Comparison of ribonucleotide sequences from the genome of vesicular stomatitis virus and two of its defective interfering particles.

RNA genomes from standard vesicular stomatitis virus and two defective interfering (DI) particles dI 0.33 (DI-T) and DI 0.52, were purified and digested with RNase T1. The resulting oligonucleotides were labeled at the 5' end with [32P]ATP and separated by two-dimensional electrophoresis in polyacrylamide gels. All of the major oligonucleotides containing 20 or more nucleotides were sequenced. Those oligonucleotides that were thought to be in common by their migration on polyacrylamide gels actually did have identical sequences. Those oligonucleotides thought to be unique to the DI RNAs either differed by only one nucleotide from oligonucleotides of the standard RNA or contained new sequences which were complementary to known sequences at the 5' end. These data indicate that RNAs from DI particles are not simple deletions but contain point mutations and additional complementary sequences.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).     

The nucleotide sequence of the 5'' terminus of vesicular stomatitis virus RNA.

We have determined the nucleotide sequence for the first 50 nucleotides at the 5' terminus of vesicular stomatitis virus (VSV) genome RNA. This sequence is identical to that of the in vitro RNA polymerase product synthesized by defective interfering (DI) particles of VSV. These results confirm previous conclusions rengarding DI and standard viral terminal sequences based on hybridization studies and earlier sequencing of the DI polymerase product RNA.     

Common and distinct regions of defective-interfering RNAs of Sindbis virus

Defective-interfering (DI) particles are helper-dependent deletion mutants which interfere specifically with the replication of the homologous standard virus. Serial passaging of alphaviruses in cultured cells leads to the accumulation of DI particles whose genomic RNAs are heterogeneous in size and sequence composition. In an effort to examine the sequence organization of an individual DI RNA species generated from Sindbis virus, we isolated and sequenced a representative cDNA clone derived from a Sindbis DI RNA population. Our data showed that: (i) the 3' end of the DI RNA template was identical to the 50 nucleotides at the 3' end of the standard RNA; (ii) the majority (75%) of the DI RNA template was derived from the 1,200 5'-terminal nucleotides of the standard RNA and included repeats of these sequences; and (iii) the 5' end of the DI RNA template was not derived from the standard RNA, but is nearly identical to a cellular tRNAAsp (S. S. Monroe and S. Schlesinger, Proc. Natl. Acad. Sci. U.S.A. 80:3279-3283, 1983). We have also utilized restriction fragments from cloned DNAs to probe by blot hybridization for the presence of conserved sequences in several independently derived DI RNA populations. These studies indicated that: (i) a 51-nucleotide conserved sequence located close to the 5' end of several alphavirus RNAs was most likely retained in the DI RNAs; (ii) the junction region containing the 5' end of the subgenomic 26S mRNA was deleted from the DI RNAs; and (iii) the presence of tRNAAsp sequences was a common occurrence in Sindbis virus DI RNAs derived by passaging in chicken embryo fibroblasts.     

Structure and origin of a novel class of defective interfering particle of vesicular stomatitis virus

The genome structure and terminal sequences of a 'copyback' defective interfering (DI) particle ST1, and a novel complexly rearranged 'snapback' DI particle ST2 of vesicular stomatitis virus have been determined. The ST1 DI genome RNA possesses 54 base long inverted complementary termini, the 5' end of which is homologous to the standard virus genome 5' end. Following this region of inverted complementarity the DI RNA 5' end continues to be homologous to standard virus RNA 5' sequences, whereas the 3' end diverges into sequences within the virus L gene internal sequences. ST2 DI genome RNA does not contain colinear covalently linked plus and minus sense RNA copies of the standard infectious virus RNA 5' terminus as predicted from the prototype snapback DI structure, but instead appears to be a hairpin copy of the ST1 DI RNA genome. This is the first evidence suggesting that DI particles may be generated from RNA templates other than the standard virus RNA. Generation models and the implications of these findings for RNA virus evolution are discussed.     

Studies of defective interfering RNAs of Sindbis virus with and without tRNAAsp sequences at their 5'' termini.

Three of six independently derived defective interfering (DI) particles of Sindbis virus generated by high-multiplicity passaging in cultured cells have tRNAAsp sequences at the 5' terminus of their RNAs (Monroe and Schlesinger, J. Virol. 49:865-872, 1984). In the present work, we found that the 5'-terminal sequences of the three tRNAAsp-negative DI RNAs were all derived from viral genomic RNA. One DI RNA sample had the same 5'-terminal sequence as the standard genome. The DI RNAs from another DI particle preparation were heterogeneous at the 5' terminus, with the sequence being either that of the standard 5' end or rearrangements of regions near the 5' end. The sequence of the 5' terminus of the third DI RNA sample consisted of the 5' terminus of the subgenomic 26S mRNA with a deletion from nucleotides 24 to 67 of the 26S RNA sequence. These data showed that the 5'-terminal nucleotides can undergo extensive variations and that the RNA is still replicated by virus-specific enzymes. DI RNAs of Sindbis virus evolve from larger to smaller species. In the two cases in which we followed the evolution of DI RNAs, the appearance of tRNAAsp-positive molecules occurred at the same time as did the emergence of the smaller species of DI RNAs. In pairwise competition experiments, one of the tRNAAsp-positive DI RNAs proved to be the most effective DI RNA, but under identical conditions, a second tRNAAsp-positive DI RNA was unable to compete with the tRNAAsp-negative DIs. Therefore, the tRNAAsp sequence at the 5' terminus of a Sindbis DI RNA is not the primary factor in determining which DI RNA becomes the predominant species in a population of DI RNA molecules.     

Sequence analysis of cDNA''s derived from the RNA of Sindbis virions and of defective interfering particles

Sindbis virus generates defective interfering (DI) particles during serial high-multiplicity passage in cultured cells. These DI particles inhibit the replication of infectious virus and can be an important factor in the establishment and maintenance of persistent infection in BHK cells. In an effort to understand how these DI particles are generated and how they interfere with the replication of standard virus, we performed a partial sequence analysis of the RNA obtained from two independently isolated populations of DI particles and from two Sindbis virus variants and compared these with the RNA of the parental wild-type virus. The 3'-terminal regions of the RNAs were sequenced by the dideoxy chain terminating method. Internal regions of the RNA were examined by restriction endonuclease digestion of cDNA's made to the various RNAs and by direct chemical sequencing of 5' end-labeled restriction fragments from cDNA made to the DI RNAs. One of the variant viruses examined was originally derived from cells persistently infected with Sindbis virus for 16 months and is resistant to interference by the DI strains used. In the 3'-terminal region of the RNA from this variant, only two base changes were found; one of these occurs in the 20-nucleotide 3'-terminal sequence which is highly conserved among alphaviruses. The DI RNA sequences were found to have been produced not by a single deletional event, but by multiple deletion steps combined with sequence rearrangements; all sequences examined are derived from the plus strand of Sindbis virion RNA. Both DI RNAs had at least 50 nucleotides of wild-type sequence conserved at the 3' terminus; in addition, they both contained conserved and perhaps amplified sequences derived from the non-26S region of the genome which may be of importance in their replication and interference ability.     

Analysis of efficiently packaged defective interfering RNAs of murine coronavirus: localization of a possible RNA-packaging signal.

We have previously shown that most of the defective interfering (DI) RNA of mouse hepatitis virus (MHV) are not packaged into virions. We have now identified, after 21 serial undiluted passages of MHV, a small DI RNA, DIssF, which is efficiently packaged into virions. The DIssF RNA replicated at a high efficiency on its transfection into the helper virus-infected cells. The virus released from the transfected cells interfered strongly with mRNA synthesis and growth of helper virus. cDNA cloning and sequence analysis of DIssF RNA revealed that it is 3.6 kb and consists of sequences derived from five discontinuous regions of the genome of the nondefective virus. The first four regions (domains I to IV) from the 5' end are derived from gene 1, which presumably encodes the RNA polymerase of the nondefective virus. The entire domain I (859 nucleotides) and the first 750 nucleotides of domain II are also present in a previously characterized DI RNA, DIssE, which is not efficiently packaged into virions. Furthermore, the junction between these two domains is identical between the two DI RNAs. The remaining 77 nucleotides at the 3' end of domain II and all of domains III (655 nucleotides) and IV (770 nucleotides) are not present in DIssE RNA. These four domains are derived from gene 1. In contrast, the 3'-most domain (domain V, 447 nucleotides) is derived from the 3' end of the genomic RNA and is also present in DIssE. The comparison of primary sequences and packaging properties between DIsse and DIssF RNAs suggested that domains III and IV and part of the 3' end of domain II contain the packaging signal for MHV RNA. This conclusion was confirmed by inserting these DIssF-unique sequences into a DIssE cDNA construct; the in vitro-transcribed RNA from this hybrid construct was efficiently packaged into virion particles. DIssF RNA also contains an open reading frame, which begins from domain I and ends at the 5'-end 20 bases of domain III. In vitro translation of DIssF RNA and metabolic labeling of the virus-infected cells showed that this open reading frame is indeed translated into a 75-kDa protein. The structures of both DIssE and DIssF RNAs suggest that a protein-encoding capability is a common characteristic of MHV DI RNA.     

Deletion mapping of a mouse hepatitis virus defective interfering RNA reveals the requirement of an internal and discontiguous sequence for replication.

All of the defective interfering (DI) RNAs of mouse hepatitis virus (MHV) contain both the 5' and 3' ends of the viral genomic RNA, which presumably include the cis sequences required for RNA replication. To define the replication signal of MHV RNA, we have used a vaccinia virus-T7 polymerase-transcribed MHV DI RNA to study the effects of sequence deletion on DI RNA replication. Following infection of susceptible cells with a recombinant vaccinia virus expressing T7 RNA polymerase, various cDNA clones derived from a DI RNA (DIssF) of the JHM strain of MHV, which is a 3.5-kb naturally occurring DI RNA, behind a T7 promoter were transfected. On superinfection with a helper MHV, the ability of various DI RNAs to replicate was determined. Serial deletions from the middle of the RNA toward both the 5' and 3' ends demonstrated that 859 nucleotides from the 5' end and 436 nucleotides from the 3' end of the MHV RNA genome were necessary for RNA replication. Surprisingly, an additional stretch of 135 nucleotides located at 3.1 to 3.3 kb from the 5' end of the genome was also required. This stretch is discontiguous from the 5'-end cis replication signal and is present in all of the naturally occurring DI RNAs studied so far. The requirement for a long stretch of 5'- and 3'-end sequences predicts that the subgenomic MHV mRNAs cannot replicate. The efficiency of RNA replication varied with different cDNA constructs, suggesting possible interaction between different regions of DI RNA. The identification of MHV RNA replication signals allowed the construction of an MHV DI-based expression vector, which can express foreign genes, such as the chloramphenicol acetyltransferase gene.     

Defective interfering virus particles modulate virulence.

To determine whether defective interfering (DI) particles modulate virulence by initiating a cyclic pattern of virus growth in vivo, adult mice were infected with vesicular stomatitis virus (VSV), both with and without DI particles. A total of 184 mice divided into groups were inoculated intranasally. A majority of mice inoculated only with standard VSV developed paralysis, most of them between days 7 and 9. The addition of DI particles altered the development of paralysis in several ways. When there was significant protection, a few still became paralyzed on days 7 and 9. When overall mortality was unaffected or even slightly increased, the majority of mice became paralyzed between days 7 and 9 as well. Protection could not be predicted based on a single ratio of standard VSV to DI particles or on the absolute amount of DI particles inoculated. Infectious virus recovered from mouse brains at the time of paralysis and incipient death showed considerable variation, although the titer in a majority of the animals was between 10(5) and 10(7) PFU/ml. When the brains of these paralyzed mice were examined for hybridizable VSV RNA, the detection of standard VSV RNA correlated well with infectivity. The amount of DI RNA in the coinfected mice was more variable and independent of the amount of 40S RNA, although DI RNA was usually found when standard RNA was present. Survivors examined between days 14 and 21 did not contain infectious virus or any detectable viral RNA in their brains. Because these results were consistent with the hypothesis of viral cycling in vivo, rather than a gradual accumulation of total infectious virus, mice were coinfected with 10(8) PFU of standard VSV and 10(5) PFU equivalents of DI particles and sacrificed daily thereafter, irrespective of whether they developed paralysis. Infectivity measurements indicated a reproducible cycling pattern of VSV in the mouse brains with a periodicity of about 5 days. This cycling and the detection of DI RNA in brains several days after intranasal inoculation suggest that there is a dynamic continuous interaction between standard VSV and its DI particle beyond the initial site of replication as the virus population spreads into the host animal. Such cycling of virus production before the full development of specific immune responses from the host may have important implications for viral diagnostics and disease transmission.     

Vesicular stomatitis virus defective interfering particles can contain extensive genomic sequence rearrangements and base substitutions

We sequenced the 5' and 3' RNA termini of 16 defective interfering (DI) particles of vesicular stomatitis virus (VSV) isolated at intervals from persistent infections and from a series of undiluted lytic passages. All DI RNAs exhibited complementary termini, but sequences internal to these termini were extensively rearranged in a variety of ways. Despite extensive rearrangement, these internal sequences (in addition to the termini) apparently are important for DI particle interference properties. Some of these DI particles are derived from multiple intrastrand and interstrand recombination events, and the generation of each can be explained by current replicase error models. During viral evolution in persistent and acute infections, DI particles with specific termini base substitutions are selected. One DI particle exhibits a remarkable clustering of specific A----G (and complementary U----C) substitutions, apparently as a result of repetitive misincorporations by an error-prone viral polymerase complex.     

Utilization of homotypic and heterotypic proteins of vesicular stomatitis virus by defective interfering particle genomes for RNA replication and virion assembly: implications for the mechanism of homologous viral interference

Defective interfering (DI) particles of Indiana serotype of vesicular stomatitis virus (VSV(Ind)) are capable of interfering with the replication of both homotypic VSV(Ind) and heterotypic New Jersey serotype (VSV(NJ)) standard virus. In contrast, DI particles from VSV(NJ) do not interfere with the replication of VSV(Ind) standard virus but do interfere with VSV(NJ) replication. The differences in the interfering activities of VSV(Ind) DI particles and VSV(NJ) DI particles against heterotypic standard virus were investigated. We examined the utilization of homotypic and heterotypic VSV proteins by DI particle genomic RNAs for replication and maturation into infectious DI particles. Here we show that the RNA-nucleocapsid protein (N) complex of one serotype does not utilize the polymerase complex (P and L) of the other serotype for RNA synthesis, while DI particle genomic RNAs of both serotypes can utilize the N, P, and L proteins of either serotype without serotypic restriction but with differing efficiencies as long as all three proteins are derived from the same serotype. The genomic RNAs of VSV(Ind) DI particles assembled and matured into DI particles by using either homotypic or heterotypic viral proteins. In contrast, VSV(NJ) DI particles could assemble only with homotypic VSV(NJ) viral proteins, although the genomic RNAs of VSV(NJ) DI particles could be replicated by using heterotypic VSV(Ind) N, P, and L proteins. Thus, we concluded that both efficient RNA replication and assembly of DI particles are required for the heterotypic interference by VSV DI particles.