Use of Rep‐PCR for Genetic Diversity Analyses in Fusarium culmorum

Fusarium culmorum is a pathogen of economically important grain crops. In this work, Rep‐PCR was used to identify genetic diversity in F. culmorum isolates which have been collected from wheat fields in Turkey. Reproducible genomic fingerprints were amplified in each strain by PCRs of prokaryotic repetitive extragenic palindromic (REP), enterobacterial repetitive intergenic consensus (ERIC) and BOX sequences. Totally 104 molecular markers were evaluated and similarity comparisons were shown as a dendrogram. The average genetic diversity was 52.3% ranging from 15.8% to 88.7% according to the Rep‐PCR data. Cluster analysis showed agreement with the distance of sampling locations. The highest genetic similarity (84.2%) was determined between two F. culmorum isolates (F1 and F2) originated from the same agro‐ecological region. Our results showed that Rep‐PCR is convenient and rapid for genetic diversity analyses and strain differentiation in F. culmorum.     

Multiplex restriction amplicon sequencing: a novel next‐generation sequencing‐based marker platform for high‐throughput genotyping

To enable rapid selection of traits in marker‐assisted breeding, markers must be technically simple, low‐cost, high‐throughput and randomly distributed in a genome. We developed such a technology, designated as Multiplex Restriction Amplicon Sequencing (MRASeq), which reduces genome complexity by polymerase chain reaction (PCR) amplification of amplicons flanked by restriction sites. The first PCR primers contain restriction site sequences at 3’‐ends, preceded by 6‐10 bases of specific or degenerate nucleotide sequences and then by a unique M13‐tail sequence which serves as a binding site for a second PCR that adds sequencing primers and barcodes to allow sample multiplexing for sequencing. The sequences of restriction sites and adjacent nucleotides can be altered to suit different species. Physical mapping of MRASeq SNPs from a biparental population of allohexaploid wheat (Triticum aestivum L.) showed a random distribution of SNPs across the genome. MRASeq generated thousands of SNPs from a wheat biparental population and natural populations of wheat and barley (Hordeum vulgare L.). This novel, next‐generation sequencing‐based genotyping platform can be used for linkage mapping to screen quantitative trait loci (QTL), background selection in breeding and many other genetics and breeding applications of various species.     

INTER‐ AND INTRASPECIFIC COMMUNITY STRUCTURE WITHIN THE DIATOM GENUS PSEUDO‐NITZSCHIA (BACILLARIOPHYCEAE)1

Pseudo‐nitzschia‐specific PCR primers (PnAll F/R) were designed to amplify a polymorphic region of the internal transcribed spacer 1 (ITS1) from at least 11 Pseudo‐nitzschia species. The primers were used to generate environmental clone libraries from Puget Sound, Washington, and Vancouver Island, British Columbia, to confirm that the primers were specific for Pseudo‐nitzschia and to determine the extent of ITS1 sequence diversity within individual species. All environmental ITS1 sequences generated with PnAll primers displayed the greatest similarity to known Pseudo‐nitzschia ITS1 sequences. The length of cloned ITS1 fragments differed among species but was conserved within a species. Intraspecific genotypes exhibited <3% sequence divergence for seven of the 10 species detected in clone libraries. Several ITS1 genotypes unique to the Pacific Northwest were identified in environmental samples, and other genotypes were more broadly distributed. The Pseudo‐nitzschia primers were also used to develop an automated ribosomal intergenic spacer analysis (ARISA) to rapidly identify Pseudo‐nitzschia species in environmental samples based on species‐specific variation in the length of the targeted ITS1 region. The ARISA peaks were then associated with the environmental clone sequences for Pseudo‐nitzschia species. Surveying the genetic composition of communities at both the inter‐ and intraspecific levels will enhance our understanding of Pseudo‐nitzschia bloom dynamics.     

Development of Streptococcus gordonii‐specific quantitative real‐time polymerase chain reaction primers based on the nucleotide sequence of rpoB

In this study, Streptococcus gordonii‐specific quantitative real‐time polymerase chain reaction (qPCR) primers, RTSgo‐F2/RTSgo‐R2, were developed based on the nucleotide sequences of RNA polymerase β‐subunit gene (rpoB). The specificity of the RTSgo‐F2/RTSgo‐R2 primers was assessed by conventional PCR on 99 strains comprising 63 oral bacterial species, including the type strain and eight clinical isolates of S. gordonii. PCR products were amplified from the genomic DNAs of only S. gordonii strains. The qPCR primers were able to detect as little as 40 fg of S. gordonii genomic DNA at a cycle threshold value of 33. These findings suggest that these qPCR primers detect S. gordonii with high specificity and sensitivity.     

Performance comparison of genetic markers for high‐throughput sequencing‐based biodiversity assessment in complex communities

Metabarcode surveys of DNA extracted from environmental samples are increasingly popular for biodiversity assessment in natural communities. Such surveys rely heavily on robust genetic markers. Therefore, analysis of PCR efficiency and subsequent biodiversity estimation for different types of genetic markers and their corresponding primers is important. Here, we test the PCR efficiency and biodiversity recovery potential of three commonly used genetic markers – nuclear small subunit ribosomal DNA (18S), mitochondrial cytochrome c oxidase subunit I (COI) and 16S ribosomal RNA (mt16S) – using 454 pyrosequencing of a zooplankton community collected from Hamilton Harbour, Ontario. We found that biodiversity detection power and PCR efficiency varied widely among these markers. All tested primers for COI failed to provide high‐quality PCR products for pyrosequencing, but newly designed primers for 18S and 16S passed all tests. Furthermore, multiple analyses based on large‐scale pyrosequencing (i.e. 1/2 PicoTiter plate for each marker) showed that primers for 18S recover more (38 orders) groups than 16S (10 orders) across all taxa, and four vs. two orders and nine vs. six families for Crustacea. Our results showed that 18S, using newly designed primers, is an efficient and powerful tool for profiling biodiversity in largely unexplored communities, especially when amplification difficulties exist for mitochondrial markers such as COI. Universal primers for higher resolution markers such as COI are still needed to address the possible low resolution of 18S for species‐level identification.     

A DNA mini‐barcode for land plants

Small portions of the barcode region – mini‐barcodes – may be used in place of full‐length barcodes to overcome DNA degradation for samples with poor DNA preservation. 591,491,286 rbcL mini‐barcode primer combinations were electronically evaluated for PCR universality, and two novel highly universal sets of priming sites were identified. Novel and published rbcL mini‐barcode primers were evaluated for PCR amplification [determined with a validated electronic simulation (n = 2765) and empirically (n = 188)], Sanger sequence quality [determined empirically (n = 188)], and taxonomic discrimination [determined empirically (n = 30 472)]. PCR amplification for all mini‐barcodes, as estimated by validated electronic simulation, was successful for 90.2–99.8% of species. Overall Sanger sequence quality for mini‐barcodes was very low – the best mini‐barcode tested produced sequences of adequate quality (B₂₀ ≥ 0.5) for 74.5% of samples. The majority of mini‐barcodes provide correct identifications of families in excess of 70.1% of the time. Discriminatory power noticeably decreased at lower taxonomic levels. At the species level, the discriminatory power of the best mini‐barcode was less than 38.2%. For samples believed to contain DNA from only one species, an investigator should attempt to sequence, in decreasing order of utility and probability of success, mini‐barcodes F (rbcL1/rbcLB), D (F52/R193) and K (F517/R604). For samples believed to contain DNA from more than one species, an investigator should amplify and sequence mini‐barcode D (F52/R193).     

Brief Report of a New Highly Divergent Variant of Grapevine leafroll‐associated virus 3 (GLRaV‐3)

The alignment of the complete genomes of genetic variants of Grapevine leafroll‐associated virus 3 (GLRaV‐3) representing phylogenetic groups I, II, III and VI revealed numerous regions with exceptionally high divergence between group I to III and group VI variants. Oligonucleotide primers universal for all the above groups of the virus were designed in conserved short stretches of sequences flanking the divergent regions in the helicase (Hel) and RNA‐dependent RNA polymerase (RdRP) domains of the replicase gene and the divergent copy of the capsid protein (dCP) gene. Cloning and sequencing of the 549‐bp RT‐PCR amplicon of the helicase domain from grapevine cv. Shiraz lead to the detection of a variant of GLRaV‐3, which shared only 69.6–74.1% nt similarity with other variants, including the recently reported, new, highly divergent variant, isolate 139. This was confirmed by the results of the analysis of 517‐bp amplicon of the HSP70 gene of GLRaV‐3 generated in RT‐nested PCR based on degenerate primers for the simultaneous amplification of members of the Closteroviridae family designed by Dovas and Katis (J Virol Methods, 109, 2003, 217). In this genomic region, the variant shares 72.3–78.7% nt similarity with other variants of GLRaV‐3. This previously unreported, new, highly divergent variant was provisionally named GTG10. From the alignment of the HSP70 sequences primers for the specific RT‐nested PCR amplification of the variant GTG10 and members of group VI, and specific simultaneous amplification of variants of groups I, II and III, were designed. The results obtained from brief testing of various grapevines using all these primers suggest a relatively limited presence of GTG10 variant in vineyards.     

Species‐specific detection of Candida tropicalis using evolutionary conserved intein DNA sequences

Inteins (internal proteins) are self‐splicing transportable genetic elements present in conserved regions of housekeeping genes. The study highlights the importance of intein as a potential diagnostic marker for species‐specific identification of Candida tropicalis, a rapidly emerging opportunistic human pathogen. Initial steps of primer validation, sequence alignment, phylogenetic tree analysis, gel electrophoresis and real‐time polymerase chain reaction (PCR) assays were performed to confirm the specificity of the designed primers. The primers were selective for C. tropicalis with 100% inclusivity and showed no cross‐species or cross‐genera matches. The established technique is a prototype for developing multifaceted PCR assays and for point‐of‐care testing in near future.

Significance and Impact of the Study

Development of molecular markers for specific detection of microbial pathogens using real‐time polymerase chain reaction (PCR) is an appealing and challenging technique. A real‐time PCR is an emerging technology frequently used to detect the aetiologic agents. In recent times, designing species‐specific primers for pathogen detection is gaining momentum. The method offers rapid, accurate and cost‐effective strategy to identify the target, thus providing sufficient time to instigate appropriate chemotherapy. The study highlights the use of intein DNA sequence as molecular markers for species‐specific identification of Candida tropicalis. The study also offers a prototype model for developing multifaceted PCR assays using intein DNA sequences, and provides a developmental starting point for point‐of‐care testing in near future.     

Microdevice‐based solid‐phase polymerase chain reaction for rapid detection of pathogenic microorganisms

We demonstrate the integration of DNA amplification and detection functionalities developed on a lab‐on‐a‐chip microdevice utilizing solid‐phase polymerase chain reaction (SP‐PCR) for point‐of‐need (PON) DNA analyses. First, the polycarbonate microdevice was fabricated by thermal bonding to contain microchambers as reservoirs for performing SP‐PCR. Next, the microchambers were subsequently modified with polyethyleneimine and glutaraldehyde for immobilizing amine‐modified forward primers. During SP‐PCR, the immobilized forward primers and freely diffusing fluorescence‐labeled reverse primers cooperated to generate target amplicons, which remained covalently attached to the microchambers for the fluorescence detection. The SP‐PCR microdevice was used for the direct identifications of two widely detected foodborne pathogens, namely Salmonella spp. and Staphylococcus aureus, and an alga causing harmful algal blooms annually in South Korea, Cochlodinium polykrikoides. The SP‐PCR microdevice would be versatilely applied in PON testing as a universal platform for the fast identification of foodborne pathogens and environmentally threatening biogenic targets.     

Complete Genome Sequence and Genome Analysis of Eggplant mottled dwarf virus‐Iranian Isolate

The full‐length nucleotide sequence of the Iranian isolate of Eggplant mottled dwarf virus (EMDV), a phytorhabdovirus, was determined using the random polymerase chain reaction method (rPCR) followed by PCR with specific primers to fill in the gaps. The negative‐sense RNA genome of the Iranian isolate of EMDV contains 13154 nucleotides and seven open‐reading frames (ORFs) in the order 3′‐leader‐N‐X‐P‐Y‐M‐G‐L‐trailer‐5′. These ORFs encode the nucleocapsid, X protein (of unknown function), phosphoprotein, Y protein (putative movement protein), matrix protein, glycoprotein and RNA‐dependent RNA polymerase, respectively. EMDV has a 199 nt 3′ leader RNA and a 151 nt 5′ trailer, and the ORFs are separated by conserved intergenic sequences. Phylogenetic analyses indicate that EMDV is most closely related to Potato yellow dwarf virus, which has a distinctly different geographical distribution.     

A simple method to score single nucleotide polymorphisms based on allele‐specific PCR and primer‐induced fragment‐length variation

We describe a simple protocol to genotype single nucleotide polymorphisms (SNPs), which combines allele‐specific polymerase chain reaction (PCR) with fragment‐length analysis. Three primers are used in the PCR: two allele‐specific forward primers with a length‐difference and one reverse primer. The forward primers induce a length‐difference between the SNP‐variants, which can be assessed with standard fragment‐length analyses. We designed primers for 21 SNPs, and codominance was achieved for 76% of these SNPs. An inexpensive and flexible laser‐detection scoring protocol can be achieved with multiplex scoring and by incorporating the M13(‐21) genotyping method.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Differences in population structure estimated within maternally‐ and paternally‐inherited forms of mitochondria in Lampsilis siliquoidea (Bivalvia: Unionidae)

Mussels in several orders possess two separate mitochondrial lineages: a standard female‐inherited form and one inherited only through males. This system of doubly uniparental inheritance (DUI) for mitochondrial genes provides an opportunity to compare the population structure of gene‐lineages passed either mother‐to‐daughter or father‐to‐son. In the present study, we contrast variation in the male and female haplotype lineages of the American freshwater mussel species, Lampsilis siliquoidea (sometimes called Lampsilis radiata luteola), throughout the Lake Erie, Ohio River, and upper Mississippi River watersheds, and contrast variation with the sequences obtained for the related species/subspecies Lampsilis radiata radiata from Maine. The genetic markers were fragments of the cytochrome c oxidase subunit I gene (COI), which occurs in both mitochondrial types, F (female) and M (male). High haplotype diversity was found in the two independent lineages, although purifying selection against amino acid change appeared to be stronger in the female than the male lineage. Phylogeographical patterns also varied between mitochondria passing through females and males. The female lineage exhibited more population structure, with the occurrence of private or nearly‐private haplotypes within two streams, and three others showed restricted haplotype distributions. By contrast to the F‐haplotypes, complex phylogenetic structure occurred for M‐haplotypes, yet this phylogenetic variation coincided with almost no geographical pattern within haplotypes. Basically, F‐haplotypes showed isolation, especially above physical barriers, whereas M‐haplotypes did not. A few individuals in the eastern Lake Erie watershed even possessed M‐haplotypes of an Atlantic Slope (L. radiata radiata) origin, although their F‐haplotypes were typical of Midwestern L. siliquoidea. The finding that mussels package sperm as spermatozuegmata, which float downstream, may underlie greater gene mobility in male‐inherited mitochondria. © 2013 The Linnean Society of London, Biological Journal of the Linnean Society, 2013, 109 , 229–240.     

Direct sequencing of haplotypes from diploid individuals through a modified emulsion PCR‐based single‐molecule sequencing approach

While standard DNA‐sequencing approaches readily yield genotypic sequence data, haplotype information is often of greater utility for population genetic analyses. However, obtaining individual haplotype sequences can be costly and time‐consuming and sometimes requires statistical reconstruction approaches that are subject to bias and error. Advancements have recently been made in determining individual chromosomal sequences in large‐scale genomic studies, yet few options exist for obtaining this information from large numbers of highly polymorphic individuals in a cost‐effective manner. As a solution, we developed a simple PCR‐based method for obtaining sequence information from individual DNA strands using standard laboratory equipment. The method employs a water‐in‐oil emulsion to separate the PCR mixture into thousands of individual microreactors. PCR within these small vesicles results in amplification from only a single starting DNA template molecule and thus a single haplotype. We improved upon previous approaches by including SYBR Green I and a melted agarose solution in the PCR, allowing easy identification and separation of individually amplified DNA molecules. We demonstrate the use of this method on a highly polymorphic estuarine population of the copepod Eurytemora affinis for which current molecular and computational methods for haplotype determination have been inadequate.     

A Real‐time PCR Assay to Identify Meloidogyne minor

Meloidogyne minor is a small root‐knot nematode that causes yellow patch disease in golf courses and severe quality damage in potatoes. It was described in 2004 and has been detected in The Netherlands, England, Wales, Northern Ireland, Ireland and Belgium. The nematode often appears together with M. naasi on grasses. It causes similar symptoms on potato tubers as M. chitwoodi and M. fallax, which are both quarantine organisms in Europe. An accurate identification method therefore is required. This study describes a real‐time PCR assay that enables the identification of M. minor after extraction of nematodes from soil or plant samples. Alignments of sequences of rDNA‐ITS fragments of M. minor and five other Meloidogyne species were used to design a forward primer Mminor_f299, a specific primer Mminor_r362 and the specific MGB TaqMan probe P_Mm_MGB321. PCR with this primers and probe results in an amplicon of 64 bp. The analytical specificity of the real‐time PCR assay was assessed by assaying it on six populations of M. minor and on 10 populations of six other Meloidogyne species. Only DNA from M. minor gave positive results in this assay. The assay was able to identify M. minor using DNA from a single juvenile independent from the DNA extraction method used.     

New specific primers for amplification of the Internal Transcribed Spacer region in Clitellata (Annelida)

Nuclear molecular evidence, for example, the rapidly evolving Internal Transcribed Spacer region (ITS), integrated with maternally inherited (mitochondrial) COI barcodes, has provided new insights into the diversity of clitellate annelids. PCR amplification and sequencing of ITS, however, are often hampered by poor specificity of primers used. Therefore, new clitellate‐specific primers for amplifying the whole ITS region (ITS: 29F/1084R) and a part of it (ITS2: 606F/1082R) were developed on the basis of a collection of previously published ITS sequences with flanking rDNA coding regions. The specificity of these and other ITS primers used for clitellates were then tested in silico by evaluating their mismatches with all assembled and annotated sequences (STD, version r127) from EMBL, and the new primers were also tested in vitro for a taxonomically broad sample of clitellate species (71 specimens representing 11 families). The in silico analyses showed that the newly designed primers have a better performance than the universal ones when amplifying clitellate ITS sequences. In vitro PCR and sequencing using the new primers were successful, in particular, for the 606F/1082R pair, which worked well for 65 of the 71 specimens. Thus, using this pair for amplifying the ITS2 will facilitate further molecular systematic investigation of various clitellates. The other pair (29F/1084R), will be a useful complement to existing ITS primers, when amplifying ITS as a whole.     

Evidence for extreme sequence divergence between the male‐ and female‐transmitted mitochondrial genomes in the bivalve mollusc,Modiolus modiolus (Mytilidae)

Marine mussels of the family Mytilidae, as well as a number of other bivalves, have a unique system of mitochondrial DNA inheritance called doubly uniparental inheritance (DUI). DUI is characterized by the presence of an ‘F’ mitochondrial genome that is transmitted through mothers to daughters and sons, and an ‘M’ mitochondrial genome that is transmitted only from fathers to sons. In this paper, we demonstrate that DUI exists in the horse mussel, Modiolus modiolus (Linnaeus, 1758) and compare the pattern of molecular evolution of the M and F types in this species. Total DNA was isolated from M. modiolus male and female gonad tissues, as well as from spawned sperm cells. From these DNA samples, partial mitochondrial DNA fragments were amplified from both cytochrome c oxidase subunit I (cox1), and 16S ribosomal RNA (rrnL) genes. Based on cox1 and rrnL sequences, heteroplasmy was observed in M. modiolus and characterized by the resolution of two mitotypes: an F mitotype present in tissues of both males and females, and an M mitotype present in spawned sperm. Using standardized p‐distance and Tamura‐Nei values, M. modiolus is found to display the highest M/F conspecific sequence divergence for any member of the family Mytilidae (i.e. 38% M/F sequence divergence, which is 9% higher than any other intraspecific M/F comparison for the family Mytilidae when standardized using p‐distances across all taxa observed). Sequence analysis also indicated that the M. modiolus M mitotype evolves significantly faster than its conspecific F type. The findings discussed herein broaden the range of mytilid species known to exhibit DUI and they also establish a new threshold for the genetic divergence of male mytilid mitochondrial genomes.     

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini‐barcode

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century‐old museum specimens and shown to be useful as mini‐barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.     

Diversity of human colonic butyrate‐producing bacteria revealed by analysis of the butyryl‐CoA:acetate CoA‐transferase gene

Butyrate‐producing bacteria play an important role in the human colon, supplying energy to the gut epithelium and regulating host cell responses. In order to explore the diversity and culturability of this functional group, we designed degenerate primers to amplify butyryl‐CoA:acetate CoA‐transferase sequences from faecal samples provided by 10 healthy volunteers. Eighty‐eight per cent of amplified sequences showed > 98% DNA sequence identity to CoA‐transferases from cultured butyrate‐producing bacteria, and these fell into 12 operational taxonomic units (OTUs). The four most prevalent OTUs corresponded to Eubacterium rectale, Roseburia faecis, Eubacterium hallii and an unnamed cultured species SS2/1. The remaining 12% of sequences, however, belonged to 20 OTUs that are assumed to come from uncultured butyrate‐producing strains. Samples taken after ingestion of inulin showed significant (P = 0.019) increases in Faecalibacterium prausnitzii. Because several of the dominant butyrate producers differ in their DNA % G+C content, analysis of thermal melt curves obtained for PCR amplicons of the butyryl‐CoA:acetate CoA‐transferase gene provides a convenient and rapid qualitative assessment of the major butyrate producing groups present in a given sample. This type of analysis therefore provides an excellent source of information on functionally important groups within the colonic microbial community.