Assignment of two rat dihydrofolate (DHFR) genes to chromosomes 2 and 4

A panel of rat x mouse cell hybrids was used in the chromosomal mapping of the rat dihydrofolate reductase (DHFR) gene. It was determined that the probe hybridized to gene sequences on two different chromosomes (Nos. 2 and 4), possibly representing the active gene and a pseudogene. Hybridization of the DHFR probe to DNA from a methotrexate resistant rat cell line revealed that the gene on chromosome 2 was amplified, but not the gene on chromosome 4. This result was taken to suggest that the active DHFR gene is located on rat chromosome 2 and that the sequence on chromosome 4 is a pseudogene.     

A human dihydrofolate reductase intronless pseudogene with an Alu repetitive sequence: multiple DNA insertions at a single chromosomal site

A dihydrofolate reductase (DHFR) pseudogene, hDHFR-psi 3 has been isolated from a human genomic DNA fragment library. Sequence analysis of this gene revealed a lack of introns and the presence of a tract of nine adenines, 90 bp downstream from the end of the coding sequence. These features suggest that hDHFR-psi 3 was derived from a processed RNA molecule that has been converted into DNA and inserted into a chromosome, analogous to the origin of three intronless human DHFR genes previously described. An interesting feature of hDHFR-psi 3 is the presence of a member of the Alu moderately repetitive DNA sequence family within the DHFR coding region. This Alu element is flanked by a 16 bp directly repeated DNA segment derived from DHFR coding sequences. The Alu element apparently has been inserted into the intronless DHFR pseudogene and thus, there have been two insertions at a single chromosomal locus. The hDHFR-psi 3 contains only the 3' half of the DHFR coding sequence. Immediately upstream from the directly repeated sequence before the Alu element is an adenine-rich tract. The DNA farther upstream is moderately repetitive and is related to neither DHFR nor Alu DNA sequence. Therefore, it seems possible that a third insertion has occurred at the same site further disrupting the hDHFR coding sequences.     

Opal suppressor phosphoserine tRNA gene and pseudogene are located on human chromosomes 19 and 22, respectively

An opal suppressor phosphoserine tRNA gene and pseudogene have been isolated from a human DNA library and sequenced (O'Neill, V., Eden, F., Pratt, K., and Hatfield, D. (1985) J. Biol. Chem. 260, 2501-2508). Southern hybridization of human genomic DNA with an opal suppressor tRNA probe suggested that the gene and pseudogene are present in single copy. In this study, we have determined the chromosome location of the human gene and pseudogene by utilizing a 193-base pair fragment encoding the opal suppressor phosphoserine tRNA gene as probe to examine DNAs isolated from human-rodent somatic cell hybrids that have segregated human chromosomes. These studies show that the probe hybridized with two regions in the human genome; one is located on chromosome 19 and the second on chromosome 22. By comparing the restriction sites within these two regions to those previously determined for the human opal suppressor phosphoserine tRNA gene and pseudogene, we tentatively assigned the gene to chromosome 19 and the pseudogene to chromosome 22. These assignments were confirmed by utilizing a 350-base pair fragment which was isolated from the 5'-flanking region of the human gene as probe. This fragment hybridized only to chromosome 19, demonstrating unequivocally that the opal suppressor phosphoserine tRNA gene is located on chromosome 19. The flanking probe hybridized to a single homologous band in hamster and in mouse DNA to which the gene probe also hybridized, demonstrating that the 5'-flanking region of the opal suppressor tRNA gene is conserved in mammals. Restriction analysis of DNAs obtained from the white blood cells of 10 separate individuals demonstrates that the gene is polymorphic. This study provides two additional markers for the human genome and constitutes only the second set of two tRNA genes assigned to human chromosomes.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

Structural analysis of the locus containing the human C-reactive protein gene and its related pseudogene

The gene for human C-reactive protein (CRP) is mapped within a 34-kilobase pair genomic DNA segment identified by chromosome walking through overlapping DNA fragments cloned into a lambda phage library. Within 16 kilobase pairs upstream and downstream of the locus for the authentic CRP gene, only one other sequence homologous to that for CRP could be found. Sequencing analysis indicates this sequence to be a pseudogene with 50-80% region-specific homology. Comparison of the authentic CRP gene cloned from genomic DNA libraries independently prepared from three patients indicates no difference in the 5' and 3' flanking region, promoter region, or coding sequence. Only a polymorphism in the length of the poly(GT) stretch located in the intron is observed. There appears to be only one gene locus and copy per haploid chromosome for the authentic CRP gene and its pseudogene.     

Existence of glucose-6-phosphate dehydrogenase-like locus on chromosome 17.

Hybridization of DNA samples prepared from flow-sorted human chromosomes with a cDNA probe for the X-linked glucose-6-phosphate dehydrogenase (G6PD) suggested the existence of the G6PD-like locus on chromosome 17. Southern hybridization analysis of endonuclease-digested DNA samples from the human-mouse hybrid cell line with human chromosome 17, and from control human and mouse cells, proved that not only X chromosomes, but also chromosome 17, contain DNA sequences that are hybridizable with the G6PD cDNA probe. The G6PD-like locus on chromosome 17 could be a putative pseudogene or a functional gene for the fetal brain-specific G6PD isozyme or other protein.     

Cloning of the genomic sequence encoding a processed adenylate kinase 2 pseudogene

A chromosomal DNA sequence harboring a processed AK2B pseudogene was isolated from a human genomic library. It was a variant of the AK2B gene sequence including several point mutations, deletions, and insertions. The nucleotide sequence of the ORF of the AK2B pseudogene predicted a truncated form of the AK2B mutant suggesting that the processed pseudogene is nonfunctional. A repetitive sequence, AAAAGAGAG, found in the 5' and 3' flanking regions of the pseudogene and the poly(A) tract in the 3' end junction suggest that a mRNA of AK2B may have been converted to the processed pseudogene by retrotransposition events. Previously, it was suggested that an adenylate kinase (AK) 2 related gene on chromosome 2, confirmed by Southern analysis using somatic cell hybrid cell lines, may be a processed pseudogene. It is proposed that the processed pseudogene isolated in this study may be the AK2 related nonfunctional gene localized on human chromosomes 2.     

Novel use of a chimpanzee pseudogene for chromosomal mapping of human cytochrome c oxidase subunit IV

We have isolated a chimpanzee processed pseudogene for subunit IV of cytochrome c oxidase (COX; EC 1.9.3.1) by screening a chimpanzee genomic library in lambda Charon 32 with a bovine liver cDNA encoding COX subunit IV (COX IV), and localized it to a 1.9-kb HindIII fragment. Southern-blot analysis of genomic DNA from five primates showed that DNAs from human, gorilla, and chimpanzee each contained the 1.9-kb pseudogene fragment, whereas orangutan and pigtail macaque monkey DNA did not. This result clearly indicates that the pseudogene arose before the divergence of the chimpanzee and gorilla from the primate lineage. By screening Chinese hamster x human hybrid panels with the human COX4 cDNA, we have mapped COX4 genes to two human chromosomes, 14 and 16. The 1.9-kb HindIII fragment containing the pseudogene, COX4P1, can be assigned to chromosome 14, and by means of rearranged chromosomes in somatic cell hybrids, to 14q21-qter. Similarly, the functional gene, COX4, has been mapped to 16q22-qter.     

Evolutionary implications of the human aldolase-A, -B, -C, and -pseudogene chromosome locations.

The aldolase genes represent an ancient gene family with tissue-specific isozymic forms expressed only in vertebrates. The chromosomal locations of the aldolase genes provide insight into their tissue-specific and developmentally regulated expression and evolution. DNA probes for the human aldolase-A and -C genes and for an aldolase pseudogene were used to quantify and map the aldolase loci in the haploid human genome. Genomic hybridization of restriction fragments determined that all the aldolase genes exist in single copy in the haploid human genome. Spot-blot analysis of sorted chromosomes mapped human aldolase A to chromosome 16, aldolase C to chromosome 17, the pseudogene to chromosome 10; it previously had mapped the aldolase-B gene to chromosome 9. All loci are unlinked and located on to two pairs of morphologically similar chromosomes, a situation consistent with tetraploidization during isozymic and vertebrate evolution. Sequence comparisons of expressed and flanking regions support this conclusion. These locations on similar chromosome pairs correctly predicted that the aldolase pseudogene arose when sequences from the aldolase-A gene were inserted into the homologous aldolase location on chromosome 10.     

Chromosomal localization of three human D5 dopamine receptor genes

It is currently thought that genetic predisposition to imbalances in dopaminergic transmission may underlie several neurological disorders, including schizophrenia, manic depression, Tourette syndrome, Parkinson disease, Huntington disease, and alcohol abuse. Originally two receptors, D1 and D2, were thought to account for all of the pharmacological actions of dopamine. However, through homology screening three additional genes, D3, D4, and D5, and two pseudogenes closely related to D5 have been characterized. To begin our genomic and evolutionary analyses of the human D5 dopamine receptor gene and its two pseudogenes, we have mapped each of them to their respective chromosomes. By combining in situ hybridization results with sequence analysis of PCR products from microdissected chromosomes, somatic cell hybrids, and radiation hybrids, we have assigned DRD5 (the locus containing the functional human D5 receptor gene) to chromosome 4p16.1, DRD5P1 (the locus containing D5 pseudogene 1) to chromosome 2p11.1-p11.2, and DRD5P2 (the locus of D5 pseudogene 2) to chromosome 1q21.1.     

Chromosomal localization of a cytochrome b5 gene to human chromosome 18 and a cytochrome b5 pseudogene to the X chromosome.

We have isolated cDNA clones that code for human cytochrome b5. Owing to the high degree of evolutionary conservation of cytochrome b5 sequences and the existence of human and rodent cytochrome b5 processed pseudogenes, we were unable to map unambiguously the chromosomal localization of the human gene(s) by Southern blot hybridization of DNA from human-rodent somatic cell hybrids. An alternative approach, based on restriction enzyme digestion of PCR-amplified DNA, enabled us to map the human cytochrome b5 gene(s) to chromosome 18 and one of its processed pseudogenes to the X chromosome. We propose the designations CYB5 and CYB5P1 for the gene and pseudogene loci, respectively.     

An unusual adenine phosphoribosyltransferase pseudogene is syntenic with its functional gene and is flanked by highly polymorphic DNAs.

A mouse adenine phosphoribosyltransferase (aprt) pseudogene that had previously been recovered from a BALB/c sperm DNA library possessed several unusual features. Its nucleotide sequence, like that of other processed pseudogenes, was colinear with its corresponding mRNA, but it was truncated at its 3' end and lacked a poly(A) tail. The pseudogene was 82% homologous with corresponding regions of the functional gene and had incurred mutations that included transitions, transversions, deletions, and a point insertion. Even though the pseudogene was truncated within the protein-coding region of the corresponding functional gene, it was flanked at both ends by 13-base-pair direct repeats. Curiously, the direct repeats exhibited homology to APRT mRNA at the site of pseudogene divergence. The pseudogene appeared to be common to BALB/c and A/J mice, but it was contained on a 3-kilobase EcoRI fragment in the former strain and a 4.5-kilobase EcoRI fragment in the latter. The BALB/c and apparently the A/J pseudogene both mapped to chromosome 8, which also contains the functional aprt gene. The DNA sequences immediately surrounding the pseudogene in the two strains appeared to be similar, suggesting that the BALB/c and A/J pseudogenes are allelic. However, DNA sequences more distal to the pseudogene in the two strains appeared to vary. Thus, the EcoRI polymorphism was not due to simple loss of an EcoRI site, but was more complex. The pattern of flanking restriction sites was different for each of several enzymes, consistent with extensive DNA rearrangement. Double digests of BALB/c and A/J genomic DNAs revealed complex polymorphisms on both sides of the pseudogene. The results were consistent with insertion, deletion, or other rearrangement of DNA sequences that flank the pseudogene and suggest that this region of mouse chromosome 8 may be a region active for mutation or recombination.     

The human thyroglobulin gene: A polymorphic marker localized distal to C-MYC on chromosome 8 band q24

Summary We have used a cDNA clone for human phosphoglycerate kinase (PGK) to examine the chromosomal localization of three members of the human PGK gene family. Using somatic cell hybrids segregating portions of several X-autosome translocations as well as a clone panel of hybrids segregating radiation-induced fragments of the human X chromosome, we assign a PGK pseudogene to the region Xq11–Xq13, proximal to the functional X-linked PGK gene located in Xq13. In addition, using a panel of 24 somatic cell hybrids, we assign an autosomal PGK-related DNA sequence to human chromosome 19.     

Assignment of the human dihydrofolate reductase gene to the q11----q22 region of chromosome 5.

Cells from a dihydrofolate reductase-deficient Chinese hamster ovary cell line were hybridized to human fetal skin fibroblast cells. Nineteen dihydrofolate reductase-positive hybrid clones were isolated and characterized. Cytogenetic and biochemical analyses of these clones have shown that the human dihydrofolate reductase (DHFR) gene is located on chromosome 5. Three of these hybrid cell lines contained different terminal deletions of chromosome 5. An analysis of the breakpoints of these deletions has demonstrated that the DHFR gene resides in the q11----q22 region.     

Mapping and characterization of the mouse and human SS18 genes, two human SS18-like genes and a mouse Ss18 pseudogene.

We have previously isolated and characterized a mouse cDNA orthologous to the human synovial sarcoma associated SS18 (formerly named SSXT and SYT) cDNA. Here, we report the characterization of the genomic structure of the mouse Ss18 gene. Through in silico methods with sequence information contained in the public databases, we did the same for the human SS18 gene and two human SS18 homologous genes, SS18L1 and SS18L2. In addition, we identified a mouse Ss18 processed pseudogene and mapped it to chromosome 1, band A2-3. The mouse Ss18 gene, which is subject to extensive alternative splicing, is made up of 11 exons, spread out over approximately 45 kb of genomic sequence. The human SS18 gene is also composed of 11 exons with similar intron-exon boundaries, spreading out over about 70 kb of genomic sequence. One alternatively spliced exon, which is not included in the published SS18 cDNA, corresponds to a stretch of sequence which we previously identified in the mouse Ss18 cDNA. The human SS18L1 gene, which is also made up of 11 exons with similar intron-exon boundaries, was mapped to chromosome 20 band q13.3. The smaller SS18L2 gene, which is composed of three exons with similar boundaries as the first three exons of the other three genes, was mapped to chromosome 3 band p21. Through sequence and mutation analyses this gene could be excluded as a candidate gene for 3p21-associated renal cell cancer. In addition, we created a detailed BAC map around the human SS18 gene, placing it unequivocally between the CA-repeat marker AFMc014wf9 and the dihydrofolate reductase pseudogene DHFRP1. The next gene in this map, located distal to SS18, was found to be the TBP associated factor TAFII-105 (TAF2C2). Further analogies between the mouse Ss18 gene, the human SS18 gene and its two homologous genes were found in the putative promoter fragments. All four promoters resemble the promoters of housekeeping genes in that they are TATA-less and embedded in canonical CpG islands, thus explaining the high and widespread expression of the SS18 genes.