Cytochrome oxidase from an extreme thermophile. Thermus thermophilus HB8

The cytochrome oxidase (EC 1.9.3.1) of $\text{Thermus}\text{thermophilus}$ HB8 was isolated from the membrane fraction, and was highly purified. The oxidase contained heme $\text{a}$ and heme $\text{c}$ as the prosthetic groups. The purified preparation showed a single band in polyacrylamide gel electrophoresis, and three major polypeptides with apparent molecular weights of 52,000, 37,000 and 29,000 were observed in the presence of sodium dodecyl sulfate. The enzyme reacted rapidly with $\text{T}\text{.}\text{thermophilus}$ cytochrome c-552. The oxidation of $\text{T}\text{.}\text{thermophilus}$ cytochrome $\text{c}$-555,549 by the enzyme was very slow, and was stimulated by the addition of cytochrome $\text{c}$-552. The enzyme was highly stable to heat.     

Aminoacyl-tRNA synthetases from an extreme thermophile, Thermus thermophilus HB8

Thermostable aminoacyl-tRNA synthetases specific to Val, Ile, Met and Glu were purified from an extreme thermophile, Thermus thermophilus HB8. As for the subunit compositions and molecular weights, these four aminoacyl-tRNA synthetases are similar to the corresponding enzymes from E. coli and B. stearothermophilus. Val-tRNA, Ile-tRNA and Met-tRNA synthetases from T. thermophilus have two tightly bound zinc ions, whereas Glu-tRNA synthetase does not. The amino acid compositions and secondary structures of Val-tRNA, Ile-tRNA and Met-tRNA synthetases are quite similar to one another. The conformational transition involving the anticodon of E. coli tRNAGlu as complexed with Glu-tRNA synthetase from T. thermophilus is necessary for the aminoacylation activity.     

Purification and some properties of cytochrome c-552 from an extreme thermophile, Thermus thermophilus HB8.

A c-type cytochrome, cytochrome c-552, from a soluble fraction of an extreme thermophile, Thermus thermophilus HB8, was highly purified and its properties investigated. The absorption peaks were at 552, 522, and 417 nm in the reduced form, and at 408 nm in the oxidized form. The isoelectric point was at PH 10.8, the midpoint redox potential was about +0.23 V, and the molecular weight was about 15,000. The cytochrome c-552 was highly thermoresistant. The cytochrome reacted rapidly with pseudomonas aeruginosa nitrite reductase [EC 1.9.3.2], but slowly with bovine cytochrome oxidase [EC 1.9.3.1], yeast cytochrome c peroxidase [EC 1.11.1.5], or Nitrosomonas europaea hydroxylamine-cytochrome c reductase [EC 1.7.3.4].     

C-type cytochromes isloated from an extreme thermophile, Thermus thermophilus HB8.

Two cytochromes of the C-type, c-554 and c-549, were isolated from the soluble fraction of an extreme thermophile, Thermus thermophilus HB8. Highly purified cytochrome c-554 had absorption maxima at 554, 522, and 417 nm in the reduced state, and at 410 nm in the oxidized state. The alpha-band of the reduced state resembled that of "split-alpha" cytochromes. The isoelectric point was at pH 4.9, and the molecular weight was about 29,000. Cytochrome c-549, partially purified, had absorption maxima a6 549,520, and 416 nm in the reduced form, and at 408 nm in the oxidized form. The molecular weight was about 25,000. Both were slowly auto-oxidizable, and did not combine with CO.     

Purification and properties of D-glyceraldehyde-3-phosphate dehydrogenase from an extreme thermophile, Thermus thermophilus strain HB 8.

1. D-Glyceraldehyde-3-phosphate dehydrogenase from an extreme thermophile, T. thermophilus strain HB8, was purified and crystallized. 2. The enzyme was found to possess remarkable heat stability, being slowly inactivated at 90 degrees C. 3. Basic kinetic constants and pH profile are reported. The enzyme was activated 25-fold by 90 mM NH4Cl, and also by ethanol up to 5-fold at 30 degrees C. 4. The enzyme was found to be far more resistant to urea or sodium dodecylsulfate than the rabbit enzyme. 5. The enzyme was shown to be a tetramer of molecular weight 130000--135000. Amino acid composition analysis revealed no unusual features. Circular dichroic spectra suggested that the contents of the ordered structure of the thermophile enzyme are similar to those of the rabbit enzyme. 6. The other catalytic properties of the thermophile enzyme are discussed in comparison with those of the enzymes from other sources.     

Nucleotide sequence of formylmethionine tRNA from an extreme thermophile, Thermus thermophilus HB8.

The nucleotide sequence of formylmethionine tRNA from an extreme thermophile, Thermus thermophilus HB8, was determined by a combination of classical methods using unlabeled samples to determine the sequences of the oligonucleotides of RNase T1 and RNase A digests and a rapid sequencing gel technique using 5'-32P labeled samples to determine overlapping sequences. Formylmethionine tRNA from T. thermophilus is composed of two species, tRNAf1Met and tRNAf2Met. Their nucleotide sequences are almost identical, and are also almost identical with that of E. coli tRNAfMet, except for slight modifications and replacements. Both species have modifications at three points which do not exist in E. coli tRNAfMet: 2'-O-methylation at G19, N-1-methylation at A59 and 2-thiolation at T55. Moreover U51 in E. coli tRNAfMet is replaced by C51 in both species, so that a G-C pair is formed between this C51 and G65. tRNAf2Met has a reversed G-C pair at positions 52 and 64 compared with those in tRNAf1Met and E. coli tRNAfMet. Other regions are mostly the same as those in all prokaryotic initiator tRNAs so far reported. The thermostability of these thermophile initiator tRNAs is discussed in relation to their unique modifications.     

Energy conservation in the extreme thermophile Thermus thermophilus HB8

Whole cells of the extreme thermophile Thermus thermophilus HB8 contained a membrane-bound respiratory chain (comprised of nicotinamide nucleotide transhydrogenase, NADH dehydrogenase, menaquinone, and cytochromes b, c, aa₃, o), which exhibited a maximumH⁺/O quotient of approximately 8 g-ion H⁺·g-atom O^-1 for the oxidation of endogenous substrates. Whole cell respiration at 70° at the expense of endogenous substrates or ascorbate-TMPD generated a transmembrane protonmotive force (p) of up to 197 mV and an intracellular phosphorylation poteintial (Gp), measured under similar conditions, of approximately 43.9 kJ·mol^-1.The measured Gp/p ratio thus indicated anH⁺/ATP quotient of approximately 2.3 g-ion H⁺·mole ATP^-1. Glucose-limited continuous cultures of T. thermophilus at 60°, 70° and 78.5° exhibited extremely low moler growth yields (Y _O2 ^max 27.6 g cells·mol O ₂ ^-1 ; Y _glucose ^max 64.4 g cells ·mol glucose^-1) compared with mesophilic bacteria of similar respiratory chain composition and proton translocation efficiency. These low yields are probably at least partly explained by the extremely high permeability of the cytoplasmic membrane to H⁺, which thus causes the cells to respire rapidly in order to maintain the protonmotive force at a level commensurate with cell growth.Abbreviations TPMP⁺ triphenylmethylphosphonium cation - FCCP carbonylcyanide p-trifluoromethoxy phenythydrazone - TMPD N,N,N,N-tetramethyl-p-phenylene diamine     

Studies on polypeptide-chain-elongation factors from an extreme thermophile, Thermus thermophilus HB8. 2. Catalytic properties.

Catalytic properties of the elongation factors from Thermus thermophilus HB8 have been studied and compared with those of the factors from Escherichia coli. 1. The formation of a ternary guanine-nucleotide . EF-Tu . EF-Ts complex was demonstrated by gel filtration of the T. thermophilus EF-Tu . EF-Ts complex on a Sephadex G-150 column equilibrated with guanine nucleotide. The occurrence of this type of complex has not yet been proved with the factors from E. coli. 2. The dissociation constants for the complexes of T. thermophilus EF-Tu . EF-Ts with GDP and GTP were 6.1 x 10(-7) M and 1.9 x 10(-6) M respectively. On the other hand, T. thermophilus EF-Tu interacted with GDP and GTP with dissociation constants of 1.1 x 10(-9) M and 5.8 x 10(-8) M respectively. This suggests that the association of EF-Ts with EF-Tu lowered the affinity of EF-Tu for GDP by a factor of about 600 and facilitated the nucleotide exchange reaction. 3. Although the T. thermophilus EF-Tu . EF-Ts complex hardly dissociates into EF-Tu and EF-Ts, a rapid exchange was observed between free EF-Ts and the EF-Tu . EF-Ts complex using 3H-labelled EF-Ts. The exchange reaction was independent on the presence or absence of guanine nucleotides. 4. Based on the above findings, an improved reaction mechanism for the regeneration of EF-Tu . GTP from EF-Tu . GDP is proposed. 5. Studies on the functional interchangeability of EF-Tu and EF-Ts between T. thermophilus and E. coli has revealed that the factors function much more efficiently in the homologous than in the heterologous combination. 6. T. thermophilus EF-Ts could bind E. coli EF-Tu to form an EF-Tu (E. coli) . EF-Ts (T. thermophilus hybrid complex. The complex was found to exist in a dimeric form indicating that the property to form a dimer is attributable to T. thermophilus EF-Ts. On the other hand, no stable complex between E. coli EF-Ts and T. thermophilus EF-Tu has been isolated. 7. The uncoupled GTPase activity of T. thermophilus EF-G was much lower than that of E. coli EF-G. T. thermophilus EF-G formed a relatively stable binary EF-G . GDP complex, which could be isolated on a nitrocellulose membrane filter. The Kd values for EF-G . GDP and EF-G . GTP were 6.7 x 10(-7) M and 1.2 x 10(-5) M respectively. The ternary T. thermophilus EF-G . GDP . ribosome complex was again very stable and could be isolated in the absence of fusidic acid. The stability of the latter complex is probably the cause of the low uncoupled GTPase activity of T. thermophilus EF-G.     

Studies on polypeptide-chain-elongation factors from an extreme thermophile, Thermus thermophilus HB8. 3. Molecular properties.

Molecular properties of the polypeptide chain elongation factors from Thermus thermophilus HB8 have been investigated and compared with those from Escherichia coli. 1. As expected, the factors purified from T. thermophilus were exceedingly heat-stable. Even free EF-Tu not complexed with GDP was stable after heating for 5 min at 60 degrees C. 2. GDP binding activity of T. thermophilus EF-Tu was also stable in various protein denaturants, such as 5.5 M urea, 1.5 M guanidine-HCl, and 4 M LiCl. 3. Amino acid compositions of EF-Tu and EF-G from T. thermophilus were similar to those from E. coli. On the other hand, amino acid composition of T. thermophilus EF-Ts was considerably different from that of E. coli EF-Ts. 4. In contrast to E. coli EF-Tu, T. thermophilus EF-Tu contained no free sulfhydryl group, but one disulfide bond. The disulfide bond was cleaved by sodium borohydride or sodium sulfite under native conditions. The heat stability of the reduced EF-Tu . GDP, as measured by GDP binding activity, did not differ from that of the untreated EF-Tu . GDP. 5. T. thermophilus EF-Ts contained, in addition to one disulfide bond, a sulfhydryl group which could be titrated only after complete denaturation of the protein. 6. Under native conditions one sulfhydryl group of T. thermophilus EF-G was titrated with p-chloromercuribenzoate, while the rate of reaction was very sluggish. The sulfhydryl group appears to be essential for interaction with ribosomes, whereas the ability to form a binary GDP . EF-G complex was not affected by its modification. The protein contained also one disulfide bond. 7. Circular dichroic spectra of EF-Tu from T. thermophilus and E. coli were very similar. Binding of GDP or GTP caused a similar spectral change in both. T. thermophilus and E. coli EF-Tu. On the other hand, the spectra of T. thermophilus EF-G and E. coli EF-G were significantly different, the content of ordered structure being higher in the former as compared to the latter.     

Functions of isolated domains of methionyl-tRNA synthetase from an extreme thermophile, Thermus thermophilus HB8

Methionyl-tRNA synthetase (MetRS, 2 X 75 kDa) was purified to homogeneity from an extreme thermophile, Thermus thermophilus HB8. The polypeptide chain of MetRS was cleaved by limited digestion with trypsin into four domains: T1 (29 kDa), T2 (23 kDa), T3 (14.5 kDa), and T4 (7.5 kDa), which were aligned in that order. MetRS was also cleaved into similar fragments with a variety of other proteases. Domains T1, T2, T3, and T4 were isolated by column chromatography. "Tandem domain" T1-T2 (56 kDa) is fully active in the aminoacylation of tRNA and is further cleaved with trypsin into domains T1 and T2. Domain T1 is the smallest aminoacylation unit so far reported. Domain T2 (enzymatically inactive) interacts with tRNAMetf, as found by UV-induced cross-linking. Isolated domain T3 forms a dimer and is responsible for the dimer assembly of two protomers in MetRS. Domain T4 is a flexible tail of MetRS. These domains, in particular T1 and T2, will be important for detailed structure analyses in relation to aminoacylation activity.     

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

Isolation and characterization of a bacteriophage infectious to an extreme thermophile, Thermus thermophilus HB8.

A bacteriophage (phiYS40) infectious to an extreme thermophile, Thermus thermophilus HB8, was isolated and characterized. phiYS40 grows over the temperature range of 56 to 78 C, and the optimum growth temperature is about 65 C. The phage had a latent period of 80 min and a burst size of about 80 at 65 C. The phage has a hexagonal head 0.125 mum in diameter, a tail 0.178 mum long and 0.027 mum wide, a base plate and tail fibers. The phage is thermostable in broth but rather unstable in a buffer containing 10 mM Tris, 10 mM MgCl2, pH 7.5. The addition of Casamino Acids (1 percent), polypeptone (0.8 percent), yeast extract (0.4 percent), NaCl (0.1 M) or spermidine (1 mM) to the buffer restores the thermostability of phiYS40 to the same degree as in broth. The phage is also thermostable in water of the hot spring from which this phage was isolated. The nucleic acid of PhiYS40 is a double-stranded DNA and has a molecular weight of 1.36 X 10-8. The guanine plus cytosine content of the DNA was determined to be about 35 percent from chemical determinations, buoyant density (1.693 g/cm-3 in CsCl), and melting temperature (83.5 C in 0.15 M NaCl plus 0.015 M sodium citrate).     

Two types of tRNA(Gm)methylase found in extreme thermophile, Thermus thermophilus strains HB 8 and HB 27

There are two distinct strains HB 8 and HB 27 in an extreme thermophile, Thermus thermophilus, and both strains have their own tRNA(Gm)methylases, which specifically methylates the 2'-OH of the ribose ring in the D loop of tRNA. The Gm-methylases are very similar with respect to the recognition mechanism of substrate tRNA and the molecular weight, but differ in the temperature dependency of the enzyme activity. Gm-methylase from strain HB 8 possesses its activity even at low temperature (40 degrees C), whereas that of strain HB 27 shows very low activity at the temperature and increases the activity as the incubation temperature is raised. Amino acid compositions of both the enzymes are very similar except for Glx and Asx, but the content of secondary structure is very different as judged by circular dichroism.     

A double-alpha c-type cytochrome, cytochrome c-555, 549, from an extreme thermophile, Thermus thermophilus HB8.

A "double-alpha" c-type cytochrome, cytochrome c-555, 549, was isolated from the membrane fraction of an extreme thermophile, Thermus thermophilus HB8, and highly purified by chromatographies on DEAE-cellulose and Sephadex G-75 and by isoelectric focusing. The absorption maxima were at 554.8, 548.6, 522, and 417 nm in the reduced form, and at 528, 409, and 360 nm in the oxidized form. The double alpha-peak of this cytochrome was enhanced at liquid nitrogen temperature. The cytochrome contained one heme c group per protein molecule. The isoelectric point, midpoint redox potential and molecular weight were pH 4.0, +0.206 V and about 10,000, respectively. Cytochrome c-555, 549 is highly thermostable.     

Purification, catalytic properties, and thermal stability of threo-Ds-3-isopropylmalate dehydrogenase coded by leuB gene from an extreme thermophile, Thermus thermophilus strain HB8

Threo-Ds-3-isopropylmalate dehydrogenase coded by the leuB gene from an extreme thermophile, Thermus thermophilus strain HB8, was expressed in Escherichia coli carrying a recombinant plasmid. The thermostable enzyme thus produced was extracted from the E. coli cells, purified, and crystallized. The enzyme was shown to be a dimer of identical subunits of molecular weight (4.0 +/- 0.5) x 10(4). The Km for threo-Ds-3-isopropylmalate was estimated to be 8.0 x 10(-5) M and that for NAD 6.3 x 10(-4) M. The optimum pH at 75 degrees C in the presence of 1.2 M KCl was around 7.2. The presence of Mg2+ or Mn2+ was essential for the enzyme action. The enzyme was activated about 30-fold by the addition of 1 M KCl or RbCl. The high salt concentration decelerated the thermal unfolding of the enzyme, and accelerated the aggregation of the unfolded protein. Based on these effects, the molecular mechanism of the unusual stability of the enzyme is discussed.