only occurred in a few samples (see the supplemental material). Furthermore, all unclassified sequences were removed (8.7%; 41,467 of 474,769 sequences). Due to the use of the RDP reference database, the SEED software incorrectly assigned the majority of unclassified sequences as unclassified Deferribacterales (83%; 34,393 sequences), which were actually identified as 16S soybean or wheat chloroplasts by BLAST or as cyanobacterial chloroplasts by the RDP II seqmatch tool.The pyrosequencing results for the two primer combinations were merged by taking only sequences from the primer combination that yielded the higher number of reads for a specific sequence assignment in a sample. The remaining reads were used to calculate the relative contribution of assigned sequences to total sequence reads in a sample.The Firmicutes phylum dominated the small intestinal bacterial communities in both the control group and the group with high dietary ZnO intake, with 98.3% and 97.0% of total sequence reads, respectively. No significant influence of high dietary ZnO intake was found for the main phyla Proteobacteria (0.92% versus 1.84%), Actinobacteria (0.61% versus 0.75%), Bacteroidetes (0.15% versus 0.17%), and Fusobacteria (0.09% versus 0.12%).On the order level, a total of 20 bacterial orders were detected (data not shown). Lactobacillales dominated bacterial communities in the control and high-dietary-ZnO-intake groups, with 83.37% and 93.24% of total reads. Lactic acid bacteria are well known to dominate the bacterial community in the ileum of piglets (11, 22). No significant difference between the control group and the group with high dietary ZnO intake was observed on the order level, although high dietary ZnO intake led to a strong numerical decrease for Clostridiales (14.4 ± 24.0% [mean ± standard deviation] versus 2.8 ± 1.7%), as well as to numerical increases for Pseudomonadales (0.3 ± 0.3% versus 0.6 ± 0.6%) and Enterobacteriales (0.2 ± 0.2% versus 0.5 ± 0.6%).On the genus level, a total of 103 genera were detected. Table Table11 summarizes the main 31 genera which exceeded 0.05% of total reads (see the supplemental material for a complete list). Lactobacilli clearly dominated the bacterial communities in both trial groups, but they also were numerically lower due to high dietary ZnO intake.

TABLE 1.

Bacterial genera in the ileum of piglets fed diets supplemented with 200 or 3,000 ppm ZnO
GenusProportion (% ± SD) of ileal microbiota in groupa receiving:
200 ppm ZnO3,000 ppm ZnO
Lactobacillus59.3 ± 30.640.7 ± 19.1
Weissella11.6 ± 7.8 A24.1 ± 8.3 B
Sarcina11.4 ± 20.5 A0.84 ± 1.2 B
Leuconostoc4.7 ± 3.2 A9.4 ± 3.1 B
Streptococcus1.8 ± 1.6 A5.7 ± 5.1 B
Lactococcus1.6 ± 1.52.6 ± 3.1
Veillonella0.57 ± 0.630.34 ± 0.30
Gemella0.34 ± 0.67 A0.45 ± 0.25 B
Acinetobacter0.25 ± 0.210.44 ± 0.50
Clostridium0.25 ± 0.400.22 ± 0.21
Enterococcus0.19 ± 0.150.26 ± 0.24
Acidovorax0.14 ± 0.040.16 ± 0.19
Arcobacter0.14 ± 0.150.16 ± 0.17
Neisseria0.14b0.03 ± 0.01
Enterobacter0.13 ± 0.090.29 ± 0.34
Lachnospira0.12 ± 0.130.13 ± 0.03
Peptostreptococcus0.11 ± 0.100.07 ± 0.09
Chryseobacterium0.10 ± 0.070.15 ± 0.16
Actinomyces0.09 ± 0.040.15 ± 0.16
Anaerobacter0.07 ± 0.080.02 ± 0.01
Aerococcus0.07 ± 0.040.07 ± 0.04
Dorea0.07b0.05 ± 0.05
Fusobacterium0.06 ± 0.090.08 ± 0.11
Microbacterium0.06 ± 0.010.07 ± 0.04
Carnobacterium0.06 ± 0.020.08 ± 0.13
Granulicatella0.06 ± 0.020.09 ± 0.10
Staphylococcus0.06 ± 0.040.05 ± 0.02
Facklamia0.05 ± 0.060.03 ± 0.01
Comamonas0.05 ± 0.030.04 ± 0.02
Citrobacter0.05 ± 0.020.07 ± 0.08
Erysipelothrix0.05 ± 0.010.22 ± 0.40
Open in a separate windowan = 6 piglets per trial group. A,B, results are significantly different by Kruskal-Wallis test.bSingle sample.Significant changes due to high dietary ZnO intake were observed for other lactic acid bacteria, including Weissella spp., Leuconostoc spp., and Streptococcus spp. A significant and strong decrease was observed for Sarcina spp., which is a genus of acid-tolerant strictly anaerobic species found in the intestinal tract of piglets and other mammals (6, 28, 29). This genus thus appeared to be very sensitive to modifications induced by high dietary ZnO intake.An interesting result was observed for Gram-negative Proteobacteria, (i.e., enterobacteria and relatives). Although not statistically significant, virtually all detected proteobacteria increased numerically due to high dietary ZnO intake (Enterobacter spp., Microbacterium spp., Citrobacter spp., Neisseria spp., and Acinetobacter spp.). Apparently, enterobacteria gained colonization potential by high dietary ZnO intake. This is in good agreement with the results of studies by Hojberg et al. (11), Amezcua et al. (1), and Castillo et al. (3). Therefore, the frequently observed diarrhea-reducing effect of zinc oxide may not be directly related to a reduction of pathogenic E. coli strains. Considering a possible antagonistic activity of lactobacilli against enterobacteria (25), it can be speculated that a numerical decrease of dominant lactobacilli may lead to increased colonization with Gram-negative enterobacteria. On the other hand, specific plasmid-borne genes for resistance against heavy metals have been reported for both Gram-positive and Gram-negative bacteria present in the intestine (21, 26), and an increased resistance against Zn ions may exist for Gram-negative enterobacteria. Zinc oxide is an amphoteric molecule and shows a high solubility at acid pH. The low pH in the stomach of piglets (pH 3.5 to 4.5) transforms a considerable amount of insoluble ZnO into zinc ions (54 to 84% free Zn2+ at 150 ppm and 24 ppm ZnO, respectively) (7), and thus, high concentrations of toxic zinc ions exist in the stomach. The stomach of piglets harbors large numbers of lactic acid bacteria, especially lactobacilli. Zn ions may thus lead to a modification of the lactic acid bacterial community in the stomach, and the changes observed in the ileum could have been created in the stomach. A reduction of dominant lactobacilli may thus point to an increased adaptation potential of Gram-negative facultative anaerobes and a generally increased bacterial diversity.Additionally, the direct effects of dietary ZnO on intestinal tissues include altered expression of genes responsible for glutathione metabolism and apoptosis (30), enhanced gastric ghrelin secretion, which increases feed intake (31), and increased production of digestive enzymes (10). An analysis of the intestinal morphology was beyond the scope of this study, but although ZnO concentrations are markedly increased in intestinal tissue, the influence of ZnO on morphology is apparently not always observed (10, 14, 18). Consequently, any changes in epithelial cell turnover, feed intake, or digestive capacity may influence the composition of bacterial communities in the small intestine.In conclusion, this study has shown that high dietary zinc oxide has a major impact on ileal bacterial communities in piglets. Future studies on the impact of zinc oxide in pigs should include a detailed analysis of host responses in order to identify the cause for the observed modifications of intestinal bacterial communities.  相似文献   

5.
6.
Arthrobacter sp. strain JBH1 was isolated from nitroglycerin-contaminated soil by selective enrichment. Detection of transient intermediates and simultaneous adaptation studies with potential intermediates indicated that the degradation pathway involves the conversion of nitroglycerin to glycerol via 1,2-dinitroglycerin and 1-mononitroglycerin, with concomitant release of nitrite. Glycerol then serves as the source of carbon and energy.Nitroglycerin (NG) is manufactured widely for use as an explosive and a pharmaceutical vasodilator. It has been found as a contaminant in soil and groundwater (7, 9). Due to NG''s health effects as well as its highly explosive nature, NG contamination in soils and groundwater poses a concern that requires remedial action (3). Natural attenuation and in situ bioremediation have been used for remediation in soils contaminated with certain other explosives (16), but the mineralization of NG in soil and groundwater has not been reported.To date, no pure cultures able to grow on NG as the sole carbon, energy, and nitrogen source have been isolated. Accashian et al. (1) observed growth associated with the degradation of NG under aerobic conditions by a mixed culture originating from activated sludge. The use of NG as a source of nitrogen has been studied in mixed and pure cultures during growth on alternative sources of carbon and energy (3, 9, 11, 20). Under such conditions, NG undergoes a sequential denitration pathway in which NG is transformed to 1,2-dinitroglycerin (1,2DNG) or 1,3DNG followed by 1-mononitroglycerin (1MNG) or 2MNG and then glycerol, under both aerobic and anaerobic conditions (3, 6, 9, 11, 20), and the enzymes involved in denitration have been characterized in some detail (4, 8, 15, 21). Pure cultures capable of completely denitrating NG as a source of nitrogen when provided additional sources of carbon include Bacillus thuringiensis/cereus and Enterobacter agglomerans (11) and a Rhodococcus species (8, 9). Cultures capable of incomplete denitration to MNG in the presence of additional carbon sources were identified as Pseudomonas putida, Pseudomonas fluorescens (4), an Arthobacter species, a Klebsiella species (8, 9), and Agrobacterium radiobacter (20).Here we describe the isolation of bacteria able to degrade NG as the sole source of carbon, nitrogen, and energy. The inoculum for selective enrichment was soil historically contaminated with NG obtained at a facility that formerly manufactured explosives located in the northeastern United States. The enrichment medium consisted of minimal medium prepared as previously described (17) supplemented with NG (0.26 mM), which was synthesized as previously described (18). During enrichment, samples of the inoculum (optical density at 600 nm [OD600] ∼ 0.03) were diluted 1/16 in fresh enrichment medium every 2 to 3 weeks. Isolates were obtained by dilution to extinction in NG-supplemented minimal medium. Cultures were grown under aerobic conditions in minimal medium at pH 7.2 and 23°C or in tryptic soy agar (TSA; 1/4 strength).Early stages of enrichment cultures required extended incubation with lag phases of over 200 h and exhibited slow degradation of NG (less than 1 μmol substrate/mg protein/h). After a number of transfers over 8 months, the degradation rates increased substantially (2.2 μmol substrate/mg protein/h). A pure culture capable of growth on NG was identified based on 16S rRNA gene analysis (504 bp) as an Arthrobacter species with 99.5% similarity to Arthrobacter pascens (GenBank accession no. GU246730). Purity of the cultures was confirmed microscopically and by formation of a single colony type on TSA plates. 16S gene sequencing and identification were done by MIDI Labs (Newark, DE) and SeqWright DNA Technology Services (Houston, TX). The Arthrobacter cells stained primarily as Gram-negative rods with a small number of Gram-positive cocci (data not shown); Gram variability is also a characteristic of the closely related Arthrobacter globiformis (2, 19). The optimum growth temperature is 30°C, and the optimum pH is 7.2. Higher pH values were not investigated because NG begins to undergo hydrolysis above pH 7.5 (data not shown). The isolated culture can grow on glycerol, acetate, succinate, citrate, and lactate, with nitrite as the nitrogen source. Previous authors described an Arthrobacter species able to use NG as a nitrogen source in the presence of additional sources of carbon. However, only dinitroesters were formed, and complete mineralization was not achieved (9).To determine the degradation pathway, cultures of the isolated strain (5 ml of inoculum grown on NG to an OD600 of 0.3) were grown in minimal medium (100 ml) supplemented with NG at a final concentration of 0.27 mM. Inoculated bottles and abiotic controls were continuously mixed, and NG, 1,2DNG, 1,3DNG, 1MNG, 2MNG, nitrite, nitrate, CO2, total protein, and optical density were measured at appropriate intervals. Nitroesters were analyzed with an Agilent high-performance liquid chromatograph (HPLC) equipped with an LC-18 column (250 by 4.6 mm, 5 μm; Supelco) and a UV detector at a wavelength of 214 nm (13). Methanol-water (50%, vol/vol) was used as the mobile phase at a flow rate of 1 ml/min. Nitrite and nitrate were analyzed with an ion chromatograph (IC) equipped with an IonPac AS14A anion-exchange column (Dionex, CA) at a flow rate of 1 ml/min. Carbon dioxide production was measured with a Micro Oxymax respirometer (Columbus Instruments, OH), and total protein was quantified using the Micro BCA protein assay kit (Pierce Biotechnology, IL) according to manufacturer''s instructions. During the degradation of NG the 1,2DNG concentration was relatively high at 46 and 72 h (Fig. (Fig.1).1). 1,3DNG, detected only at time zero, resulted from trace impurities in the NG stock solution. Trace amounts of 1MNG appeared transiently, and trace amounts of 2MNG accumulated and did not disappear. Traces of nitrite at time zero were from the inoculum. The concentration of NG in the abiotic control did not change during the experiment (data not shown).Open in a separate windowFIG. 1.Growth of strain JBH1 on NG. ×, NG; ▵, 1,2DNG; ⋄, 1MNG; □, 2MNG; ○, protein.Results from the experiment described above were used to calculate nitrogen and carbon mass balances (Tables (Tables11 and and2).2). Nitrogen content in protein was approximated using the formula C5H7O2N (14). Because all nitrogen was accounted for throughout, we conclude that the only nitrogen-containing intermediate compounds are 1,2DNG and 1MNG, which is consistent with previous studies (6, 9, 20). The fact that most of the nitrogen was released as nitrite is consistent with previous reports of denitration catalyzed by reductase enzymes (4, 8, 21). The minor amounts of nitrate observed could be from abiotic hydrolysis (5, 12) or from oxidation of nitrite. Cultures supplemented with glycerol or other carbon sources assimilated all of the nitrite (data not shown).

TABLE 1.

Nitrogen mass balance
Time (h)% of total initial nitrogen by mass recovered ina:
Total recovery (%)
1MNG2MNG1,2DNG1,3DNGNGProteinNitriteNitrate
0NDbND0.9 ± 0.70.8 ± 0.682 ± 5.20.8 ± 0.214 ± 0.70.8 ± 0.3100 ± 5.3
460.1 ± 0.00.8 ± 0.27.9 ± 0.4ND35 ± 3.62.0 ± 0.549 ± 1.11.7 ± 0.096 ± 4.2
720.1 ± 0.00.9 ± 0.24.3 ± 4.2ND5.0 ± 0.43.3 ± 0.281 ± 4.23.9 ± 1.998 ± 6.8
94ND0.6 ± 0.4NDND0.6 ± 0.43.2 ± 0.095 ± 102.6 ± 1.6102 ± 10
Open in a separate windowaData represent averages of four replicates ± standard deviations.bND, not detected.

TABLE 2.

Carbon mass balance
Time (h)% of total initial carbon by mass recovered in:
Total recovery (%)
1MNGa2MNGa1,2DNGa1,3DNGaNGaProteinaCO2b
0NDcND1.6 ± 1.21.9 ± 0.492 ± 5.84.4 ± 0.9100 ± 8.4
460.5 ± 0.22.6 ± 0.613 ± 0.7ND39 ± 3.913 ± 3.028 ± 5.796 ± 14.1
720.4 ± 0.02.9 ± 0.77.3 ± 7.0ND5.6 ± 0.422 ± 1.259 ± 8.397 ± 17.6
94ND2.8 ± 0.3NDND0.8 ± 0.518 ± 0.371 ± 4.593 ± 5.6
Open in a separate windowaData represent averages of four replicates ± standard deviations.bData represent averages of duplicates ± standard deviations.cND, not detected.In a separate experiment cells grown on NG were added to minimal media containing 1,3DNG, 1,2DNG, 1MNG, or 2MNG and degradation over time was measured. 1,2DNG, 1,3DNG, and 1MNG were degraded at rates of 6.5, 3.8, and 8 μmol substrate/mg protein/hour. No degradation of 2MNG was detected (after 250 h), which indicates that 2MNG is not an intermediate in a productive degradation pathway. Because 1,3DNG was not observed at any point during the degradation of NG and its degradation rate is approximately one-half the degradation rate of 1,2DNG, it also seems not to be part of the main NG degradation pathway used by Arthrobacter sp. strain JBH1. The above observations indicate that the degradation pathway involves a sequential denitration of NG to 1,2DNG, 1MNG, and then glycerol, which serves as the source of carbon and energy (Fig. (Fig.2).2). The productive degradation pathway differs from that observed by previous authors using both mixed (1, 3, 6) and pure cultures (4, 9, 11, 20), in which both 1,3- and 1,2DNG were intermediates during NG transformation. Additionally, in previous studies both MNG isomers were produced regardless of the ratio of 1,2DNG to 1,3DNG (3, 4, 6, 9, 20). Our results indicate that the enzymes involved in denitration of NG in strain JBH1 are highly specific and catalyze sequential denitrations that do not involve 1,3DNG or 2MNG. Determination of how the specificity avoids misrouting of intermediates will require purification and characterization of the enzyme(s) involved.Open in a separate windowFIG. 2.Proposed NG degradation pathway.Mass balances of carbon and nitrogen were used to determine the following stoichiometric equation that describes NG mineralization by Arthrobacter sp. strain JBH1: 0.26C3H5(ONO2)3 + 0.33O2 → 0.03C5H7O2N + 0.63CO2 + 0.75NO2 + 0.75H+ + 0.17H2O. The result indicates that most of the NG molecule is being used for energy. The biomass yield is relatively low (0.057 mg protein/mg NG), with an fs (fraction of reducing equivalents of electron donor used for protein synthesis) of 0.36 (10), which is low compared to the aerobic degradation of other compounds by pure cultures, for which fs ranges between 0.4 and 0.6 (10, 14). The results are consistent with the requirement for relatively large amounts of energy during the initiation of the degradation mechanism (each denitration probably requires 1 mole of NADH or NADPH [21]).Although NG degradation rates were optimal at pH 7.2, they were still substantial at values as low as 5.1. The results suggest that NG degradation is possible even at low pH values typical of the subsurface at sites where explosives were formerly manufactured or sites where nitrite production lowers the pH.NG concentrations above 0.5 mM are inhibitory, but degradation was still observed at 1.2 mM (data not shown). The finding that NG can be inhibitory to bacteria at concentrations that are well below the solubility of the compound is consistent with those of Accashian et al. (1) for a mixed culture.The ability of Arthrobacter sp. strain JBH1 to grow on NG as the carbon and nitrogen source provides the basis for a shift in potential strategies for natural attenuation and bioremediation of NG at contaminated sites. The apparent specificity of the denitration steps raises interesting questions about the evolution of the pathway.  相似文献   

7.
8.
The three-dimensional structure of adeno-associated virus (AAV) serotype 6 (AAV6) was determined using cryo-electron microscopy and image reconstruction and using X-ray crystallography to 9.7- and 3.0-Å resolution, respectively. The AAV6 capsid contains a highly conserved, eight-stranded (βB to βI) β-barrel core and large loop regions between the strands which form the capsid surface, as observed in other AAV structures. The loops show conformational variation compared to other AAVs, consistent with previous reports that amino acids in these loop regions are involved in differentiating AAV receptor binding, transduction efficiency, and antigenicity properties. Toward structure-function annotation of AAV6 with respect to its unique dual glycan receptor (heparan sulfate and sialic acid) utilization for cellular recognition, and its enhanced lung epithelial transduction compared to other AAVs, the capsid structure was compared to that of AAV1, which binds sialic acid and differs from AAV6 in only 6 out of 736 amino acids. Five of these residues are located at or close to the icosahedral 3-fold axis of the capsid, thereby identifying this region as imparting important functions, such as receptor attachment and transduction phenotype. Two of the five observed amino acids are located in the capsid interior, suggesting that differential AAV infection properties are also controlled by postentry intracellular events. Density ordered inside the capsid, under the 3-fold axis in a previously reported, conserved AAV DNA binding pocket, was modeled as a nucleotide and a base, further implicating this capsid region in AAV genome recognition and/or stabilization.Adeno-associated viruses (AAVs) are nonpathogenic single-stranded DNA (ssDNA) parvoviruses that belong to the Dependovirus genus and require helper viruses, such as Adenovirus or Herpesvirus, for lytic infection (4, 8, 22, 67). These viruses package a genome of ∼4.7 kb inside an icosahedral capsid (∼260 Å in diameter) with a triangulation number equal to 1 assembled from a total of 60 copies of their overlapping capsid viral protein (VP) 1 (VP1), VP2, and VP3 in a predicted ratio of 1:1:8/10 (10). The VPs are encoded from a cap open reading frame (ORF). VP3 is 61 kDa and constitutes 90% of the capsid''s protein composition. The less abundant VPs, VP1 (87 kDa) and VP2 (73 kDa), share the same C-terminal amino acid sequence with VP3 but have additional N-terminal sequences. A rep ORF codes for four overlapping proteins required for replication and DNA packaging.To date, more than 100 AAV isolates have been identified (21). Among the human and nonhuman primate AAVs isolated, 12 serotypes (AAV serotype 1 [AAV1] to AAV12) have been described and are classified into six phylogenetic clades on the basis of their VP sequences and antigenic reactivities, with AAV4 and AAV5 considered to be clonal isolates (21). AAV1 and AAV6, which represent clade A, differ by only 6 out of 736 VP1 amino acids (5 amino acids within VP3) and are antigenically cross-reactive. Other clade representatives include AAV2 (clade B), AAV2-AAV3 hybrid (clade C), AAV7 (clade D), AAV8 (clade E), and AAV9 (clade F) (21).The AAVs are under development as clinical gene delivery vectors (e.g., see references 5, 9, 12, 13, 24, 25, 53, and 61), with AAV2, the prototype member of the genus, being the most extensively studied serotype for this application. AAV2 has been successfully used to treat several disorders, but its broad tissue tropism makes it less effective for tissue-specific applications and the prevalence of preexisting neutralizing antibodies in the human population (11, 43) limits its utilization, especially when readministration is required to achieve a therapeutic outcome. Efforts have thus focused on characterizing the capsid-associated tissue tropism and transduction properties conferred by the capsid of representative serotypes of other clades (21). Outcomes of these studies include the observation that AAV1 and AAV6, for example, transduce liver, muscle, and airway epithelial cells more efficiently (e.g., up to 200-fold) than AAV2 (27, 28, 30). In addition, the six residues (Table (Table1)1) that differ between the VPs of AAV1 and AAV6 (a natural recombinant of AAV1 and AAV2 [56]) confer functional disparity between these two viruses. For example, AAV6 shows ∼3-fold higher lung cell epithelium transduction than AAV1 (27), and AAV1 and AAV6 bind terminally sialylated proteoglycans as their primary receptor, whereas AAV6 additionally binds to heparan sulfate (HS) proteoglycans with moderate affinity (70, 71). Therefore, a comparison of the AAV1 and AAV6 serotypes and, in particular, their capsid structures can help pinpoint the capsid regions that confer differences in cellular recognition and tissue transduction.

TABLE 1.

Amino acid differences between AAV1 and AAV6 and their reported mutants
AAVAmino acid at positiona:
Glycan targetbReference
129418531532584598642
AAV1LEEDFANS70
AAV1-E/KLEKDFANHS+ (and S)c70
AAV6FDKDLVHHS and S70
AAV6.1FDEDLVHHS (and S)c40, 70
AAV6.2LDKDLVHHS (and S)c40, 70
AAV6R2LDEDLVHHS (and S)c40
HAE1LEEDLVN(HS and S)d39
HAE2LDKDLVN(HS and S)d39
shH10FDKNLVNHS (and S-inde)33
Open in a separate windowaMutant residues in boldface have an AAV6 parental original; those underlined have an AAV1 parental origin.bS, sialic acid; HS, heparan sulfate; HS+, HS positive.cThe sialic acid binding phenotypes of these mutants were not discussed in the respective publications but are assumed to be still present.dThe glycan targets for these mutants were not discussed in this publication; thus, the phenotypes indicated are assumed.eThis mutant is sialic acid independent (S-ind) for cellular transduction.The structures of AAV1 to AAV5 and AAV8 have been determined by X-ray crystallography and/or cryo-electron microscopy and image reconstruction (cryo-EM) (23, 36, 47, 52, 66, 73; unpublished data), and preliminary characterization of crystals has also been reported for AAV1, AAV5, AAV7, and AAV9 (15, 45, 46, 55). The capsid VP structures contain a conserved eight-stranded (βB to βI) β-barrel core and large loop regions between the strands that form the capsid surface. The capsid surface is characterized by depressions at the icosahedral 2-fold axes of symmetry, finger-like projections surrounding the 3-fold axes, and canyon-like depressions surrounding the 5-fold axes. A total of nine variable regions (VRs; VRI to VRIX) were defined when the two most disparate structures, AAV2 and AAV4, were compared (23). The VRs contain amino acids that contribute to slight differences in surface topologies and distinct functional phenotypes, such as in receptor binding, transduction efficiency, and antigenic reactivity (10, 23, 37, 47).The structure of virus-like particles (VLPs) of AAV6, produced in a baculovirus/Sf9 insect cell expression system, has been determined by two highly complementary approaches, cryo-EM and X-ray crystallography. The AAV6 VP structure contains the general features already described for the AAVs and has conformational differences in the VRs compared to the VRs of other AAVs. The 9.7-Å-resolution cryoreconstructed structure enabled the localization of the C-α positions of five of the six amino acids that differ between highly homologous AAV6 and AAV1 but did not provide information on the positions of the side chains or their orientations. The X-ray crystal structure determined to 3.0-Å resolution enabled us to precisely map the atomic positions of these five residues at or close to the icosahedral 3-fold axes of the capsid. Reported mutagenesis and biochemical studies had functionally annotated the six residues differing between AAV1 and AAV6 with respect to their roles in receptor attachment and differential cellular transduction. Their disposition identifies the 3-fold capsid region as playing essential roles in AAV infection.  相似文献   

9.
Predator-prey relationships among prokaryotes have received little attention but are likely to be important determinants of the composition, structure, and dynamics of microbial communities. Many species of the soil-dwelling myxobacteria are predators of other microbes, but their predation range is poorly characterized. To better understand the predatory capabilities of myxobacteria in nature, we analyzed the predation performance of numerous Myxococcus isolates across 12 diverse species of bacteria. All predator isolates could utilize most potential prey species to effectively fuel colony expansion, although one species hindered predator swarming relative to a control treatment with no growth substrate. Predator strains varied significantly in their relative performance across prey types, but most variation in predatory performance was determined by prey type, with Gram-negative prey species supporting more Myxococcus growth than Gram-positive species. There was evidence for specialized predator performance in some predator-prey combinations. Such specialization may reduce resource competition among sympatric strains in natural habitats. The broad prey range of the Myxococcus genus coupled with its ubiquity in the soil suggests that myxobacteria are likely to have very important ecological and evolutionary effects on many species of soil prokaryotes.Predation plays a major role in shaping both the ecology and evolution of biological communities. The population and evolutionary dynamics of predators and their prey are often tightly coupled and can greatly influence the dynamics of other organisms as well (1). Predation has been invoked as a major cause of diversity in ecosystems (11, 12). For example, predators may mediate coexistence between superior and inferior competitors (2, 13), and differential trajectories of predator-prey coevolution can lead to divergence between separate populations (70).Predation has been investigated extensively in higher organisms but relatively little among prokaryotes. Predation between prokaryotes is one of the most ancient forms of predation (27), and it has been proposed that this process may have been the origin of eukaryotic cells (16). Prokaryotes are key players in primary biomass production (44) and global nutrient cycling (22), and predation of some prokaryotes by others is likely to significantly affect these processes. Most studies of predatory prokaryotes have focused on Bdellovibrionaceae species (e.g., see references 51, 55, and 67). These small deltaproteobacteria prey on other Gram-negative cells, using flagella to swim rapidly until they collide with a prey cell. After collision, the predator cells then enter the periplasmic space of the prey cell, consume the host cell from within, elongate, and divide into new cells that are released upon host cell lysis (41). Although often described as predatory, the Bdellovibrionaceae may also be considered to be parasitic, as they typically depend (apart from host-independent strains that have been observed [60]) on the infection and death of their host for their reproduction (47).In this study, we examined predation among the myxobacteria, which are also deltaproteobacteria but constitute a monophyletic clade divergent from the Bdellovibrionaceae (17). Myxobacteria are found in most terrestrial soils and in many aquatic environments as well (17, 53, 74). Many myxobacteria, including the model species Myxococcus xanthus, exhibit several complex social traits, including fruiting body formation and spore formation (14, 18, 34, 62, 71), cooperative swarming with two motility systems (64, 87), and group (or “wolf pack”) predation on both bacteria and fungi (4, 5, 8, 9, 15, 50). Using representatives of the genus Myxococcus, we tested for both intra- and interspecific variation in myxobacterial predatory performance across a broad range of prey types. Moreover, we examined whether prey vary substantially in the degree to which they support predatory growth by the myxobacteria and whether patterns of variation in predator performance are constant or variable across prey environments. The latter outcome may reflect adaptive specialization and help to maintain diversity in natural populations (57, 59).Although closely related to the Bdellovibrionaceae (both are deltaproteobacteria), myxobacteria employ a highly divergent mode of predation. Myxobacteria use gliding motility (64) to search the soil matrix for prey and produce a wide range of antibiotics and lytic compounds that kill and decompose prey cells and break down complex polymers, thereby releasing substrates for growth (66). Myxobacterial predation is cooperative both in its “searching” component (6, 31, 82; for details on cooperative swarming, see reference 64) and in its “handling” component (10, 29, 31, 32), in which secreted enzymes turn prey cells into consumable growth substrates (56, 83). There is evidence that M. xanthus employs chemotaxis-like genes in its attack on prey cells (5) and that predation is stimulated by close contact with prey cells (48).Recent studies have revealed great genetic and phenotypic diversity within natural populations of M. xanthus, on both global (79) and local (down to centimeter) scales (78). Phenotypic diversity includes variation in social compatibility (24, 81), the density and nutrient thresholds triggering development (33, 38), developmental timing (38), motility rates and patterns (80), and secondary metabolite production (40). Although natural populations are spatially structured and both genetic diversity and population differentiation decrease with spatial scale (79), substantial genetic diversity is present even among centimeter-scale isolates (78). No study has yet systematically investigated quantitative natural variation in myxobacterial predation phenotypes across a large number of predator genotypes.Given the previous discovery of large variation in all examined phenotypes, even among genetically extremely similar strains, we anticipated extensive predatory variation as well. Using a phylogenetically broad range of prey, we compared and contrasted the predatory performance of 16 natural M. xanthus isolates, sampled from global to local scales, as well as the commonly studied laboratory reference strain DK1622 and representatives of three additional Myxococcus species: M. flavescens (86), M. macrosporus (42), and M. virescens (63) (Table (Table1).1). In particular, we measured myxobacterial swarm expansion rates on prey lawns spread on buffered agar (31, 50) and on control plates with no nutrients or with prehydrolyzed growth substrate.

TABLE 1.

List of myxobacteria used, with geographical origin
Organism abbreviation used in textSpeciesStrainGeographic originReference(s)
A9Myxococcus xanthusA9Tübingen, Germany78
A23Myxococcus xanthusA23Tübingen, Germany78
A30Myxococcus xanthusA30Tübingen, Germany78
A41Myxococcus xanthusA41Tübingen, Germany78
A46Myxococcus xanthusA46Tübingen, Germany78
A47Myxococcus xanthusA47Tübingen, Germany78
A75Myxococcus xanthusA75Tübingen, Germany78
A85Myxococcus xanthusA85Tübingen, Germany78
TVMyxococcus xanthusTvärminneTvärminne, Finland79
PAKMyxococcus xanthusPaklenicaPaklenica, Croatia79
MADMyxococcus xanthusMadeira 1Madeira, Portugal79
WARMyxococcus xanthusWarwick 1Warwick, UK79
TORMyxococcus xanthusToronto 1Toronto, Ontario, Canada79
SUL2Myxococcus xanthusSulawesi 2Sulawesi, Indonesia79
KALMyxococcus xanthusKalalauKalalau, HI79
DAVMyxococcus xanthusDavis 1ADavis, CA79
GJV1Myxococcus xanthusGJV 1Unknown35, 72
MXFL1Myxococcus flavescensMx fl1Unknown65
MXV2Myxococcus virescensMx v2Unknown65
CCM8Myxococcus macrosporusCc m8Unknown65
Open in a separate window  相似文献   

10.
We used a mixture of surrogates (Acinetobacter baumannii, Mycobacterium terrae, hepatitis A virus, and spores of Geobacillus stearothermophilus) for bioagents in a standardized approach to test environmental surface disinfectants. Each carrier containing 10 μl of mixture received 50 μl of a test chemical or saline at 22 ± 2°C. Disinfectant efficacy criteria were ≥6 log10 reduction for the bacteria and the spores and ≥3 log10 reduction for the virus. Peracetic acid (1,000 ppm) was effective in 5 min against the two bacteria and the spores but not against the virus. Chlorine dioxide (CD; 500 and 1,000 ppm) and domestic bleach (DB; 2,500, 3,500, and 5,000 ppm) were effective in 5 min, except for sporicidal activity, which needed 20 min of contact with either 1,000 ppm of CD or the two higher concentrations of DB.Disinfectant testing with a single type of organism does not represent field conditions, where bioagents or other pathogens may be mixed with other contaminants. Such an approach also cannot predict the true spectrum of microbicidal activity of a given chemical, while the identity of the target pathogen(s) is often unknown. We used a mixture of Acinetobacter baumannii, Mycobacterium terrae (15), hepatitis A virus (HAV) (4), and the spores of Geobacillus stearothermophilus as surrogates for infectious bioagents, with an added soil load on disks (1 cm in diameter; 0.75 mm thick) of brushed stainless steel (AISI no. 430; Muzeen & Blythe, Winnipeg, MB, Canada), to better simulate environmental surface disinfection (1, 11). Table Table11 gives details on the microbial strains, media used for their culture and recovery, and methods for preparing working stocks. The quantitative carrier test (QCT) method, ASTM standard E-2197 (1), was used to test the organisms singly and in a mixture. Each 200 μl of the inoculum contained 34 μl each of the four organisms, 40 μl of bovine mucin, 14 μl of yeast extract, and 10 μl of bovine serum albumin stocks.

TABLE 1.

Organisms in the mixture and their growth/recovery media and titers
Organism (ATCC no.)Growth/recovery medium or host cell lineProcedure for culture and prepn of stockViability titer in stock
Mycobacterium terrae pBEN genetically modified in-house (ATCC 15755)Middlebrook 7H11 agar, OADC,a and kanamycin (10 μg/ml); incubation 20 days at 36 ± 1°C7H9 broth with ADCb and glycerol; cells washed and resuspended in deionized water (8 ml) in a Bijoux bottle (Wheaton, Millville, NJ) with glass beads (Sigma-Aldrich; 3 mm in diam; catalog no. Z143928) and stored at 4°C3.7 × 109 CFU/ml
Geobacillus stearothermophilus (ATCC 12980)Trypticase soy agar plates incubated at 56°C for 48 hSpores heat shocked at 100°C for 45 min, washed in deionized H2O, and stored at 4°C1.5 × 108 CFU/ml
Acinetobacter baumannii (ATCC 19606)Trypticase soy agar plates incubated at 36 ± 1°C for 24 hInoculated into Trypticase soy broth and incubated for 24 h at 36 ± 1°C, broth centrifuged, and pellet resuspended in deionized H2O and stored at 4°C1.2 × 109 CFU/ml
Hepatitis A virus (ATCC VR-1402)FRhK-4 cells (CRL-1688) infected and incubated for 6 daysCells grown in MEMc with 7% (vol/vol) fetal bovine serum (Fisher; M33-500) and 1% nonessential amino acids (Gibco; 11140) at 36 ± 1°C, monolayers infected and incubated at 36 ± 1°C for 7 days in medium with no antibiotics, flasks frozen and thawed (thrice), cell lysate centrifuged, and supernatant aliquoted for storage at −80°C8 × 108 PFU/ml
Open in a separate windowaOADC, oleic acid-albumin-dextrose-catalase.bADC, albumin dextrose-catalase.cMEM, minimal essential medium.Disinfectants tested were peracetic acid (PAA; 500 and 1,000 ppm), chlorine dioxide (CD; 500 and 1,000 ppm), and domestic bleach (DB; 2,500, 3,300, and 5,000 ppm). Buffered saline (pH 7.2) was the control fluid, eluent, and diluent. Hard water (400 ppm CaCO3) was the diluent for disinfectants (1).Each disk received 10 μl of the inoculum, dried and covered with 50 μl of test substance, or saline at 22 ± 2°C. At the end of the contact time, each disk was eluted in a neutralizer and the eluates were assayed (1, 9, 11, 12). The neutralizer consisted of 1% dextrose (Difco), 0.7% lecithin (Alfa Aesar), 0.25% sodium bisulfite (J. T. Baker), 0.1% sodium thioglycolate (Sigma), 0.6% sodium thiosulfate (Analar), 0.2% l-cysteine (Sigma), 0.5% tryptone (Oxoid), and 0.1% Tween 80 (Bioshop) in buffered saline (pH 7.2). In each experiment, three control and three test carriers were used, and all experiments were repeated thrice. The performance criteria for the tested substances were ≥3.0 log10 reduction in PFU of the virus and ≥6.0 log10 reductions in the CFU for the other three organisms. When the mixture of test organisms was used, the components were separated by first passing the mixture through a membrane filter (0.22-μm pore diameter) to retain all the organisms except the virus. The filtrate was subjected to plaque assays for HAV in FRhK-4 cells. For the three bacteria, separate filters were placed on appropriate agar plates (Table (Table1)1) and incubated.The data for 5-min contact are given in Table Table2.2. All levels of the disinfectants tested met the criterion for M. terrae and A. baumannii when tested individually or in mixture. Only 1,000 ppm of PAA was effective against the spores. Both levels of PAA were ineffective against HAV, while the other disinfectants could reduce its titer between 3.5 and 4 log10. Only 1,000 ppm of PAA could consistently meet the criterion for sporicidal activity after 10 min (data not shown). Extending the contact time to 20 min allowed both levels of PAA and DB to meet the criterion for sporicidal activity, while 500 ppm of CD failed to do so; CD at 1,000 ppm barely met the criterion when tested alone against the spores but could not do so in the mixture (Fig. (Fig.11).Open in a separate windowFIG. 1.Reductions of G. stearothermophilus spores by the test formulations after 20 min of contact, individually and in a mixture at 22 ± 2°C.

TABLE 2.

Reductions by the test formulations in 5 min at 22 ± 2°C when tested against each organism individually and in a mixture
Disinfectant (concn [ppm])Mean log10 reduction ± SD of:
M. terrae
A. baumannii
G. stearothermophilus
Hepatitis A virus
IndividualMixtureIndividualMixtureIndividualMixtureIndividualMixture
Peracetic acid (500)8.18 ± 0.197.33 ± 0.167.19 ± 0.036.33 ± 0.034.03 ± 0.084.45 ± 0.98Not tested0.30 ± 0.01
Peracetic acid (1,000)8.18 ± 0.197.33 ± 0.167.19 ± 0.036.33 ± 0.038.03 ± 0.287.21 ± 0.590.58 ± 0.220.68 ± 0.09
Chlorine dioxide (500)8.18 ± 0.197.72 ± 0.217.22 ± 0.036.37 ± 0.131.47 ± 0.450.69 ± 0.054.30 ± 0.183.97 ± 0.19
Chlorine dioxide (1,000)8.18 ± 0.197.72 ± 0.217.22 ± 0.036.37 ± 0.133.07 ± 0.091.27 ± 0.054.30 ± 0.183.97 ± 0.19
Domestic bleach (2,500)8.18 ± 0.197.72 ± 0.217.22 ± 0.036.37 ± 0.130.27 ± 0.030.25 ± 0.024.41 ± 0.233.97 ± 0.29
Domestic bleach (3,500)8.18 ± 0.197.72 ± 0.217.22 ± 0.036.37 ± 0.130.27 ± 0.030.25 ± 0.024.41 ± 0.233.45 ± 0.09
Domestic bleach (5,000)8.18 ± 0.197.72 ± 0.217.22 ± 0.036.37 ± 0.130.28 ± 0.010.25 ± 0.024.41 ± 0.233.97 ± 0.29
Open in a separate windowThe study showed the feasibility of testing liquid chemicals against a mixture of suitable surrogates for infectious bioagents. This approach allowed standardized and simultaneous assessment of the spectrum of microbicidal activities of the test formulations under identical conditions that better simulate field conditions and that can be readily adapted to test foams and gaseous chemicals on other carrier materials. The surrogates selected covered the spectrum of microbicide resistances of all currently known classes of infectious bioagents.A. baumannii is among the more environmentally stable and microbicide-resistant vegetative bacteria known (7, 13). M. terrae represented pathogens with generally higher resistance to microbicides (3) and possibly drug-resistant Mycobacterium tuberculosis and category C agents (6). HAV, a small, nonenveloped virus known for its stability and microbicide resistance (9), represented select agents (CBW, biological weapons classification, 2001 [http://www.selectagents.gov/Select%20Agents%20and%20Toxins%20List.html]) and also food- and waterborne pathogens listed as biothreats (2, 10). The spores of G. stearothermophilus may be more resistant to oxidizing chemicals than the spores of Bacillus anthracis (8); their thermophilic nature made them safer to handle and easy to separate from the mixtures.The disinfectants were selected for their commercial availability and broad-spectrum and relatively rapid action (5, 14). The last criterion excluded all but oxidizers because other common active agents are limited as microbicides and/or require hours of contact for sporicidal action.For PAA tests, the recovery of infectious HAV in the absence of any viable spores is somewhat anomalous but not surprising. While we do not believe HAV to be more resistant than bacterial spores, the small size of the virus in the dried inocula likely afforded it significant protection. Compared to HAV, the mycobacterium proved more susceptible to all the disinfectants tested. This highlights a serious weakness in the traditional rankings of disinfectant susceptibility, where mycobacteria are often considered more resistant than nonenveloped viruses (5, 14).In the initial trials with the mixtures, the titer of A. baumannii dropped sharply; using virus pools without antibiotics resolved the issue. The ability of A. baumannii to grow on 7H11 agar and thus interfere with the recovery of M. terrae was addressed by replacing the standard strain of M. terrae with one containing a kanamycin resistance gene (15). Incorporation of enough kanamycin in 7H11 suppressed the growth of A. baumannii while allowing the mycobacterium to grow.Using a mixture of surrogates in QCT not only proved feasible but also highlighted the need to review certain long-held concepts about the relative sensitivities of classes of pathogens to disinfectants. The details reported should allow extension of the work to CL-3 and possibly CL-4 agents to confirm that the results obtained with the carefully chosen surrogates are indeed applicable to various classes of infectious bioagents.  相似文献   

11.
12.
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.

TABLE 1.

Primers used in multiplex amplification for the TMLGT assay
AmpliconPositionaGene(s)PrimerSequence (5′-3′)b
INLa455381-456505inlAinl2-a1GTCCTTGATAGTCTACTG
inl2-a2ACCAAATTAGTAATCTAGCAC
INLb457726-458752inlBinl-f1dGAATTRTTTAGYCAAGAATGT
inlb-rCTACCGGRACTTTATAGTAYG
LMO325116-326096lmo0298-lmo0300lmo-a1AAGGCTTACAAGATGGCT
lmo1a-1rAAATAATAYGTGATACCGAC
VGCa205366-206622plcA, hlyplca-fCTCATCGTATCRTGTGTACC
hly-rTCTGGAAGGTCKTGTAGGTTC
VGCb208447-209465mplra_mpl-fGTGGAYAGAACTCATAAAGG
ra_mpl-rACTCCCTCCTYGTGATASGCT
VGCc209728-211239actAvgc1a-2fTTCMATRCCAGCAGAACG
vgc1a-2rGCAGACCTAATAGCAATGTTG
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number NC_003210).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table (Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.

TABLE 2.

TMLGT probes and probe performance data
ProbebTarget (n)cProbe sequencedIDeSensitivity (%)Specificity (%)
VGCb-21Lineage I (506)AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc7.3100100
VGCa-94Lineage ICTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc51.7100100
VGCc-8Lineage II (340)AATCCTTTTACATTCATTACTTACattagctgattcgctttcct14.1100100
INLb-51Lineage IITCATTTCAATCAATCATCAACAATagcgccaataaagctggc21.9100100
VGCb-19Lineage III (50)TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca31.0100100
VGCb-29Lineage IIIAATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt45.1100100
LMO-17Lineage IV (10)CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt11.8100100
VGCa-27Lineage IVCTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac58.3100100
INLb-84Serogroup 4b (213)TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg9.7100100
INLb-85Serogroup 4bATACTACATCATAATCAAACATCActcgtgaacaagctttcc5.5100100
INLb-16Serogroup 1/2b (293)AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta11.7100100
INLb-100Serogroup 1/2bCTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat13.0100100
LMO-42Serogroup 1/2a (268)CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg6.6100100
VGCb-40Serogroup 1/2aCTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag10.410098.6
LMO-9Serogroup 1/2c (72)TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg13.5100100
VGCb-5Serogroup 1/2cCAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac20.898.6100
LMO-10ECI (111)ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag19.0100100
LMO-28ECICTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt23.7100100
VGCc-80ECIa (44)CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc10.7100100
VGCa-35ECIaCAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt9.2100100
LMO-12ECII (35)TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt3.8100100
LMO-30ECIITTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa7.5100100
VGCc-45ECIII (10)TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc21.110099.4
INLa-3ECIIITACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta17.010099.4
INLa-1INLa controlCTTTAATCTCAATCAATACAAATCagaagtggaagctgggaaNAaNANA
INLb-13INLb controlCAATAAACTATACTTCTTCACTAAtgcacctaaacctccgacNANANA
LMO-88LMO controlTTACTTCACTTTCTATTTACAATCccgtttccttatgccacaNANANA
VGCa-23VGCa controlTTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcgNANANA
VGCb-25VGCb controlCTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrccaNANANA
VGCc-82VGCc controlTACATACACTAATAACATACTCATgactgcatgctagaatctaagNANANA
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology.   相似文献   

13.
14.
At present there is little quantitative information on the identity and composition of bacterial populations in the rumen microbial community. Quantitative fluorescence in situ hybridization using newly designed oligonucleotide probes was applied to identify the microbial populations in liquid and solid fractions of rumen digesta from cows fed barley silage or grass hay diets with or without flaxseed. Bacteroidetes, Firmicutes, and Proteobacteria were abundant in both fractions, constituting 31.8 to 87.3% of the total cell numbers. They belong mainly to the order Bacteroidales (0.1 to 19.2%), hybridizing with probe BAC1080; the families Lachnospiraceae (9.3 to 25.5%) and Ruminococcaceae (5.5 to 23.8%), hybridizing with LAC435 and RUM831, respectively; and the classes Deltaproteobacteria (5.8 to 28.3%) and Gammaproteobacteria (1.2 to 8.2%). All were more abundant in the rumen communities of cows fed diets containing silage (75.2 to 87.3%) than in those of cows fed diets containing hay (31.8 to 49.5%). The addition of flaxseed reduced their abundance in the rumens of cows fed silage-based diets (to 45.2 to 58.7%) but did not change markedly their abundance in the rumens of cows fed hay-based diets (31.8 to 49.5%). Fibrolytic species, including Fibrobacter succinogenes and Ruminococcus spp., and archaeal methanogens accounted for only a small proportion (0.4 to 2.1% and 0.2 to 0.6%, respectively) of total cell numbers. Depending on diet, between 37.0 and 91.6% of microbial cells specifically hybridized with the probes used in this study, allowing them to be identified in situ. The identities of other microbial populations (8.4 to 63.0%) remain unknown.The rumen is an anaerobic ecosystem used by herbivores to convert fibrous plant material into fermentation products that are in turn used as energy by the host. Fibrolytic degradation is accomplished by a complex microbial community which includes specialized fungi, protozoa, and bacteria (14). More than 200 bacterial species (5) have been isolated from rumen, and many of these have been phylogenetically and physiologically characterized. Several of these, including Fibrobacter succinogenes, Ruminococcus albus, and Ruminococcus flavefaciens, have the ability to hydrolyze cellulose in axenic culture (24). Despite the presence of these fibrolytic populations, a large portion of the fiber in low-quality forage diets passes through the rumen undigested. In the rumen, fibrolytic bacteria do not digest plant cell walls in isolation but rather interact with a consortium of bacteria (18). Although culture-dependent studies have improved our understanding of rumen microbiology, the importance of the isolates to the structure and function of the rumen microbial community, with the possible exception of the fibrolytic strains, is still unknown. Expanding our knowledge of the structure and function of the rumen microbial community may provide insights into approaches to improve the efficiency of fiber digestion and biofuel production (14).To provide a high-resolution view of the population structure of the rumen bacterial community, we used quantitative fluorescence in situ hybridization (qFISH) to investigate the composition and distribution of bacterial populations associated with the liquid and solid rumen contents from 12 ruminally cannulated Holstein dairy cows (3 cows were used for each diet) fed (for at least 21 days) grass hay or barley silage diets with or without flaxseed (Table (Table1).1). Six new 16S rRNA-targeted FISH probes (Table (Table2)2) for not only the fibrolytic groups but also other unclassified bacterial groups in the rumen were designed, using ARB software (17), against the rumen 16S rRNA gene sequences (data not shown) retrieved from the Ribosomal Database Project (RDP) database (6). The new probes target Bacteroidales-related clones (probe BAC1080) (phylum Bacteroidetes), Lachnospiraceae- and Ruminococcaceae-related clones (probes LAC435 and RUM831, respectively) (phylum Firmicutes), Butyrivibrio fibrisolvens-related clones (probe BFI826), and R. albus- and R. flavefaciens-related clones (probes RAL1436 and RFL155, respectively).

TABLE 1.

Composition of diets used in this study
IngredientDiet composition (% dry weight)
Hay-based dietHay and flaxseed dietSilage-based dietSilage and flaxseed diet
Alfalfa grass hay (chopped)47.547.500
Barley silage0047.547.5
Steamed rolled barley grain47.532.547.532.5
Ground flaxseeds015015
Other5555
Open in a separate window

TABLE 2.

Oligonucleotide probes and their target populations used in this study for FISH analyses
Probe nameaTarget rRNADesigned target(s)% FAbReference
EUB338 (00159)16SDomain Bacteria0-5016
EUB338II (00160)16SPhylum Planctomycetes0-5016
EUB338III (00161)16SPhylum Verrucomicrobia0-5016
NONEUB (00243)16SControl probe complementary to EUB3380-5016
ALF968 (00021)16SClass Alphaproteobacteria, phylum Proteobacteria2016
BET42a (00034)23SClass Betaproteobacteria, phylum Proteobacteria3516
GAM42a (00174)23SClass Gammaproteobacteria, phylum Proteobacteria3516
SRB385 (00300)16SClass Deltaproteobacteria, phylum Proteobacteria3516
SRB385Db (00301)16SClass Deltaproteobacteria, phylum Proteobacteria3516
HGC69a (00182)23SPhylum Actinobacteria2516
GNSB941 (00718)16SPhylum Chloroflexi3516
CFX1223 (00719)16SPhylum Chloroflexi3516
SPIRO1400 (01004)16SSubgroup of family Spirochaetaceae2016
TM7-905 (00600)16SCandidate phylum TM72016
LGC354A (00195)16SPhylum Firmicutes3516
LGC354B (00196)16SPhylum Firmicutes3516
LGC354C (00197)16SPhylum Firmicutes3516
RUM83116SRumen clones in family Ruminococcaceae, phylum Firmicutes35This study
RAL143616SRuminococcus albus-related clones, phylum Firmicutes20This study
RFL15516SRuminococcus flavefaciens-related clones, phylum Firmicutes45This study
LAC43516SClones in family Lachnospiraceae, phylum Firmicutes35This study
BFI82616SButyrivibrio fibrisolvens-related clones, phylum Firmicutes35This study
BAC108016SClones in order Bacteroidales, phylum Bacteroidetes20This study
Fibr225 (00005)16SFibrobacter succinogenes-related clones, phylum Fibrobacteres20c16
ARCH915 (00027)16SDomain Archaea2016
Open in a separate windowaThe numbers in parentheses after the probe names represent the probe accession numbers in probeBase (16).bFA, formamide concentration used in the FISH buffer.cThe optimum formamide concentration for the probe was determined in this study.The optimal formamide concentrations (OFC) of the new probes used in FISH were assessed in different ways. Probes RUM831 and BAC1080 were assessed by using pure cultures of Ruminococcus and Prevotella strains with zero and one mismatch (Fig. (Fig.1)1) to the probes. The OFC of probes LAC435 and BFI826 were assessed using Clone-FISH (21) with zero and one mismatch 16S rRNA clone (Fig. (Fig.1)1) by following the procedure described previously (9, 10). The highest formamide concentration (tested in 5% stepwise increases) at which a clear fluorescent signal was observed with the reference bacterium or competent cells with zero mismatches after FISH probing, but not with bacteria or competent cells with one mismatch, was selected. The OFC of probes FIB225 (designed by Stahl et al. [23]), RFL155, and RAL1436 were assessed using only pure cultures of F. succinogenes, R. flavefaciens, and R. albus, respectively, all having perfect matches to each probe (Fig. (Fig.1).1). The highest formamide concentration (tested in 5% stepwise increases) at which a clear fluorescent signal was observed with the reference bacterium after FISH probing was selected. These probes were employed with other available probes (Table (Table2)2) chosen from probeBase (16) based on the alignment and classification of the 16S rRNA gene sequences retrieved from rumen communities.Open in a separate windowFIG. 1.Alignments of the probe sequences and their target sites and sequences of corresponding sites in reference bacteria or clones. The probe names in parentheses after the abbreviated names are according to Oligonucleotide Probe Database nomenclature (2). Only the nucleotides that are different from target sequences are shown. E, empty space; R., Ruminococcus; P., Prevotella; F., Fibrobacter.The digest samples from the top, bottom, and middle of the rumen were collected through a cannula, thoroughly mixed, and fractioned as liquid fraction (LiqF) and solid fraction (SolF). On-site, about 100 ml was transferred to a heavy-wall 250-ml beaker and squeezed using a Bodum coffee maker plunger (Bodum Inc., Triengen, Switzerland). The extruded liquid samples (containing the planktonic cells) were fixed in ethanol and paraformaldehyde (PFA) for FISH probing (3). The remaining liquid was discarded, and the squeezed particulate samples (used to collect particulate-attached cells) were washed with 100 ml phosphate buffer (5.23 g/liter K2HPO4, 2.27 g/liter KH2PO4, 3.00 g/liter NaHCO3, and 20 ml/liter 2.5% cysteine HCl) by stirring gently with a spatula, followed by squeezing again and decanting. Washed particulate samples (5 g) were then fixed for FISH as described above.After fixation, the particulate samples plus the fixation solution were transferred into a stomacher bag and “stomached” (Stomacher 400 Circulator, Seaward England) at 230 rpm for 6 min. Treated samples were then transferred into a clean 250-ml beaker and squeezed again. Microscopic examination of the squeezed residues after DAPI (4′,6-diamidino-2-phenylindole) staining (100 μl [0.003 mg/ml] for 10 min) showed only a few bacterial cells attached on the plant fibers, indicating that most bacterial cells had been “stomached” into the liquid (data not shown). To recover cells, filtrates were centrifuged (5,000 × g), and the cell pellet was washed three times with phosphate buffer before being used for FISH probing. On the day of sampling, each cow was sampled twice, at 1100 h and 1600 h. The liquid FISH samples obtained from the 3 cows fed with the same diet (at two different sampling times) were mixed, as were the particulate FISH samples, and used in qFISH analysis. FISH was carried out according to Amann (3). FISH was carried out on glass coverslips (24 by 60 mm) coated with gelatin (9). DAPI staining of biomass samples was carried out after FISH probing. FISH and DAPI images were captured with a Zeiss epifluorescence microscope (Zeiss PM III) equipped with a Canon 5D Mark II camera. Raw images captured randomly were transferred into gray TIF images and sharpened in Adobe Photoshop CS3. Cells stained with DAPI and hybridized to the probes were enumerated using the function provided in ImageJ (1). The percent compositions of these probe-defined groups (against all DAPI-stained cells in the same microscopic field) in the different fractions of rumen contents from cows fed different diets are presented in Table Table33.

TABLE 3.

Distribution and composition of FISH probe-defined groups in rumen microbial communities in cows fed with different diets
Probe-defined microbial groupComposition (mean value [%] ± SD)a
Hay-based diet
Hay and flaxseed diet
Silage-based diet
Silage and flaxseed diet
LiqFSolFLiqFSolFLiqFSolFLiqFSolF
BAC10809.6 ± 1.330.1 ± 0.0219.2 ± 3.714.2 ± 0.7214.2 ± 3.1118.8 ± 3.8814.4 ± 2.8916.7 ± 4.33
ALF9680.2 ± 0.020.2 ± 0.020.2 ± 0.030.2 ± 0.040.7 ± 0.141.5 ± 0.410.1 ± 0.010.1 ± 0.01
BET42a000.6 ± 0.011.2 ± 0.270.1 ± 0.01<0.10.4 ± 0.060.2 ± 0.04
GAM42a3.2 ± 0.534.4 ± 0.574.2 ± 0.764.5 ± 0.672.0 ± 0.321.2 ± 0.238.2 ± 1.235.3 ± 0.95
SRBmix5.8 ± 0.8811.6 ± 2.439.0 ± 1.5210.1 ± 2.5628.3 ± 4.4323.3 ± 4.547.7 ± 0.7813.2 ± 2.22
CHLmix1.7 ± 0.2700.5 ± 0.010 ± 00.2 ± 0.020.4 ± 0.070.1 ± 0.010.1 ± 0.02
SPIRO14000.5 ± 0.091.9 ± 0.321.7 ± 0.332.0 ± 0.211.4 ± 0.311.9 ± 0.330.4 ± 0.030.4 ± 0.07
TM7-9050.6 ± 0.080.8 ± 0.070.5 ± 0.010.1 ± 0.031.5 ± 0.230.2 ± 0.020.6 ± 0.020.3 ± 0.08
HGC69a1.3 ± 0.282.1 ± 0.310.3 ± 0.060.3 ± 0.050.4 ± 0.030.1 ± 0.020.5 ± 0.090.2 ± 0.02
RUM8315.5 ± 0.135.7 ± 0.895.8 ± 0.738.9 ± 1.3218.0 ± 4.1323.8 ± 3.115.6 ± 1.147.4 ± 1.32
RAL14360.4 ± 0.060.3 ± 0.030.2 ± 0.060.2 ± 0.030.3 ± 0.050.6 ± 0.090.7 ± 0.130.6 ± 0.12
RFL1550.7 ± 0.110.2 ± 0.030.3 ± 0.070.7 ± 0.190.1 ± 0.010.8 ± 0.110.5 ± 0.061.2 ± 0.34
LAC43525.5 ± 3.9810.0 ± 1.519.6 ± 1.3111.7 ± 1.6712.6 ± 2.5620.2 ± 3.239.3 ± 1.5116.1 ± 3.31
BFI8260.3 ± 0.060.4 ± 0.050.4 ± 0.060.7 ± 0.120.5 ± 0.050.3 ± 0.082.4 ± 0.370.2 ± 0.02
Fibr225000.2 ± 0.040.1 ± 0.020.8 ± 0.140.7 ± 0.140.4 ± 0.110.1 ± 0.04
ARCH9150.3 ± 0.080.2 ± 0.070.6 ± 0.010.3 ± 0.070.6 ± 0.090.1 ± 0.020.4 ± 0.050.4 ± 0.06
Total hybridizedb54.13752.443.780.991.64860.7
Otherc45.96347.656.319.18.45239.3
Open in a separate windowaThe two numbers represent the mean value (%) and the standard deviation of individual probe-defined microbial groups in a specified rumen digest fraction, which were calculated based on 3 mean values, each consisting of 20 enumerations.bThe numbers represent the sum of percentages of all individual probe-defined microbial groups in a specified rumen digest fraction. The percentages obtained with FISH probes RAL1436, RFL155, and BFI826 were not counted in the sum because the bacterial cells hybridizing with the former two probes also hybridized with RUM831, and the bacterial cells hybridizing with the last probe also hybridized with probe LAC435.cThe numbers represent the percentages of microorganisms which were not identified by FISH in a specified rumen digest fraction.We provided quantitative data by using qFISH to show that Bacteroidetes, Firmicutes, and Proteobacteria were abundant in both the LiqF and the SolF, constituting 31.8 to 87.3% of the total cell numbers. These FISH data add weight to the view that Firmicutes and Bacteroidetes might be dominant in rumens, as suggested previously from their high ratios retrieved from 16S rRNA clone libraries (e.g., see references 12, 26, and 27). However, information emerging from 16S rRNA gene clone library data cannot be used to reach conclusions on the quantitative composition of the rumen bacterial community. Bacteria may have 1 to 14 copies of rRNA genes, and several biases are known to be associated with their PCR amplification (8).These 3 dominant bacterial groups have been identified at a high-resolution level. They belong mainly to the order Bacteroidales (0.1 to 19.2%), hybridizing with probe BAC1080 (Fig. (Fig.22 A); the families Lachnospiraceae (9.3 to 25.5%) and Ruminococcaceae (5.5 to 23.8%), hybridizing with LAC435 (Fig. (Fig.2E)2E) and RUM831 (Fig. (Fig.2D),2D), respectively; and the classes Deltaproteobacteria (5.8 to 28.3%) and Gammaproteobacteria (1.2 to 8.2%), hybridizing with SRBmix (equal moles of SRB385 and SRB385Db) (Fig. (Fig.2C)2C) and GAM42a (Fig. (Fig.2B),2B), respectively. All were more abundant in the microbial communities in the rumens of cows fed diets containing silage (75.2 to 87.3%) than in those in the rumens of cows fed diets containing hay (31.8 to 49.5%). These results show how diets containing different forages (hay or silage) may influence the distribution of the microbial populations, which is in line with data by Tajima et al. (25). We also found in this study that the addition of flaxseed (to inhibit methane emission) reduced their abundance in the rumens of cows fed silage-based diets (to 45.2 to 58.7%) but did not change markedly their abundance in the rumens of cows fed hay-based diets (31.8 to 49.5%), suggesting that adding flaxseed to these diets also affected rumen microbial community composition, although the extent of its influence reflected the forage used, being more profound with a silage-based diet than when hay was used.Open in a separate windowFIG. 2.Images of digest samples from the rumens of cows fed hay- or silage-based diets with and without flaxseed after color combination. Images from probes are labeled in red, and those from DAPI staining are in green. The yellow (combination of red and green), including those partly colored cells in panels A to F, hybridized with probes BAC1080, GAM42a, SRBmix, RUM831, LAC435, and ARCH915, respectively. A few cells (arrows) hybridizing with SRBmix (C) were not stained by DAPI. Bars, 10 μm.We also present evidence here to suggest that Proteobacteria are common members of the microbial community, with sulfur-reducing bacteria (SRB) belonging to Deltaproteobacteria in particular being readily detected (up to 28% of the total cells) in both the LiqF and the SolF of rumen contents from cows fed the four different diets examined here. SRB have seldom been retrieved in clone libraries obtained from rumen samples. Lin et al. (15) have estimated SRB abundance in the rumen using DNA hybridization and concluded that they were of minor importance (0.7 to 0.8% of the total rRNA). Our estimates are much higher than those for every diet regime examined, possibly reflecting the coverage of the probes used in the two different studies. The probe mixture SRBmix used here targets most members of the Deltaproteobacteria, while those of Lin et al. (15) covered mainly members of the Desulfobacteraceae, Desulfovibrionaceae, and Desulfobulbaceae. We also recognized that the probe mixture SRBmix perfectly matched with the 16S rRNA genes of some bacteria other than SRB in Deltaproteobacteria. The possibility of overestimation of SRB cannot be ruled out. Interestingly, our data suggest that Gammaproteobacteria were abundant in some of the rumen communities we examined by FISH, comprising 1.2 to 8.2% of total cells.The other unexpected finding was that the fibrolytic bacteria and archaeal methanogens accounted for only a minor fraction of the communities. Of the three characterized fibrolytic bacterial species, F. succinogenes was not detected in the rumen digesta from cattle fed the hay-based diet but was present in the remainder of the diets. In contrast, R. albus and R. flavefaciens were present in both the LiqF and the SolF of the rumen digesta from cows fed all four diets. Although the importance of these bacteria within the rumen microbial community cannot be denied, these three populations accounted for only 0.7 to 2.1% of the total microbial cells. This numerical range compares well with that determined previously for F. succinogenes (0.1 to 6.9% of total rRNA) (4, 23) and Ruminococcus spp. (1.5 to 2.9% of total rRNA) (11), considering that different animals and diets were used in those studies and that different specificities of the probes and different detection methods were used. However, this is much lower than the 9% (of total rRNA) detected by Michalet-Doreau et al. (19) in their work. The abundance of fibrolytic B. fibrisolvens-related species was also low, being present at <1% in all fractions, except in the LiqF in cows fed the mixture of silage and flaxseed, where they contributed 2.4% of total cells.Methanogens hybridized to ARCH915 (Fig. (Fig.2F)2F) were present (0.1 to 0.6%) in all rumen samples examined by FISH, which is close to or within the range (0.3 to 3.3%) estimated in other studies (15, 22). Interestingly, no marked difference in abundance of the methanogens could be seen between the samples from the rumens of cows fed diets with flaxseed and those from the rumens of cows fed diets without flaxseed, although it has been reported (7) that the addition of fatty acids could decrease methane production in the rumen. This may be due to the presence of methanogens with different activities in different rumen samples or the inability of probe ARCH915 to hybridize to all methanogens in the rumen samples examined here.Bacteria belonging to Chloroflexi, TM7, Spirochetes, and Actinobacteria hybridizing with CHLmix, TM7-905, SPRO1400, and HGC69a, respectively, accounted for only a minor fraction of the total cell numbers observed. In most cases, their abundances in each fraction did not change markedly with diet, always being present in small numbers (0 to 1%), suggesting that they have a minor role there. This conclusion, however, has to be confirmed since many (8.4 to 63.0%, depending on diet) of the bacteria could not be identified in the rumens of cows fed with all diets except the silage-based diet (Table (Table33).FISH with the probes designed in this study failed to identify all of the bacterial cells. This is because the probes do not target all rumen 16S rRNA gene sequences and/or the true extent of rumen biodiversity has not been revealed from cloning analyses. This indicates that our current understanding of the quantitative composition of the rumen microbial community is far from complete. Moreover, no physiological data were generated in this study to suggest what the role(s) of most of the dominant populations (except the SRB hybridized with probe SRBmix) identified by FISH might be, meaning that it is still not possible to link their abundance to their in situ function. Furthermore, each FISH-probed population probably includes bacteria with different phenotypes. Clearly, much needs to be done before the structure and function of the rumen microbial community are fully understood.FISH is a useful tool in the investigation of microbial composition in complex ecosystems (3). However, FISH probes targeting rumen bacterial populations are limited. By comparison with other culture-independent methods, e.g., quantitative PCR, FISH has several advantages (8). In particular, in combination with histochemical staining methods (20) and microautoradiography (MAR-FISH) (13), the in situ ecophysiology of a targeted population can be determined under specified electron acceptor conditions. These techniques may provide important clues as to the functional role of microbial populations within complex communities, like that of the rumen. The possession of the FISH probes described in this paper could allow such studies to be undertaken in herbivore rumens.  相似文献   

15.
16.
Melioidosis has been considered an emerging disease in Brazil since the first cases were reported to occur in the northeast region. This study investigated two municipalities in Ceará state where melioidosis cases have been confirmed to occur. Burkholderia pseudomallei was isolated in 26 (4.3%) of 600 samples in the dry and rainy seasons.Melioidosis is an endemic disease in Southeast Asia and northern Australia (2, 4) and also occurs sporadically in other parts of the world (3, 7). Human melioidosis was reported to occur in Brazil only in 2003, when a family outbreak afflicted four sisters in the rural part of the municipality of Tejuçuoca, Ceará state (14). After this episode, there was one reported case of melioidosis in 2004 in the rural area of Banabuiú, Ceará (14). And in 2005, a case of melioidosis associated with near drowning after a car accident was confirmed to occur in Aracoiaba, Ceará (11).The goal of this study was to investigate the Tejuçuoca and Banabuiú municipalities, where human cases of melioidosis have been confirmed to occur, and to gain a better understanding of the ecology of Burkholderia pseudomallei in this region.We chose as central points of the study the residences and surrounding areas of the melioidosis patients in the rural areas of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50′W) (Fig. (Fig.1).1). There are two well-defined seasons in each of these locations: one rainy (running from January to May) and one dry (from June to December). A total of 600 samples were collected at five sites in Tejuçuoca (T1, T2, T3, T4, and T5) and five in Banabuiú (B1, B2, B3, B4, and B5), distributed as follows (Fig. (Fig.2):2): backyards (B1 and T1), places shaded by trees (B2 and T2), water courses (B3 and T3), wet places (B4 and T4), and stock breeding areas (B5 and T5).Open in a separate windowFIG. 1.Municipalities of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50″W).Open in a separate windowFIG. 2.Soil sampling sites in Banabuiú and Tejuçuoca.Once a month for 12 months (a complete dry/rainy cycle), five samples were gathered at five different depths: at the surface and at 10, 20, 30 and 40 cm (Table (Table1).1). The samples were gathered according to the method used by Inglis et al. (9). Additionally, the sample processing and B. pseudomallei identification were carried out as previously reported (1, 8, 9).

TABLE 1.

Distribution of samples with isolates by site and soil depth
Sitesa and depth (cm)No. of B. pseudomallei isolates in samples from:
Banabuiú (n = 300)Tejuçuoca (n = 300)Total (n = 600)
B1/T13
    Surface2
    10
    201
    30
    40
B2/T21
    Surface1
    10
    20
    30
    40
B3/T315
    Surface2
    102
    204
    303
    404
B4/T45
    Surface
    101
    201
    3011
    401
B5/T52
    Surface
    10
    20
    302
    40
Total62026
Open in a separate windowaSites designated with B are in Banabuiú, and sites designated with T are in Tejuçuoca. See the text for details.The data on weather and soil composition were obtained from specialized government institutions, such as FUNCEME, IPECE, and EMBRAPA. The average annual temperature in both municipalities is between 26 and 28°C. In 2007, the annual rainfall in Tejuçuoca was 496.8 mm, and that in Banabuiú was 766.8 mm. There are a range of soil types in both Tejuçuoca and Banabuiú: noncalcic brown, sodic planossolic, red-yellow podzolic, and litholic. In Banabuiú, there are also alluvial and cambisol soils. The characteristic vegetation in both municipalities is caatinga (scrublands).There were isolates of B. pseudomallei in 26 (4.3%) of the 600 samples collected. The bacterium was isolated at a rate (3%) similar to that previously reported (9). The bacterium isolation occurred in both the dry (53.8%) and the rainy (46.2%) seasons. Tejuçuoca represented 76.9% (20/26) of the strains isolated. Four sites in Tejuçuoca (T1, T3, T4, and T5) and three in Banabuiú (B1, B2, and B4) presented isolates of the bacterium (Table (Table1).1). The isolation of the B. pseudomallei strains varied from the surface down to 40 cm. However, 17 of the 26 positive samples (65.3%) were found at depths between 20 and 40 cm (Table (Table1).1). Only two isolates were found at the surface during the dry season.A study in Vietnam (13) and one in Australia (9) reported the presence of B. pseudomallei near the houses of melioidosis patients. In our study, the same thing happened. Site T3 (15/26; 57.6%) was located 290 m from the patient''s house, as reported by the Rolim group (14).B. pseudomallei was isolated from a sheep paddock in Australia, where animals sought shelter below mango and fig trees (17). In our study, the bacterium was isolated at site T5, a goat corral alongside the house where the outbreak occurred in Tejuçuoca. Four sites in places shaded by trees yielded positive samples (30.7%) in both Tejuçuoca (palm trees) and Banabuiú (mango trees). Additionally, B. pseudomallei was isolated on three occasions from a cornfield (site 4B) located alongside the house of the melioidosis patient in Banabuiú.In the main areas of endemicity, the disease is more prevalent in the rainy season (4, 5, 16). The outbreak in Tejuçuoca was related to rainfall (14). Besides the association of cases of the disease with rainfall itself, the isolation of B. pseudomallei in soil and water was also demonstrated during the dry season (12, 15). An Australian study isolated strains from soil and water during the dry and rainy seasons (17). A Thai study also reported B. pseudomallei in the dry season (18). In our study, the isolation of B. pseudomallei took place either at the end of the wet season or in the dry months. Fourteen of the positive samples (53.8%) were collected during the dry season, albeit near a river or reservoir (sites T3 and B4).Physical, biological, and chemical soil features appear to influence the survival of B. pseudomallei (6, 10). In the present study, the soil was classified as litholic with sandy or clayey textures. It is susceptible to erosion, and when there is a lack of water, it is subject to salinization. During the dry season, the clay layer becomes dried, cracked, and very hard. During the rainy season, it becomes soggy and sticky. The isolation of B. pseudomallei in the dry season is possibly related to the capacity for adaptation of this soil, since the extreme conditions of lithosols do not prevent the bacterial growth and survival.It has been shown that B. pseudomallei is more often isolated at depths between 25 and 45 cm (17). In our study, 65.3% of the positive samples were taken at depths between 20 and 40 cm. Moreover, of these 17 samples, 10 (58.8%) were collected during the dry months. Also, unlike in other regions, two positive samples were taken from the surface in the period without rainfall.The rainfall in Tejuçuoca and Banabuiú is generally low, and temperatures do not vary significantly during the year. Therefore, the isolation of B. pseudomallei in these places occurs outside the rainfall, temperature, and moisture conditions observed in other regions of endemicity. Our data thus suggest that peculiar environmental features, such as soil composition, might favor the multiplication of B. pseudomallei in northeast Brazil.  相似文献   

17.
18.
Resistance of greenhouse-selected strains of the cabbage looper, Trichoplusia ni, to Bacillus thuringiensis subsp. kurstaki was countered by a hybrid strain of B. thuringiensis and genetically modified toxins Cry1AbMod and Cry1AcMod, which lack helix α-1. Resistance to Cry1AbMod and Cry1AcMod was >100-fold less than resistance to native toxins Cry1Ab and Cry1Ac.Insecticidal proteins from Bacillus thuringiensis are used widely for pest control, but evolution of resistance by pests can reduce their efficacy (3, 4, 6, 14). Resistance to B. thuringiensis toxins has been reported in field populations of four species of Lepidoptera, one species in response to sprays (3, 14) and three species in response to transgenic crops (10, 15, 16). Here, we focus on understanding and countering resistance to sprays of Bacillus thuringiensis subsp. kurstaki that evolved in commercial greenhouse populations of the cabbage looper, Trichoplusia ni (7, 17).We compared responses to single toxins and formulations of B. thuringiensis by two resistant strains (GipBtR and GlenBtR) and two related susceptible strains (GipS and GlenS) of T. ni. All four strains were started by the collection of larvae in 2001 from commercial greenhouses near Vancouver in British Columbia, Canada (7). Resistance evolved in the greenhouses in response to repeated sprays of DiPel (7), a formulation of B. thuringiensis subsp. kurstaki strain HD1 containing Cry1Aa, Cry1Ab, Cry1Ac, and Cry2Aa (9). Previously reported concentrations required to kill 50% of larvae (LC50s) indicated that, relative to a susceptible laboratory strain, initial resistance to DiPel was 113-fold in the Gip population (labeled T2c in reference 7) and 24-fold in the Glen population (labeled P5 in reference 7).We reared larvae on a wheat germ diet (5) at 26°C on a light-to-dark schedule of 16 h:8 h. GipS and GlenS were reared on diet without B. thuringiensis toxins, which allowed resistance to decline (7). To maintain resistance, GipBtR and GlenBtR were reared each generation on a diet treated with 5 or 10 mg of DiPel WP (Abbott Laboratories, Ontario, Canada) per milliliter of diet (7). In bioassays, groups of five third-instar larvae were put in 60-ml plastic cups containing diet, and mortality was assessed after 3 days by gently probing larvae for movement.We used diet overlay bioassays to evaluate the toxicity to GipBtR and GipS of the protoxin forms of Cry1Ab, Cry1Ac, Cry1AbMod, and Cry1AcMod produced in B. thuringiensis strains (12). Cry1AbMod and Cry1AcMod are genetically engineered variants of Cry1Ab and Cry1Ac, respectively, each lacking 56 amino acids from the amino-terminal region, including helix α-1 (12). An 80-μl aliquot containing distilled water and toxin was dispensed evenly over the surfaces of 2 ml of diet (a mean surface area of 7.1 cm2) and allowed to dry. Fifty to 200 larvae from each strain were tested at five to eight concentrations of each toxin.We used diet incorporation bioassays (7) to evaluate the toxicities of DiPel and Agree WG (Certis, Columbia, MD) to GipS, GipBtR, GlenS, and GlenBtR. Agree is a formulation of hybrid strain GC91, which was created from the conjugation-like transfer of a plasmid from B. thuringiensis subsp. kurstaki strain HD191 into B. thuringiensis subsp. aizawai strain HD135, and it contains Cry1Ac, Cry1C, and Cry1D (1, 8). DiPel and Agree were diluted in distilled water and mixed into diet (7). Twenty-five to 50 larvae from each strain were tested at six to seven concentrations of DiPel and Agree.We used probit analysis (13) to estimate the LC50s and their 95% fiducial limits (FL), as well as the slopes of concentration-mortality lines and their standard errors. The mortality of larvae fed treated diet was not adjusted for the mortality of control larvae on untreated diet, because the control mortality was low (mean, 3.6%; range, 0 to 16%). LC50s with nonoverlapping 95% FL are significantly different. Resistance ratios were calculated as the LC50 of a resistant strain (GipBtR or GlenBtR) divided by the LC50 of its susceptible counterpart (GipS or GlenS).The genetically modified toxins Cry1AbMod and Cry1AcMod were much more effective than the native toxins Cry1Ab and Cry1Ac against larvae of T. ni from the resistant GipBtR strain (Table (Table1).1). Resistance ratios of GipBtR were 580 for Cry1Ab and 1,400 for Cry1Ac but only 5.5 for Cry1AbMod and 9.3 for Cry1AcMod (Table (Table1).1). Against GipBtR, the LC50 was 53-fold higher for Cry1Ab than for Cry1AbMod and 11-fold higher for Cry1Ac than for Cry1AcMod (Table (Table1).1). Against GipS, however, the LC50 was 2-fold higher for Cry1AbMod than for Cry1Ab and 14-fold higher for Cry1AcMod than for Cry1Ac (Table (Table11).

TABLE 1.

Responses of resistant (GipBtR and GlenBtR) and susceptible (GipS and GlenS) strains of T. ni to native toxins (Cry1Ab and Cry1Ac), modified toxins (Cry1AbMod and Cry1AcMod), and formulations (DiPel and Agree)
Toxin or formulationStrainNo. of larvaeLC50 (95% FL)aSlope ± SEResistance ratiob
Cry1AbGipBtR400180 (59-2,900)c0.41 ± 0.09580
GipS3760.30 (0.21-0.41)0.56 ± 0.06
Cry1AbModGipBtR4003.4 (2.6-4.6)0.52 ± 0.055.5
GipS3750.62 (0.51-0.75)0.99 ± 0.09
Cry1AcGipBtR60054 (35-110)d0.50 ± 0.071,400
GipS1,4500.038 (0.031-0.046)0.44 ± 0.02
Cry1AcModGipBtR6005.1 (4.4-5.8)0.85 ± 0.069.3
GipS1,1450.55 (0.47-0.64)0.60 ± 0.03
DiPelGipBtR12566 (21-420,000)e0.43 ± 0.17370
GipS1250.18 (0.08-0.27)0.73 ± 0.16
AgreeGipBtR3004.9 (3.6-7.7)0.81 ± 0.129.9
GipS3000.49 (0.42-0.57)1.4 ± 0.14
DiPelGlenBtR1503.2 (2.7-3.9)1.9 ± 0.2726
GlenS1250.13 (0.05-0.17)1.5 ± 0.44
AgreeGlenBtR3002.0 (1.7-2.4)1.2 ± 0.125.9
GlenS2950.34 (0.29-0.39)1.4 ± 0.17
Open in a separate windowaConcentration that killed 50% and its 95% FL in mg protoxin per cm2 diet for toxins and mg formulation per ml of diet for DiPel and Agree.bLC50 of the resistant strain divided by the LC50 of the related susceptible strain for each toxin or formulation.cTotal of 17% mortality at the highest toxin concentration tested (17 mg protoxin/cm2 diet).dTotal of 35% mortality at the highest toxin concentration tested (23 mg protoxin/cm2 diet).eTotal of 24% mortality at the highest toxin concentration tested (15 mg DiPel/ml diet).Agree was more effective than DiPel against the two resistant strains GipBtR and GlenBtR (Table (Table1).1). Resistance ratios for DiPel were 370 for GipBtR and 26 for GlenBtR compared to resistance ratios for Agree, which were 9.9 for GipBtR and 5.9 for GlenBtR (Table (Table1).1). For the two resistant strains, LC50s were higher for DiPel than for Agree (13-fold higher against GipBtR and 1.6-fold higher against GlenBtR) (Table (Table1).1). Conversely, against the two susceptible strains, the LC50s were higher for Agree than for DiPel (2.7-fold higher against GipBtR and 2.6-fold higher against GlenBtR).The resistant GipBtR strain examined here (Table (Table1)1) and the resistant GLEN-Cry1Ac-BCS strain of T. ni studied by Wang et al. (17) had >500-fold resistance to Cry1Ab and Cry1Ac. Both GipBtR and GLEN-Cry1Ac-BCS were derived from greenhouse populations of T. ni that had been sprayed repeatedly with DiPel (7, 17), which contains Cry1Ab and Cry1Ac but not Cry1C or Cry1D (9). The GLEN-Cry1Ac-BCS strain had cross-resistance of only 2.5-fold to Cry1C and 2.4-fold to Cry1D (17). Agree contains Cry1C and Cry1D (8), which probably boosted its efficacy against GipBtR and GlenBtR (Table (Table11).The results here with Cry1AbMod and Cry1AcMod extend those of previous work indicating that modified toxins killed larvae of Manduca sexta in which susceptibility to Cry1Ab was decreased via RNA interference and also killed larvae of Pectinophora gossypiella that had laboratory-selected, genetically based resistance to Cry1Ab and Cry1Ac (12). The efficacy of Cry1AbMod and Cry1AcMod against greenhouse-selected T. ni suggests that the modified toxins may be useful against resistance that evolves in commercial agricultural settings. The results here also increase the number of lepidopteran species against which the modified toxins were effective to three, with each species representing a different family (Sphingidae, Gelechiidae, and Noctuidae). In the two other species, decreased susceptibility to native Cry1A toxins was mediated by alterations in a cadherin protein that binds Cry1Ac (2, 11, 12), whereas the role of cadherin in T. ni resistance has not been demonstrated or excluded.Similar to patterns observed with P. gossypiella (12), modified toxins were more effective than native toxins against resistant T. ni larvae, but native toxins were more effective than modified toxins against susceptible T. ni larvae (Table (Table1).1). This raises the intriguing possibility that combinations of native and modified toxins might be especially effective against populations with a mixture of susceptible and resistant individuals. In any case, the Cry1AMod toxins and hybrid B. thuringiensis products applied either jointly or separately may be useful for countering or delaying evolution of resistance in T. ni. However, further work is needed to determine how native and modified toxins interact when used in combination and how modified toxins perform in the greenhouse and field.  相似文献   

19.
The microbial biotransformation of Δ9-tetrahydrocannabinol was investigated using a collection of 206 alkane-degrading strains. Fifteen percent of these strains, mainly gram-positive strains from the genera Rhodococcus, Mycobacterium, Gordonia, and Dietzia, yielded more-polar derivatives. Eight derivatives were produced on a mg scale, isolated, and purified, and their chemical structures were elucidated with the use of liquid chromatography-mass spectrometry, 1H-nuclear magnetic resonance (1H-NMR), and two-dimensional NMR (1H-1H correlation spectroscopy and heteronuclear multiple bond coherence). All eight biotransformation products possessed modified alkyl chains, with hydroxy, carboxy, and ester functionalities. In a number of strains, β-oxidation of the initially formed C5 carboxylic acid led to the formation of a carboxylic acid lacking two methylene groups.Δ9-Tetrahydrocannabinol (Δ9-THC) is the decarboxylated product of the corresponding Δ9-THC acid, the major cannabinoid present in the cannabis plant (Cannabis sativa L., Cannabaceae). This compound is officially registered as a drug for the stimulation of appetite and antiemesis in patients under chemotherapy and human immunodeficiency virus therapy regimens. Other biological activities ascribed to this compound include lowering intraocular pressure in glaucoma, acting as an analgesic for muscle relaxation, immunosuppression, sedation, bronchodilation, and neuroprotection (11).Δ9-THC and many of its derivatives are highly lipophilic and poorly water soluble. Calculations of the n-octanol/water partition coefficient (Ko/w) of Δ9-THC at neutral pH vary between 6,000, using the shake flask method (15), and 9.44 × 106, by reverse-phase high-performance liquid chromatography estimation (19). The poor water solubility and high lipophilicity of cannabinoids cause their absorption across the lipid bilayer membranes and fast elimination from blood circulation. In terms of the “Lipinsky rule of 5” (14), the high lipophilicity of cannabinoids hinders the further development of these compounds into large-scale pharmaceutical products.To generate more water-soluble analogues, one can either apply de novo chemical synthesis (as, e.g., in reference 16) or modify naturally occurring cannabinoids, e.g., by introducing hydroxy, carbonyl, or carboxy groups. Chemical hydroxylation of compounds such as cannabinoids is difficult (Δ9-THC is easily converted into Δ8-THC under mild conditions), and therefore microbial biotransformation of cannabinoids is potentially a more fruitful option to achieve this goal.So far, studies on biotransformation of Δ9-THC were mainly focused on fungi, which led to the formation of a number of mono- and dihydroxylated derivatives. Previous reports on the biotransformation of cannabinoids by various microorganisms are summarized in Table Table1.1. The aim of the present study was to test whether bacterial strains are capable of transforming Δ9-THC into new products (with potentially better pharmaceutical characteristics) at a higher yield and specificity than previously found for fungal strains. For this purpose, we have chosen to use a collection of alkane-degrading strains, since it was shown in previous studies (8, 18, 20) that alkane oxygenases often display a broad substrate range. Production of novel cannabinoid derivatives that might have interesting pharmacological activities was another objective of this project.

TABLE 1.

Previous biotransformation experiments conducted using various microorganisms to transform cannabinoids
Cannabinoid(s)aMicroorganism(s) usedNo. of transformed productsReference
Δ9-THCCunninghamella blakesleeana63
Δ8-THCPellicularia filamentosa421
Δ8-THCStreptomyces lavendulae421
Δ6a,10a-THC400 cultures (soil microorganisms)Various1
Nabilone400 cultures (soil microorganisms)Various1
Δ6a,10a-THC358 cultures containing bacteria, actinomycetes, and molds310
Δ9-THC, Δ8-THC, CBD, CBNSyncephalastrum racemosum, Mycobacterium rhodochrousVarious17
Δ9-THCChaetomium globosum37
Δ9-THC51 fungal strains84
NabiloneMicrobesVarious2
Δ9-THCFusarium nivale, Gibberella fujikuroi, and Thamnidium elegans85
Open in a separate windowaCBD, cannabidiol; CBN, cannabinol.  相似文献   

20.
Par-1 is an evolutionarily conserved protein kinase required for polarity in worms, flies, frogs, and mammals. The mammalian Par-1 family consists of four members. Knockout studies of mice implicate Par-1b/MARK2/EMK in regulating fertility, immune homeostasis, learning, and memory as well as adiposity, insulin hypersensitivity, and glucose metabolism. Here, we report phenotypes of mice null for a second family member (Par-1a/MARK3/C-TAK1) that exhibit increased energy expenditure, reduced adiposity with unaltered glucose handling, and normal insulin sensitivity. Knockout mice were protected against high-fat diet-induced obesity and displayed attenuated weight gain, complete resistance to hepatic steatosis, and improved glucose handling with decreased insulin secretion. Overnight starvation led to complete hepatic glycogen depletion, associated hypoketotic hypoglycemia, increased hepatocellular autophagy, and increased glycogen synthase levels in Par-1a−/− but not in control or Par-1b−/− mice. The intercrossing of Par-1a−/− with Par-1b−/− mice revealed that at least one of the four alleles is necessary for embryonic survival. The severity of phenotypes followed a rank order, whereby the loss of one Par-1b allele in Par-1a−/− mice conveyed milder phenotypes than the loss of one Par-1a allele in Par-1b−/− mice. Thus, although Par-1a and Par-1b can compensate for one another during embryogenesis, their individual disruption gives rise to distinct metabolic phenotypes in adult mice.Cellular polarity is a fundamental principle in biology (6, 36, 62). The prototypical protein kinase originally identified as a regulator of polarity was termed partitioning defective (Par-1) due to early embryonic defects in Caenorhabditis elegans (52). Subsequent studies revealed that Par-1 is required for cellular polarity in worms, flies, frogs, and mammals (4, 17, 58, 63, 65, 71, 89). An integral role for Par-1 kinases in multiple signaling pathways has also been established, and although not formally addressed, multifunctionality for individual Par-1 family members is implied in reviews of the list of recognized upstream regulators and downstream substrates (Table (Table1).1). Interestingly, for many Par-1 substrates the phosphorylated residues generate 14-3-3 binding sites (25, 28, 37, 50, 59, 61, 68, 69, 78, 95, 101, 103). 14-3-3 binding in turn modulates both nuclear/cytoplasmic as well as cytoplasmic/membrane shuttling of target proteins, thus allowing Par-1 activity to establish intracellular spatial organization (15, 101). The phosphorylation of Par-1 itself promotes 14-3-3 binding, thereby regulating its subcellular localization (37, 59, 101).

TABLE 1.

Multifunctionality of Par-1 polarity kinase pathwaysa
Regulator or substrateFunctionReference(s)
Regulators (upstream function)
    LKB1Wnt signaling, Peutz-Jeghers syndrome, insulin signal transduction, pattern formation2, 63, 93
    TAO1MEK3/p38 stress-responsive mitogen-activated protein kinase (MAPK) pathway46
    MARKKNerve growth factor signaling in neurite development and differentiation98
    aPKCCa2+/DAG-independent signal transduction, cell polarity, glucose metabolism14, 37, 40, 45, 59, 75, 95
    nPKC/PKDDAG-dependent, Ca2+-independent signal transduction (GPCR)101
    PAR-3/PAR-6/aPKC(−); regulates Par-1, assembly of microtubules, axon-dendrite specification19
    GSK3β(−); tau phosphorylation, Alzheimer''s dementia, energy metabolism, body patterning54, 97
    Pim-1 oncogene(−); G2/M checkpoint, effector of cytokine signaling and Jak/STAT(3/5)5
    CaMKI(−); Ca2+-dependent signal transduction, neuronal differentiation99
Substrates (downstream function)
    Cdc25CRegulation of mitotic entry by activation of the cdc2-cyclin B complex25, 72, 78, 103
    Class II HDACControl of gene expression and master regulator of subcellular trafficking28, 50
    CRTC2/TORC2Gluconeogenesis regulator via LKB1/AMPK/TORC2 signaling, PPARγ1a coactivator49
    Dlg/PSD-95Synaptogenesis and neuromuscular junction, tumor suppressor (102)104
    DisheveledWnt signaling, translocation of Dsh from cytoplasmic vesicles to cortex73, 94
    KSR1Regulation of the Ras-MAPK pathway68, 69
    MAP2/4/TAUDynamic instability (67, 83) of microtubules, Alzheimer''s dementia (30)11, 31-33, 47, 70, 96
    Mib/NotchMind bomb (Mib degradation and repression of Notch signaling results in neurogenesis)57, 74, 81
    Par3/OSKAR/LglCytoplasmic protein segregation, cell polarity, and asymmetric cell division7, 10
    Pkp2Desmosome assembly and organization; nuclear shuttling68, 69
    PTPH1Linkage between Ser/Thr and Tyr phosphorylation-dependent signaling103
    Rab11-FIPRegulation of endocytosis (23), trafficking of E-cadherin (64)34
Open in a separate windowaLKB1 also is known as Par-4; MARKK also is known as Ste20-like; (−), inhibitory/negative regulation has been shown; GPCR, G protein-coupled receptors. MARKK is highly homologous to TAO-1 (thousand-and-one amino acid kinase) (46).The mammalian Par-1 family contains four members (Table (Table2).2). Physiological functions of the Par-1b kinase have been studied using targeted gene knockout approaches in mice (9, 44). Two independently derived mouse lines null for Par-1b have implicated this protein kinase in diverse physiological processes, including fertility (9), immune system homeostasis (44), learning and memory (86), the positioning of nuclei in pancreatic beta cells (35, 38), and growth and metabolism (43).

TABLE 2.

Terminology and localization of mammalian Par-1 family members
SynonymsaSubcellular localization
Par-1a, MARK3, C-TAK1, p78/KP78, 1600015G02Rik, A430080F22Rik, Emk2, ETK-1, KIAA4230, mKIAA1860, mKIAA4230, M80359Basolateralb/apicalc
Par-1b, EMK, MARK2, AU024026, mKIAA4207Basolateral
Par1c, MARK1Basolateral
Par1d, MARK4, MARKL1Not asymmetricd
Open in a separate windowaPar should not to be confused with protease-activated receptor 1 (PAR1 [29]); C-TAK1, Cdc twenty-five C-associated kinase 1; MARK, microtubule affinity regulating kinase; MARKL, MAP/microtubule affinity-regulating kinase-like 1.bBasolateral to a lesser degree than Par-1b (37).cHuman KP78 is asymmetrically localized to the apical surface of epithelial cells (76).dVariant that does not show asymmetric localization in epithelial cells when overexpressed (95).Beyond Par-1b, most information regarding the cell biological functions of the Par-1 kinases comes from studies of Par-1a. Specifically, Par-1a has been implicated in pancreatic (76) and hepatocarcinogenesis (51), as well as colorectal tumors (77), hippocampal function (100), CagA (Helicobacter pylori)-associated epithelial cell polarity disruption (82), and Peutz-Jeghers syndrome (48), although the latter association has been excluded recently (27). As a first step toward determining unique and redundant functions of Par-1 family members, mice disrupted for a second member of the family (Par-1a/MARK3/C-TAK1) were generated. We report that Par-1a−/− mice are viable and develop normally, and adult mice are hypermetabolic, have decreased white and brown adipose tissue mass, and unaltered glucose/insulin handling. However, when challenged by a high-fat diet (HFD), Par-1a−/− mice exhibit resistance to hepatic steatosis, resistance to glucose intolerance, and the delayed onset of obesity relative to that of control littermates. Strikingly, overnight starvation results in a complete depletion of glycogen and lipid stores along with an increase in autophagic vacuoles in the liver of Par-1a−/− but not Par-1b−/− mice. Correspondingly, Par-1a−/− mice develop hypoketotic hypoglycemia. These findings reveal unique metabolic functions of two Par-1 family members.  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号