High resolution thermal denaturation analyses of small sequenced DNA restriction fragments containing Escherichia coli lactose genetic control loci.

Differential melting curves are reported for four DNA restriction fragments (789, 301, 203, and 95 base pairs in length) spanning the lactose control region. All but the smallest melt with two or more subtransitions. Maps are proposed which identify the positions of regions of different thermal stability in the sequences. The sizes of regions comprising subtransitions range from 60 to 200 base pairs. An analysis is made of the cooperativity exhibited between regions in the sequence. The effect on the shape of the differential melting curves of Na+ between 10 mM and 0.5 M as well as that of Mg2+ and glycerol has been determined. An 81-bp-long sequence of unusual thermal stability occurs at the lactose promoter. Its TM change, resulting from the above change in salt concentration, is out of step by 1.5 degree C with the neighboring DNA sequence. The potential biological significance of this behavior is discussed.     

High resolution experimental and theoretical thermal denaturation studies on small overlapping restriction fragments containing the Escherichia coli lactose genetic control region

The distribution of thermal stability in the Escherichia coli lac control region is evaluated from the melting behavior of 5 short (80-219 base pairs (bp)) sequenced DNA restriction fragments containing various parts of this sequence. The thermal denaturation of these fragments was measured at 3 salt concentrations. The previous notion that the melting curves for small fragments are sharp and asymmetric in 0.01 M Na+ and broadened and less asymmetric at 0.105 and 0.505 M Na+ is confirmed and the possible explanations are discussed. The existence of two thermodynamic boundaries in this region is also confirmed. The exact location of the boundary upstream of the cyclic AMP receptor protein (CAP) binding site is accurately determined from melting experiments at 260 and 282 nm. The secondary boundary located between the promoter and operator sequence is apparent at the two higher salt concentrations and begins to disappear at the lower salt concentration. The physical interpretation of the melting experiments is compared to the results of theoretical predictions derived from the known sequence of the fragments.     

Salt-concentration dependence of thermal denaturation of restriction fragment DNAs from phi X174

High-resolution differential melting curves of phi X174 Y1 and Y2 restriction fragment DNAs, for which the base sequences were known, were measured at various sodium ion concentrations ranging from 195 to 2.3 mM. The curves were resolved into component peaks, and the change in the melting temperature, the change in the area, and the change in the breadth of each peak with change in salt concentration were examined. The locations of the melting regions corresponding to the peaks in the melting curves were assigned based on theoretical calculations of melting curves and stability maps. It was found that as the salt concentration was decreased from the high to the intermediate range, the breadths of the peaks on the low-temperature side decreased whereas those on the high-temperature side remained almost constant, and also the separation between the peaks along the temperature axis increased. Changes in the positions of peaks relative to one another were interpreted in terms of the difference in the free energy increase between a loop state and an end-coil state as the salt concentration decreased.     

Repeating restriction fragments of human DNA.

Human DNA digested with Hae III showed multiple repeats of a 170 base pair fragment. The most prominent band was the 340 base pair dimer, estimated to be 0.8% of the entire genome. Eco R1 and Hha I yielded fragments with similar electrophoretic mobility to the Hae III dimer. In each case this band was markedly enriched in DNA reassociating at a 0t of less than or equal to 1. Hybridization of the Hae III dimer to gels eluted on to filters demonstrated that the multiple Hae III fragments and Eco R1 fragments contained compatible sequences. These sequences may comprise a distinct subclass of DNA.     

Salt effects on the denaturation of DNA

When DNA's of differing GC:AT base ratios, e.g. synthetic poly dAT, T4 DNA,calf thymus DNA, E. coli DNA, and M. lysodeikticus DNA, are heat-denatured at neutral pH in increasing concentrations of N(a)(2)SO(4) or C(s)(2)SO(4) as supporting electrolytes,the variation of melting temperature with average base composition, dT(m)/dX(G)(C), changes from 45°C (in 0.002M Na) to ll°C (in 4.5M Na) and from 42°C (in 0.002M Cs) to 3°C(in 4.5M Cs). The decrease of dT(m)/dX(G)(C) is a monotonic function of decreasing water activity in the salt solutions. We interpret this decreased composition dependence of the thermal stability of the various DNA's as being due to a destabilization of the GC base pairs relative to the AT base pairs by the concentrated salt media. A simple quantitative treatment shows that k = 8GC/SAT decreases from a value of 4.14 (in 0.01MN(a)) to 1.86 (in 3M Na) and from 4.18 (in 0.01M Cs) to 1.42 (in 3M Cs). SAT is the equilibrium constant for the formation of a hydrogen-bonded AT base pair from a pair of unbonded bases at the junction between a helical region and a denatured region and SGC is the like constant for the formation of a GC base pair. These results corroborate our previous findings of a strongly reduced composition dependence of the negative logarithm of the methylmercuric hydroxide concentration necessary to produce 50% denaturation when the helix-coil transition of DNA is studied in concentrated Cs(s)SO(4)(ultracentrifugation) instead of in dilute N(a)(2)SO(4) (ultraviolet spectrophotometry).     

Transient electric birefringence of two small DNA restriction fragments of the same molecular weight.

The transient electric birefringence of two small DNA restriction fragments of the same molecular weight, one of which migrates anomalously slowly on polyacrylamide gels, has been investigated. Both fragments exhibit negative birefringence. The decay of the birefringence of the anomalously slowly migrating fragment is 8-9% faster than that of the normally migrating fragment. The faster birefringence decay of the anomalous fragment 12A persists under a variety of buffer conditions, suggesting that it is due primarily to static bending and/or curvature of fragment 12A. In reversing electric fields the absolute amplitude of the birefringence of fragments 12A and 12B decreased about 26% before returning to the steady state value. The minimum in the birefringence occurred faster than expected from the birefringence decay times and decreased with increasing electric field strength, suggesting that the minimum is due to a slow polarization of the ion atmosphere. For both fragments, the rise of the birefringence in the Kerr region is about 10% slower than the field-free decay. The buildup of the negative birefringence is preceded either by an interval when no birefringence is observed or by a small positively birefringent transient, suggesting that a small transverse ionic polarizability is also present. Both DNA fragments exhibit Kerr law behavior over most of the range of electric field strengths investigated. Analysis of the shapes of the saturation curves suggests that differences may exist in the polarization mechanisms of the two fragments.     

Secondary structural changes of large and small fragments of bovine serum albumin in thermal denaturation and in sodium dodecyl sulfate denaturation

The helicities in various fragments of bovine serum albumin (BSA) were examined in the thermal denaturation and in sodium docecyl sulfate (SDS) denaturation. The thermal denaturation was examined in a temperature range between 2 and 65°C. The helicity decreased with a rise of temperature and it recovered to some degree upon cooling temperature. A rather high reversibility was observed in the BSA fragments, which were located in the N-terminal of the parent protein and then contained the first large loop with no disulfide bridge. The high reversibility was available also for the helicity in the first large loop of the fragment, disulfide bridges of which were reduced. The fragments, which were smaller than one domain, became unstable in the SDS denaturation. The helicities of such fragments decreased in lower SDS concentrations compared with those of the intact BSA and the large fragments, which contained one or more domains. A resistance to the SDS denaturation appeared in the helices of every large loop even after the fragmentation. On the other hand, helicities of the fragments decreased to 20–25% upon the reduction of disulfide bridges. However, the helicities of these fragments increased to 35–40% in the SDS denaturation.     

pH dependence of the stability of barstar to chemical and thermal denaturation.

Equilibrium unfolding of barstar with guanidine hydrochloride (GdnHCl) and urea as denaturants as well as thermal unfolding have been carried out as a function of pH using fluorescence, far-UV and near-UV CD, and absorbance as probes. Both GdnHCl-induced and urea-induced denaturation studies at pH 7 show that barstar unfolds through a two-state F<->U mechanism and yields identical values for delta GU, the free energy difference between the fully folded (F) and unfolded (U) forms, of 5.0 +/- 0.5 kcal.mol-1 at 25 degrees C. Thermal denaturation of barstar also follows a two-state F<->U unfolding transition at pH 7, and the value of delta GU at 25 degrees C is similar to that obtained from chemical denaturation. The pH dependence of denaturation by GdnHCl is complex. The Cm value (midpoint of the unfolding transition) has been used as an index for stability in the pH range 2-10, because barstar does not unfold through a two-state transition on denaturation by GdnHCl at all pH values studied. Stability is maximum at pH 2-3, where barstar exists in a molten globule-like form that forms a large soluble oligomer. The stability decreases with an increase in pH to 5, the isoelectric pH of the protein. Above pH 5, the stability increases as the pH is raised to 7. Above pH 8, it again decreases as the pH is raised to 10. The decrease in stability from pH 7 to 5 in wild-type (wt) barstar, which is shown to be characterized by an apparent pKa of 6.2 +/- 0.2, is not observed in H17Q, a His 17-->Gln 17 mutant form of barstar. This decrease in stability has therefore been correlated with the protonation of His 17 in barstar. The decrease in stability beyond pH 8 in wt barstar, which is characterized by an apparent pKa of 9.2 +/- 0.2, is not detected in BSCCAA, the Cys 40 Cys 82-->Ala 40 Ala 82 double mutant form of barstar. Thus, this decrease in stability has been correlated with the deprotonation of at least one of the two cysteines present in wt barstar. The increase in stability from pH 5 to 3 is characterized by an apparent pKa of 4.6 +/- 0.2 for wt barstar and BSCCAA, which is similar to the apparent pKa that characterizes the structural transition leading to the formation of the A form. The use of Cm as an index of stability has been supported by thermal denaturation studies.(ABSTRACT TRUNCATED AT 400 WORDS)     

Mapping the order of DNA restriction fragments

A straightforward method was designed for mapping the order of DNA restriction fragments obtained by a double and two single digestions, without the necessity of using a computer or a radioactive label. All possible solutions compatible with a pre-set level of error in the determination of sequence lengths are obtained. The primary assumptions are given, and the appropriate modifications of the algorithm are presented as a function of any assumptions one is unable (or unwilling) to make. Use of the method in connection with end-labeled fragments is also described.     

DNA sequencing by denaturation: principle and thermodynamic simulations

We describe a new DNA sequencing method called sequencing by denaturation (SBD). A Sanger dideoxy sequencing reaction is performed on the templates on a solid surface to generate a ladder of DNA fragments randomly terminated by fluorescently labeled dideoxyribonucleotides. The labeled DNA fragments are sequentially denatured from the templates and the process is monitored by measuring the change in fluorescence intensities from the surface. By analyzing the denaturation profiles, the base sequence of the template can be determined. Using thermodynamic principles, we simulated the denaturation profiles of a series of oligonucleotides ranging from 12 to 32 bases and developed a base-calling algorithm to decode the sequences. These simulations demonstrate that DNA molecules up to 20 bases can be sequenced by SBD. Experimental measurements of the melting profiles of DNA fragments in solution confirm that DNA sequences can be determined by SBD. The potential limitations and advantages of SBD are discussed. With SBD, millions of sequencing reactions can be performed on a small area on a surface in parallel with a very small amount of sequencing reagents. Therefore, DNA sequencing by SBD could potentially result in a significant increase in speed and reduction in cost in large-scale genome resequencing.     

High resolution thermal denaturation of DNA: thermalites of bacteriophage DNA.

High resolution thermal denaturation profiles are presented for the DNAs of bacteriophages lambda and T7. It is concluded that the temperature increment in data gathering and the method of calculating results meet the requirements for quantitative recording of the large amount of information found in the thermal transitions of both DNAs. The high resolution derivative denaturation profiles of these bacteriophage DNAs demonstrate that individual subtransitions (thermalites) of natural DNA are Gaussian in form and have narrow transition widths. Curve resolution performed on these profiles indicates that the mean thermalite width (2 sigma) is 0.33 degrees C and that this breadth is relatively invariant. Transition widths are not influenced by the position of thermalites in the profile or by cation concentration in the range from 5 to 30 mM Na+. However, the relative position of thermalites within a denaturation profile is a function of the solution ionic strength. The distribution of lengths of the DNA sequences which these thermalites represent is broad, with a number average length of 900 base pairs. Although we find an approximate similarity between the number of thermalites in the denaturation profile of T7 DNA and the number of looping regions in the electron microscopic partial denaturation map of Gomez and Lang ((1972), J. Mol. Biol. 70, 239-251) we conclude that free solution thermal denaturation experiments can be compared only superficially to the mapping results.     

Antibiotic induced electrophoretic mobility shifts of DNA restriction fragments.

Several antibiotics, netropsin, distamycin A, actinomycin D, Hoechst 33258 and olivomycin, which demonstrate base specificity in their DNA binding properties have been found to alter the electrophoretic mobility of DNA restriction fragments in native polyacrylamide gels. The antibiotics mostly reduced the migration of larger DNA fragments, but netropsin and Hoechst 33258 were observed to increase the migration rate of several DNA fragments of intermediate size. DNA fragments of similar molecular weight which comigrate as a single gel band can at times be separated as the result of differential mobility shifts promoted by antibiotic DNA complex formations.     

Thermal fluctuation spectroscopy of DNA thermal denaturation

We have developed the technique of thermal fluctuation spectroscopy to measure the thermal fluctuations in a system. This technique is particularly useful to study the denaturation dynamics of biomolecules like DNA. Here we present a study of the thermal fluctuations during the thermal denaturation (or melting) of double-stranded DNA. We find that the thermal denaturation of heteropolymeric DNA is accompanied by large, non-Gaussian thermal fluctuations. The thermal fluctuations show a two-peak structure as a function of temperature. Calculations of enthalpy exchanged show that the first peak comes from the denaturation of AT rich regions and the second peak from denaturation of GC rich regions. The large fluctuations are almost absent in homopolymeric DNA. We suggest that bubble formation and cooperative opening and closing dynamics of basepairs causes the additional fluctuation at the first peak and a large cooperative transition from a partially molten DNA to a completely denatured state causes the additional fluctuation at the second peak.     

pH dependence of the reversible and irreversible thermal denaturation of gamma interferons

Heated at pH 6.0 and at 50 degrees C, human interferon gamma (HuIFN-gamma) is inactivated via the formation of insoluble aggregates. At pH 6.0, the aggregation rate increases with temperature from 40 to 65 degrees C. There is a temperature-dependent time lag to aggregate formation observed in the generation of light-scattering particles at pH 6.0, and this correlates with the fast phase observed in the kinetics of reversible thermal unfolding. In addition, the dependence of aggregation kinetics on temperature closely follows the reversible melting curve. These observations suggest that at pH 6.0 irreversible thermal denaturation and aggregation depend on partial or complete unfolding of the molecule. At pH 5.0, also at 50 degrees C, the molecule is stable to irreversible aggregation. In reversible unfolding in 0.25 M guanidine hydrochloride, the Tm for HuIFN-gamma increases from 30.5 degrees C at pH 4.75 to 41.8 degrees C at pH 6.25, in analogy to the behavior of other globular proteins. These observations suggest that the relative instability of HuIFN-gamma to irreversible denaturation via aggregation at pH 6.0 compared to pH 5.0 is not due to an increased stability toward unfolding at the lower pH. Alternatively, stability at pH 5.0 must be due either to the improved solution properties of the unfolded state or to the improved solubility/decreased kinetic lifetime of an unfolding intermediate. Aggregation of HuIFN-gamma at 50 degrees C is half-maximal at pH 5.7, suggesting that protonation of one or both of the histidine residues may be involved in this stabilization.(ABSTRACT TRUNCATED AT 250 WORDS)     

Effect of diethylsulfoxide on the thermal denaturation of DNA

DNA thermal denaturation has been investigated in aqueous solutions of diethylsulfoxide (DESO) by means of UV-vis and densimetry methods. It is suggested that, on the one hand, the structural change of entire solutions and, on the other hand, a direct interaction of DESO with DNA are responsible for the observed peculiar behavior. The results obtained were compared with those of dimethylsulfoxide (DMSO), also known from literature.     

Comparative studies on thermodynamic characteristics of pea legumin and legumin-T thermal denaturation

Characteristics of thermal denaturation of pea legumin and a product of its limited proteolysis with trypsin – legumin-T, in a wide range of NaCl concentrations have bean measured by means of differential scanning microcalorimetry. By the increase of NaCl concentration, the number of cooperative units (domains) increases from 1 per one polypeptide chain to 2 for legumin and 1.8 for legumin-T. Deconvolution of denaturation peaks have revealed up to three peaks, which were ascribed to the dissociation of protein macromolecules to subunits and the unfolding of - and β-polypeptide chains. The analysis of experimental data based on some assumptions showed that the splitting of C-termini of -chains, which are not constituents of cooperative domains, in the course of limited trypsinolysis results in destabilization of the quaternary structure of legumin and loosening of -chains, as well as decrease of the temperatures of their maximum stability.     

High-resolution thermal denaturation of DNA. I. Theoretical and practical considerations for the resolution of thermal subtransitions.

The fidelity achieved in first derivative profiles of DNA thermal denaturation is shown to depend on a number of factors including the thermal increment of data gathering, the precision of absorbance readings, and the manner in which data are smoothed prior to calculating the derivative of hyperchromicity. The closeness with which thermal denaturation data can be fitted by a cubic polynomial is carefully considered, and a derivation is presented for the estimated error in calculated values of the derivative of hyperchromicity with respect to temperature. After reviewing both theoretical and experimental evidence for the expected minimum width of a thermal transition in DNA, we conclude that thermal increments of 0.05°C or less are required for an adequate representation of transitions in naturally occurring DNA's. Data gathered under conditions meeting the requirements suggested here for quantitative recording of thermal denaturation profiles (Vizard and Ansevin, submitted for publication) show that virtually all of the high-resolution thermal denaturation profile of a simple, naturally occuring DNA may consist of small subtransitions, which we call thermalites. The finding of substransitions is consistent with current theories of DNA melting. A particularly well-resolved thermalite of λ bacteriophage DNA has a breadth of only 0.30°C (2σ width), and thus is narrower than previously reported thermal transitions for DNA. For this thermalite, the combination of width, shape, and position in the profile suggests that the substransitions observed in accurately recorded DNA thermal denaturation profiles are not described satisfactorily by existing theories. Knowledge of the requirements for the quantitative recording of thermal denaturation profiles should greatly favor the usefulness of denaturation experiments for physical genomic analysis.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.