Characterization of one trinucleotide and six dinucleotide microsatellite markers in bicolor damselfish, <Emphasis Type="Italic">Stegastes partitus</Emphasis>, a common coral reef fish

Fourteen primer pairs were designed from 47 sequences containing microsatellites isolated from a genomic library enriched for (GACA)₄ in Stegastes partitus. Seven of these were shown to be polymorphic and provided clean amplification products. These seven loci were further characterized using 38 individuals, yielding a range in number of alleles from 5 to 31 and observed and expected heterozygosity values ranging from 0.45–0.89 and 0.66–0.96 respectively. Six of seven loci conformed to Hardy-Weinberg equilibrium. Successful amplification was also achieved in other Pomacentridae.     

Alternative egg-feeding tactics in <Emphasis Type="Italic">Telmatherina sarasinorum</Emphasis>, a trophic specialist of Lake Matano’s evolving sailfin silversides fish radiation

Feeding specialisation is a typical feature of adaptive animal radiations. Different kinds of feeding specialisations have evolved in the endemic sailfin silversides species flock in Lake Matano (Central Sulawesi, Indonesia), including egg-feeding. The present study focuses on Telmatherina sarasinorum, a sailfin silverside species feeding on the eggs of related Telmatherina antoniae. Stomach content analyses supported T. antoniae eggs to be the dominant food item, independent of daytime. We hypothesized that the egg-feeders use alternative tactics for maximising egg consumption under varying densities of both, spawning T. antoniae pairs and competing conspecific egg-feeders. Focal behavioural observations were applied to describe different feeding tactics and to analyse feeding success and the related costs in terms of competitive interactions. Egg-feeders followed single courting pairs of T. antoniae or, alternatively, they switched between different spawning pairs. Following-behaviour, covering one or more spawning events of the host species, was positively related to enhanced egg consumption. Compared to feeding by switching frequently among different spawning pairs, the following tactic came at the cost of likewise increased competition. Behavioural observations suggest that some males monopolize courting pairs of T. antoniae and gain increased amounts of eggs compared to others avoiding competition by switching among pairs. The present results confirm that egg-feeding is a distinct trophic specialisation in T. sarasinorum and increase the scale of behavioural specialisation in Lake Matano’s evolving Telmatherina radiation.     

Detection of genetically unstable loci in parthenogenic families of lizards of theLacerta genus by DNA fingerprinting

Two parthenogenic families of unisexual species of Caucasian rock lizards of genusLacerta, L. armeniaca andL. unisexualis, were analyzed by DNA fingerprinting. Inheritance of M13 minisatellite and of (GACA) _n , (GATA) _n , and (TCC) _n microsatellite loci in the first generation of the lizards was studied. M13, (GACA) _n , and (TCC) _n loci in the families ofL. armeniaca were strictly inherited, as well as M13 and (GACA) _n loci in the families ofL. unisexualis: each DNA fragment in the fingerprint patterns of progeny could be detected in the maternal pattern. However, when a (TCC)₅₀ microsatellite probe was applied in the study ofL. unisexualis families, specific DNA fragments with altered mobility were revealed in the progeny patterns, and the frequency of such events was rather high. It might be hypothesized that some of the (TCC) _n loci inL. unisexualis genome are highly mutable. Hence, the family analysis allowed us to demonstrate experimentally the presence of genetically unstable loci in genomes of parthenogenic species of vertebrates. The nature and mechanism of the instability of these loci in parthenogenesis remain obscure.     

Heterogeneities in the distribution of (GACA)n simple repeats in the karyotypes of primates and mouse

Summary Tandemly organized simple repetitive sequences are widespread in all eukaryotes. The organization of the simple tetrameric (GACA)_n sequences at chromosomal loci has been investigated using in situ hybridization with chemically pure oligonucleotide probes. Both biotin- and digoxigenin-attached (GACA)₄ probes reveal specific hybridization signals over the short arms of all acrocentric autosomes in man. In the other examined primates the NOR-bearing autosomes could be detected by in situ hybridization with (GACA)₄, and a major concentration of the GACA simple repeats could be observed on the Y chromosome in the gibbon and mouse; the hybridization site in the gibbon Y chromosome coincides particularly with the silver-stainable NOR. In the past, accumulations of (GACA)_n sequences were demonstrated mainly on vertebrate sex chromosomes. Therefore, the organization of GACA simple sequences is discussed in the context of their evolutionary potential accumulation and the possible linkage with the primate rDNA loci.     

Development and characterization of seven novel di‐, tri‐, and tetranucleotide microsatellite markers in Atka mackerel (Pleurogrammus monopterygius)

We describe the enrichment for and characterization of seven Pleurogrammus monopterygius microsatellite loci. We used (GACA)₄ as an oligonucleotide enrichment probe and screened 484 clones from the enriched library. The seven microsatellite loci include five tetranucleotide, one dinucleotide, and one trinucleotide motif. These markers can potentially be useful tools for use in population genetics studies, parentage analyses, and examining other life history questions.     

Isolation and characterization of seven microsatellite loci in Chioglossa lusitanica (Urodela: Salamandridae)

Seven polymorphic microsatellite markers were isolated and characterized for golden‐striped salamander, Chioglossa lusitanica (Bocage 1864), a salamandrid endemic to the northwestern part of the Iberian Peninsula, from genomic libraries enriched for (GATA)₈ (GACA)₈ (ATG)₉ and (CA)₁₆. These loci were screened in 37–51 individuals from two populations. The number of alleles per locus ranged from five to 19. Heterozygosity ranged from 0.241 to 1.0. The high level of polymorphism revealed by these loci will be extremely useful for the study of population structure and evolutionary history of this species.     

Isolation and characterization of Brachymystax lenok microsatellite loci and cross‐species amplification in Hucho spp. and Parahucho perryi

We isolated and characterized eight polymorphic microsatellite markers for Brachymystax lenok (Pallas, 1773) from genomic libraries enriched for (GATA)_n, (GACA)_n and (ATG)_n microsatellites. The number of alleles per locus ranged from two to 17. Heterozygosity ranged from 0.2 to 0.95. In addition, cross‐species amplification was successful for seven loci in Hucho hucho, eight in H. taimen and seven in Parahucho perryi.     

Quantitative Assessment of Gene Diversity and Between-Population Differentiation of Parthenogenetic Lizard of the Genus DarevskiaUsing Mini- and Microsatellite DNA Markers

Methods of estimating within- and between-population gene diversity in parthenogenetic species using mini- and microsatellite DNA markers and modified Wright's F _ST statistic are presented with special reference to model populations of lizards of the genus Darevskia(D. dahli, D. armeniaca, D. unisexualis). We used DNA fingerprinting data for several populations of these species examined earlier. The effects of variation in M13 minisatellite, (GACA) _n - and (TCC) _n -microsatellite loci on the formation of within-population gene diversity in parthenogenetic species D. dahli and D. armeniaca were shown to be different. The equality of the realized gene diversity Hand its maximum possible value H _max in two populations of D. dahli (H _max = 0.032, H = 0.031, P 0.0431; H _max = 0.024, H = 0.027, P = 0.09) and D. armeniaca (H _max = 0.05, H = 0.053, P = 0.03; H _max= 0.054, H = 0.055, P= 0.02) suggests that variation in (GACA) _n loci substantially contributes to the maintenance of within-population genetic diversity. Analysis of between-population genetic diversity using loci M13, (GACA) _n , and (TCC) _n showed differentiation of D. dahli populations from northeastern and northwestern Armenia (F _ST = 0.0272, P = 3 × 10^–13) and genetic homogeneity of the Armenian and introduced to the Ukraine populations of D. armeniaca characteristic of one clone (F _ST = 0, P = 1).     

Isolation and characterization of microsatellite loci from the orchid Serapias vomeracea (Orchidaceae) and cross‐priming to other Serapias species

In this paper we describe the isolation and characterization of six polymorphic microsatellite loci from the orchid Serapias vomeracea. This species is widely distributed in the Mediterranean region. Microsatellite loci were isolated from an enriched library and primer pairs were designed for 18 loci. Primer pairs for six loci amplified well and were tested on samples from southern Italy. Levels of genetic variability detected at these six loci are high, with numbers of alleles per locus ranging from 3 to 6, and observed heterozygosity (H_O) ranging from 0.35 to 0.86. All primer pairs tested amplified DNA from four other Serapias species, indicating that the primers are useful for population genetic studies throughout the genus.     

Identification of microsatellite loci in lake sturgeon,Acipenser fulvescens,and their variability in green sturgeon,A. medirostris

From (CATC)_n, (GATA)_n, (AAAC)_n, and (CA)_n–enriched libraries for the lake sturgeon Acipenser fulvescens, 254 primer pairs were developed. These primer pairs resulted in the identification of 128 microsatellite loci in either A. fulvescens or A. medirostris. Polymorphic loci were identified in both sturgeon species for 48 of the primer pairs and 14 of the primer pairs amplified polymorphic loci only in A. medirostris. Most of the identified loci appear to be tetrasomic (79.1% in A. fulvescens and 64.5% in A. medirostris). These results offer estimates of the degree of diploidization in each of these species.     

Development and characterization of microsatellite markers in the sexual-apomictic complex Taraxacum officinale (dandelion)

 Microsatellite markers were developed in Taraxacum officinale to study gene flow between sexual and apomictic plants and to identify clones. Twenty five thousand genomic DNA clones were hybridized with a (CT)₁₂D probe. The density of (GA/CT) _n repeats was estimated at one every 61 kb in the T. officinale genome, which translates to 13 500 repeats per haploid genome. Ninety two percent of 110 positive clones sequenced contained at least one (GA/CT) _n≥5 repeat. Sixteen (CA/GT) _n≥5 and 11 (AT) _n≥5 arrays were also found in these sequences, suggesting some clustering of dinucleotide repeats. Among 50 PCR primer pairs tested, 32 produced bands and 28 of them were polymorphic. Of these polymorphic markers, 15 were putatively single-locus and the other 13 produced only polymorphic fingerprints. Six loci were further characterized for polymorphism and showed between 6 and 32 alleles per locus. Among eight primer pairs used to analyze the progeny of a sexual cross, seven were co-dominant single-locus Mendelian markers, but one (MSTA10) gave a dominant pattern in accordance with the hypothesis of a null allele segregating in a Mendelian fashion. Three pairs of loci among 28 showed significant linkages of 10, 21, and 39 cM. Observed and expected heterozygosities in two sexual populations indicate that null alleles may be present at two loci, including MSTA10. Received: 4 November 1997 / Accepted: 12 February 1998     

Ten polymorphic dinucleotide microsatellite markers of the noble scallop Chlamys nobilis

The primers flanking 22 microsatellites isolated from a genomic library enriched for (CA)_n and (GA)_n were designed in the noble scallop Chlamys nobilis. Ten primer pairs provided clear and polymorphic amplification products. Based on characterization with 48 individuals, the number of alleles ranged from three to six. The values of observed heterozygosity and expected heterozygosity varied from 0 to 0.88 and from 0.29 to 0.76, respectively. No significant linkage disequilibrium between pairs of loci was found and six of 10 loci conformed to the Hardy–Weinberg equilibrium. These markers are therefore potentially useful for studies of the population structure of the species.     

EST and random genomic nuclear microsatellite markers for Streptocarpus

Microsatellite markers have been developed from standard enriched genomic libraries and a cDNA library for the genus Streptocarpus. Out of 15 loci derived from ESTs (expressed sequence tags), four gave working primer pairs, with expected heterozygosities (H_E) ranging from 0.42 to 0.86. Out of 89 genomic library derived loci, 6 gave working primer pairs, with H_E ranging from 0.63 to 0.93.     

Genetic diversity in the blackberry rust pathogen, Phragmidium violaceum, in Europe and Australasia as revealed by analysis of SAMPL

Indigenous to Europe, the blackberry rust fungus Phragmidium violaceum was introduced to Australia and subsequently appeared in New Zealand, with the most recent authorised introductions to Australia specifically for the biological control of European blackberry. Markers for ‘selective amplification of microsatellite polymorphic loci’ (SAMPL) were developed for studying the population genetics of P. violaceum. Modification of one of the two SAMPL primers with a HaeIII adapter (H) revealed significantly greater levels of genetic variation than primers used to generate AFLPs, the latter revealing little or no variation among 25 Australasian and 19 European isolates of P. violaceum. SAMPL was used to describe genetic variation among these 44 isolates of P. violaceum from 51 loci generated using primer pairs (GACA)₄ + H–G and R1 + H–G. The European isolates were more diverse than Australasian isolates, with 37 and 22 % polymorphic loci, respectively. Cluster analysis revealed geographic clades, with Australasian isolates forming one cluster separated from two clusters comprising the European isolates. However, low bootstrap support at these clades suggested that Australian isolates had not differentiated significantly from European isolates since the first record of P. violaceum in Australia in 1984. In general, the results support two hypotheses. First, that the population of P. violaceum in Australia was founded from a subset of individuals originating from Europe. Second, that P. violaceum in New Zealand originated from the Australian population of P. violaceum, probably by wind dispersal of urediniospores across the Tasman Sea. The application of SAMPL markers to the current biological control programme for European blackberry is discussed.     

Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)_3.75, OAT18. 2 (GACA)_4.5, OAT24.2 (GACA)₆, OAT36 (GACA)₉, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)_3.75 and OAT15.2 (GACA)_3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.     

Linkage Disequilibrium in Natural Populations of Trypanosoma cruzi (Flagellate), the Agent of Chagas’ Disease1

ABSTRACT. We have studied linkage disequilibrium in natural populations of Trypanosoma cruzi, the agent of Chagas’ disease, by analyzing (i) a set of 524 stocks from the whole geographical range of the parasite, characterized at four gene loci coding for enzymes; (ii) a subsample of 121 stocks characterized at 12 enzyme loci; and (iii) a subset of 386 stocks from six locations in Bolivia, characterized by four enzyme loci. Our results show that the linkage disequilibrium reaches the maximum possible value, given the observed allelic frequencies, for almost all the locus pairs. This result is most consistent with the hypothesis that genetic recombination is absent or very rare in T. cruzi natural populations. Partition of the linkage disequilibrium variance for the six Bolivian populations shows that both inter- and intrapopulation components are substantial and that the relationships among the components are D_IS² < D_ST², and D'_IS² < D'_ST². These inequalities are interpreted as the result of an interplay between genetic drift, rare or absent mating, and clonal selection in generating linkage disequilibrium in T. cruzi populations.     

Abundance and polymorphism of simple repetitive DNA sequences in Bmssica napus L.

Summary The Brassica napus genome has been investigated by DNA fingerprinting with six synthetic oligonucleotide probes complementary to simple repetitive sequences, namely (GATA)₄, (GACA)₄, (GGAT)₄, (CA)₈, (CT)₈ and (GTG)₅. While all sequence motifs were found to be present in the B. napus genome, their organization and abundance varied considerably. Among the investigated probes, (GATA)₄ revealed the highest level of intraspecific polymorphism and distinguishes not only between cultivars but even between different individuals belonging to the same cultivar. In contrast, (GTG)₅, (GACA)₄ and (GGAT)₄ produced relatively homogeneous fingerprint patterns throughout different cultivars, while hybridization to (CT)₈ and (CA)₈ resulted in only a few weak bands superimposed on a smear. The isoschizomeric pair Hpa II and Msp I revealed the presence of methylated cytosines in the vicinity of (GATA)_m repeats. The applicability of simple repetitive sequence polymorphisms as molecular markers for Brassica species is discussed.     

Isolation and characterisation of 11 tetranucleotide microsatellite loci in the common genet (Genetta genetta)

We report the isolation and characterization of 11 polymorphic tetranucleotide microsatellite loci in the common genet (Genetta genetta) from genomic libraries enriched for (AAAG) _n and (AGAT) _n repeat sequences. We chose to develop tetranucleotide repeats because they can be scored less ambiguously. In a sample of 25 individuals, we observed between four and thirteen alleles per locus and their observed and expected heterozygosities ranged from 0.60 to 0.84 and from 0.68 to 0.92, respectively. All genotypic frequencies conformed to Hardy–Weinberg equilibrium expectations and there were no instances of linkage disequilibrium detected between pairs of loci. These loci will be of use in studies of population genetics, historical demography, and molecular ecology of the common genet.     

New microsatellite markers in turbot (Scophthalmus maximus) derived from an enriched genomic library and sequence databases

Scophthalmus maximus is an important commercially aquaculture fish species. We tackle the search for new microsatellites using two different approaches: an enriched partial genomic library and a screening of all turbot DNA sequences deposited in GenBank. Out of 15 genomic library derived loci, five gave working primer pairs, with expected heterozygosities (H_E) ranging from 0.13 to 0.91. Out of seven loci derived from database sequences, two amplified successfully with an H_E ranging from 0.56 to 0.63. The average allele number of these microsatellites was 5.7 per locus with a range between two and 15.     

Development of polymorphic EST-derived SSR markers for the shrimp, Fenneropenaeus chinensis

In our study, we evaluated simple sequence repeat (SSR) markers from expressed sequence tags (ESTs) of Fenneropenaeus chinensis. Characteristics of 11 EST-SSR loci were investigated using 34 F. chinensis individuals. The number of alleles per locus ranged from 4 to 9. The observed heterozygosity ranged from 0.118 to 0.826, while the expected heterozygosity ranged from 0.623 to 0.847. Two loci (T2 and T12) conformed to the Hardy–Weinberg equilibrium. There was no LD observed between all pairs of EST-SSRs loci. The PIC values of 11 microsatellite loci were higher than 0.5. These loci and markers will be useful for population genetics and systemic evolution of F. chinensis.