Affinity labelling of tryptophanyl-transfer RNA synthetase

A double affinity-labelling approach has been developed in order to convert an oligomeric enzyme with multiple active centres into a single-site enzyme.Tryptophanyl-transfer RNA synthetase (EC 6.1.1.2) from beef pancreas is a symmetric dimer, α₂ An ATP analogue, γ-(p-azidoanilide)-ATP does not serve as a substrate for enzymatic aminoacylation of tRNA^Trp but acts as an effective competitive inhibitor in the absence of photochemical reaction, with K₁ = 1 × 10^?3m (K_mfor ATP = 2 × 10^?4m). The covalent photoaddition of azido-ATP³ results in complete loss of enzymatic activity in both the ATP-[³²P]pyrophosphate exchange reaction and tRNA aminoacylation. ATP completely protects the enzyme against inactivation. However, covalent binding of azido-ATP is also observed outside the active centres. The difference between covalent binding of the azido-ATP in the absence and presence of ATP corresponds to 2 moles of the ATP analogue per mole of the enzyme.Two binding sites for tRNA^Trp have been found from complex formation at pH 5.8 in the presence of Mg²⁺. The two tRNA molecules bind, with K_dis = 3.6 × 10^?8m and K_dis = 0.9 × 10^?6m, respectively, pointing to a strong negative co-operativity between the binding sites for tRNA.N-chlorambucilyl-tryptophanyl-tRNA^Trp and TRSase form a complex with K_dis = 5.5 × 10^?8m at pH 5.8 in the presence of 10 mm-Mg²⁺. This value is similar to the value of K_dis for tryptophanyl-tRNA of 4.8 × 10^?8m. Under the same conditions a 1:1 complex (in mol) is formed between the enzyme and Trp-tRNA or N-chlorambucilyl-Trp-tRNA. On incubation, a covalent bond is formed between N-chlorambucilyl-Trp-tRNA and TRSase; 1 mole of affinity reagent alkylates 1 mole of enzyme independently of the concentration of the modifier. The alkylation reaction is completely inhibited by the presence of tRNA^Trp whereas the tRNA devoid of tRNA^Trp does not affect the rate of alkylation. In the presence of either ATP or tryptophan, or a mixture of the two, the alkylation reaction is inhibited even though these ligands have no effect on the complex formation between TRSase and the tRNA analogue. Photoaddition of the azido-ATP completely prevents the reaction of the enzyme with the tRNA analogue, although the non-covalent complex formation is not affected.Exhaustive alkylation of TRSase partially inhibits the reaction of ATP [³²P]pyrophosphate exchange and completely blocks the aminoacylation of tRNA^Trp. Cleavage of the tRNA which is covalently bound to TRSase restores both the ATP-[³²P]pyrophosphate exchange and aminoacylation activity.The TRSase which is covalently-bound to R-Trp-tRNA is able to incorporate only one ATP molecule per dimeric enzyme into the active centre. This doubly modified enzyme is completely enzymatically inactive. Removal of the tRNA residue from the doubly modified enzyme results in the formation of the derivative with one blocked ATP site. Therefore, a “single-site” TRSase may be generated either by alkylation of the enzyme with Cl-R-Trp-tRNA or after the removal of covalently bound tRNA from the doubly labelled protein.Tryptophanyl-tRNA synthetase containing blocked ATP and/or tRNA binding site(s) seems to bo a useful tool for investigation of negative co-operativity and may help in the elucidation of the structure function relationships between the active centres.     

Effect of photochemical crosslink S4U(8)-C(13) on suppressor activity of su+ tRNATrp from Escherichia coli.

Readthrough in vitro of the Qβ coat protein terminator codon UGA has been used as an assay for suppression by UGA-suppressor tRNA^Trp. When the tRNA is covalently crosslinked between 4-thiouracil(8) and cytosine(13) by irradiation at 334 nm, it is found that UGA suppression by this assay is reduced to the low level characteristic of the wild type tRNA^Trp. In contrast, crosslinking has little effect on incorporation of tryptophan in response to UGG codons. Thus, incorporation of tryptophan during translation of R17 messenger RNA is unaffected by photochemical crosslinking. Furthermore, dilution experiments using R17 mRNA in which tryptophan incorporation is dependent on precharged suppressor Trp-tRNA show that the crosslinked species competes well with non-irradiated tRNA. These results further emphasize the influence on tRNA-ribosome interactions of the region in tRNA around the dihydrouridine arm, where the mutation, in the suppressor is found and the photochemical crosslink is introduced.     

Studies on the ribothymidine content of specific rat and human tRNAs: a postulated role for 5-methyl cytosine in the regulation of ribothymidine biosynthesis.

Total mammalian tRNAs contain on the average less than one mole of ribothymidine per mole of tRNA. Mammalian tRNAs can be grouped into at least four classes, depending upon their ribothymidine content at position 23 from the 3′ terminus. Class A contains tRNA in which a nucleoside other than uridine replaces ribothymidine (tRNA_i^Met); Class B contains tRNA in which one mole of a modified uridine (rT, ψ, or 2′-O-methylribothymidine) is found per mole of tRNA (tRNA^Ser, tRNA^Trp, and tRNA^Lys, respectively). Class C contains tRNA in which there is a partial conversion of uridine to ribothymidine (tRNA^Phe, tRNA₁^Gly, tRNA₂^Gly); Class D contains tRNA which totally lacks ribothymidine (tRNA^Val). Only those tRNAs in Class C are acceptable substrates for $\text{E.}\text{coli}$ uridine methylase, under the conditions used in these studies. These observations cannot be adequately explained solely on the basis of the presence or absence of a specific “universal” nucleoside other than U or rT at position 23 from the 3′ terminus. However, correlations can be made between the ribothymidine and 5-methylcytosine content of eucaryotic tRNA. We postulate that the presence of one or more 5-methylcytosines in and adjacent to loop III (minor loop) in individual tRNAs act to regulate the amount of ribothymidine formed by uridine methylase. Several experiments are proposed as tests for this hypothesis.     

Conformational changes in the thiouridine region of Escherichia coli transfer RNA as assessed by photochemically induced crosslinking: Effect of a single base change in the “extra” loop of formylmethionine tRNA and of denaturation of tryptophan tRNA

Photochemical crosslinking studies on two formylmethionine tRNAs of Escherichia coli are consistent with the hypothesis that the role of 7-methylguanosine is to stabilize a tertiary structure of tRNA in which the “extra” loop is folded over so as to be close to the 4-thiouridine region of the molecule. In tRNA^{fmet 3}, which differs from tRNA^{fmet 1} only by substitution of an adenosine for the 7-methylguanosine in the “extra” loop, crosslinking was virtually abolished when the tRNA was placed in 40 mm Na⁺, whereas tRNA^{fmet 1} in 40 mm Na⁺ was crosslinked to 95% of the maximum extent observed for both tRNAs in Mg²⁺. Even in Mg²⁺, a difference in structure between the two tRNAs could be detected by means of a two-fold decrease in the rate of crosslinking in tRNA^{fmet 3} as compared to tRNA^{fmet 1}. Comparison of crosslinking in the native and metastable denatured forms of tRNA^Trp of E. coli revealed that these structures also differ with respect to the orientation and/or distance between 4-thiouridine (8) and cytidine (13), since denaturation abolished crosslinking. However, separation of these two residues is not obligatory for denaturation, since crosslinked tRNA^Trp could still be denatured. A 30% difference in fluorescence between the native and denatured forms of crosslinked-reduced tRNA^Trp infers an increase in hydrophilicity in the 4-thiouridine region upon denaturation.     

Isolation of transfer RNA isoacceptors by chromatography on dihydroxyboryl-substituted cellulose,polyacrylamide, and glass

Polyacrylamide and porous-glass supports containing the dihydroxyborylphenyl group can be prepared by a method similar to that used in the synthesis of N-[N′-(m-dihydroxyborylphenyl)succinamyl]aminoethylcellulose. The reaction of aminoethylpolyacrylamide or amino-substituted glass with N-(m-dihydroxyborylphenyl)succinamic acid in the presence of N-cyclohexyl-N′-β-(4-methyl-morpholinium) ethylcarbodiimide yields products which, together with the cellulose derivative, are all capable of binding tRNA dissolved in buffers at pH 8.7. The demonstration that bound tRNA can be released with sorbitol solutions or with low pH buffers, together with studies on the binding of tRNA species that contain chemically modified 3′-terminals, indicate that the predominant binding mechanism consists of cyclic complex formation between the immobilized dihydroxyboryl groups and the 3′-terminal cis-diol groups of the tRNA molecules. Aminoacylated tRNA does not bind under the conditions necessary to bind tRNA and this permits the isolation of specific tRNA isoacceptors. The purification of tRNA^Phe and the partial purification of tRNA^Glu and tRNA^Trp are described.     

Complex formation between transfer RNAs with complementary anticodons: use of matrix bound tRNA

It is shown that yeast tRNA^Phe, chemically coupled by its oxidized 3′CpCpA end behaves exactly as free tRNA^Phe in its ability to form a specific complex with $\text{E. coli}$ tRNA₂^Glu having a complementary anticodon. The results support models of tRNA in which the 3′CpCpA_OH end and the anticodon are not closely associated in the tertiary structure, and provide a convenient tool of general use to characterize others pairs of tRNA having complementary anticodons, as well as for highly selective purification of certain tRNA species.     

Properties of the 5'-terminus of tRNAHis: kinetics of polynucleotide kinase catalyzed exchange and effect of dephosphorylation on the aminoacylation reaction.

Bacteriophage T₄ induced polynucleotide kinase was found to be ineffective in transferring ³²P from [γ-³²P]ATP to the 5′-terminus of 5′-phosphorylated $\text{E. coli}$ tRNA^His using the ADP mediated exchange reaction. However, prior dephosphorylation with alkaline phosphatase allowed polynucleotide kinase catalyzed phosphorylation of tRNA^His. Contrary to reports for other tRNA species, alkaline phosphatase catalyzed 5′-terminus dephosphorylation destroys the amino acid accepting ability of tRNA^His. Aminoacylation competency of the tRNA^His is restored after phosphorylation with polynucleotide kinase.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

Interactions of yeast valyl-tRNA synthetase with RNAs and conformational changes of the enzyme.

Different conformations have been identified for the enzyme valyl-tRNA synthetase from yeast inside its complex with one tRNA molecule by neutron scattering. One form is identical to that of the free enzyme in solution; the other form is more contracted, having a radius of gyration which is smaller by 10% and a specific volume which is smaller by 1%. The contracted conformation has been found for the complexes with tRNA^Val and tRNA^Asp in phosphate buffer (pH 6.3) provided the ionic strength is lower than about 150 mm. In higher ionic strength (up to about 500 mm) the enzyme still forms a complex with tRNA^Val but its conformation remains that of the free protein in solution. In the complex with tRNA₃^Leu, the enzyme conformation is that of the free state even at the lowest ionic strength examined (that of the phosphate buffer, 60 mm). The free enzyme is an elongated molecule of radius of gyration 40 Å (a compact protein of the same molecular weight would have a radius of gyration of 30 Å).The positioning within the complex of tRNA^Val, on the one hand, and tRNA₃^Leu, on the other, is very different. The first tRNA is intimately associated with the enzyme, lying predominantly closer to the centre of mass of the complex than the protein. In the complex with tRNA₃^Leu, the tRNA lies further away from the centre of mass of the complex than the protein.Small concentrations of tRNA^Val, tRNA^Asp, tRNA₃^Leu or Escherichia coli 5 S ribosomal RNA cause the enzyme to aggregate into dimers, trimers and higher aggregates provided the ionic strength of the buffer is below 150 mm. In higher ionic strength or for [RNA]: [enzyme] > 1 the aggregates are dissociated to yield the one-to-one RNA-enzyme complex.     

Study of the Mechanism of Interaction of Oligonucleotides with the 3′-Terminal Region of tRNA<Superscript>Phe</Superscript> by Computer Modeling

Three-dimensional atomic models of complexes between yeast tRNA^Phe and 10- or 15-mer oligonucleotides complementary to the 3′-terminal tRNA sequence have been constructed using computer modeling. It has been found that rapidly formed primary complexes appear when an oligonucleotide binds to the coaxial acceptor and T stems of the tRNA^Phe along the major groove, which results in the formation of a triplex. Long stems allow the formation of a sufficiently strong complex with the oligonucleotide, which delivers its 3′-terminal nucleotides to the vicinity of the T loop adjoining the stem. These nucleotides destabilize the loop structure and initiate conformational rearrangements involving local tRNA^Phe destruction and formation of the final tRNA^Phe-oligonucleotide complementary complex. The primary complex formation and the following tRNA^Phe destruction constitute the “molecular wedge” mechanism. An effective antisence oligonucleotide should consist of three segments—(1) complex initiator, (2) primary complex stabilizer, and (3) loop destructor—and be complementary to the (free end)/loop-stem-loop tRNA structural element.