Guanine tetraplex topology of human telomere DNA is governed by the number of (TTAGGG) repeats

Secondary structures of the G-rich strand of human telomere DNA fragments G₃(TTAG₃)_n, n = 1–16, have been studied by means of circular dichroism spectroscopy and PAGE, in solutions of physiological potassium cation concentrations. It has been found that folding of these fragments into tetraplexes as well as tetraplex thermostabilities and enthalpy values depend on the number of TTAG₃ repeats. The suggested topologies include, e.g. antiparallel and parallel bimolecular tetraplexes, an intramolecular antiparallel tetraplex, a tetraplex consisting of three parallel chains and one antiparallel chain, a poorly stable parallel intramolecular tetraplex, and both parallel and antiparallel tetramolecular tetraplexes. G₃(TTAG₃)₃ folds into a single, stable and very compact intramolecular antiparallel tetraplex. With an increasing repeat number, the fragment tetraplexes surprisingly are ever less thermostable and their migration and enthalpy decrease indicate increasing irregularities or domain splitting in their arrangements. Reduced stability and different topology of lengthy telomeric tails could contribute to the stepwise telomere shortening process.     

Circular dichroism spectroscopy of conformers of (guanine + adenine) repeat strands of DNA

(Guanine+adenine) strands of DNA are known to associate into guanine tetraplexes, homodimerize into parallel or antiparallel duplexes, and fold into a cooperatively melting single strand resembling the protein alpha helix. Using CD spectroscopy and other methods, we studied how this conformational polymorphism depended on the primary structure of DNA. The study showed that d(GGGA)(5) and d(GGA)(7) associated into homoduplexes at low salt or in the presence of LiCl but were prone to guanine tetraplex formation, especially in the presence of KCl. In addition, they yielded essentially the same CD spectrum in the presence of ethanol as observed with the ordered single strand of d(GA)(10). Strands of d(GA)(10), d(GGAA)(5), d(GAA)(7), and d(GAAA)(5) associated into homoduplexes in both LiCl and KCl solutions, but not into guanine tetraplexes. d(GAAA)(5) and d(GAA)(7) further failed to form the single-stranded conformer in aqueous ethanol. Adenine protonation, however, stabilized the single-stranded conformer even in these adenine-rich fragments. The ordered single strands, homoduplexes as well as the guanine tetraplexes, all provided strikingly similar CD spectra, indicating that all of the conformers shared similar base stacking geometries. The increasing adenine content only decreased the conformer thermostability.     

The fragile X chromosome (GCC) repeat folds into a DNA tetraplex at neutral pH

UV absorption and CD spectroscopy, along with polyacrylamide gel electrophoresis, were used to study conformational properties of DNA fragments containing the trinucleotide repeat (GCC)_n (n = 4, 8 or 16), whose expansion is correlated with the fragile X chromosome syndrome. We have found that the conformational spectrum of the (GCC)_n strand is wider than has been shown so far. (GCC)_n strands adopt the hairpin described in the literature under a wide range of salt concentrations, but only at alkaline (>7.5) pH values. However, at neutral and slightly acid pH (GCC)₄ and (GCC)₈ strands homodimerize. Our data suggest that the homodimer is a bimolecular tetraplex formed by two parallel-oriented hairpins held together by hemi-protonated intermolecular C·C⁺ pairs. The (GCC)₁₆ strand forms the same tetraplex intramolecularly. We further show that below pH 5 (GCC)_n strands generate intercalated cytosine tetraplexes, whose molecularity depends on DNA strand length. They are tetramolecular with (GCC)₄, bimolecular with (GCC)₈ and monomolecular with (GCC)₁₆. i-Tetraplex formation is a complex and slow process. The neutral tetraplex, on the other hand, arises with fast kinetics under physiological conditions. Thus it is a conformational alternative of the (GCC)_n strand duplex with a complementary (GGC)_n strand.     

The guanine-rich fragile X chromosome repeats are reluctant to form tetraplexes

Using circular dichroism spectroscopy, UV absorption spectroscopy and polyacrylamide gel electrophoresis, we studied conformational properties of guanine-rich DNA strands of the fragile X chromosome repeats d(GGC)_n, d(GCG)_n and d(CGG)_n, with n = 2, 4, 8 and 16. These strands are generally considered in the literature to form guanine tetraplexes responsible for the repeat expansion. However, we show in this paper that the repeats are reluctant to form tetraplexes. At physiological concentrations of either Na⁺ or K⁺ ions, the hexamers and dodecamers associate to form homoduplexes and the longer repeats generate homoduplexes and hairpins. The tetraplexes are rarely observed being relatively most stable with d(GGC)_n and least stable with d(GCG)_n. The tetraplexes are exclusively formed in the presence of K⁺ ions, at salt concentrations higher than physiological, more easily at higher than physiological temperatures, and they arise with extremely long kinetics (even days). Moreover, the capability to form tetraplexes sharply diminishes with the oligonucleotide length. These facts make the concept of the tetraplex appearance in this motif in vivo very improbable. Rather, a hairpin of the fragile X repeats, whose stability increases with the repeat length, is the probable structure responsible for the repeat expansion in genomes.     

Guanine tetraplex formation by short DNA fragments containing runs of guanine and cytosine.

Using CD spectroscopy, guanine tetraplex formation was studied with short DNA fragments in which cytosine residues were systematically added to runs of guanine either at the 5' or 3' ends. Potassium cations induced the G-tetraplex more easily with fragments having the guanine run at the 5' end, which is just an opposite tendency to what was reported for (G+T) oligonucleotides. However, the present (G+C) fragments simultaneously adopted other conformers that complicated the analysis. We demonstrate that repeated freezing/thawing, performed at low ionic strength, is a suitable method to exclusively stabilize the tetraplex in the (G+C) DNA fragments. In contrast to KCl, the repeated freeze/thaw cycles better stabilized the tetraplex with fragments having the guanine run on the 3' end. The tendency of guanine blocks to generate the tetraplex destabilized the d(G5).d(C5) duplex whose strands dissociated, giving rise to a stable tetraplex of (dG5) and single-stranded (dC5). In contrast to d(G3C3) and d(G5C5), repeated freezing/thawing induced the tetraplex even with the self-complementary d(C3G3) or d(C5G5); hence the latter oligonucleotides preferred the tetraplex to the apparently very stable duplex. The tetraplexes only included guanine blocks while the 5' end cytosines interfered neither with the tetraplex formation nor the tetraplex structure.     

Unpaired structures in SCA10 (ATTCT)n.(AGAAT)n repeats

A number of human hereditary diseases have been associated with the instability of DNA repeats in the genome. Recently, spinocerebellar ataxia type 10 has been associated with expansion of the pentanucleotide repeat (ATTCT)(n).(AGAAT)(n) from a normal range of ten to 22 to as many as 4500 copies. The structural properties of this repeat cloned in circular plasmids were studied by a variety of methods. Two-dimensional gel electrophoresis and atomic force microscopy detected local DNA unpairing in supercoiled plasmids. Chemical probing analysis indicated that, at moderate superhelical densities, the (ATTCT)(n).(AGAAT)(n) repeat forms an unpaired region, which further extends into adjacent A+T-rich flanking sequences at higher superhelical densities. The superhelical energy required to initiate duplex unpairing is essentially length-independent from eight to 46 repeats. In plasmids containing five repeats, minimal unpairing of (ATTCT)(5).(AGAAT)(5) occurred while 2D gel analysis and chemical probing indicate greater unpairing in A+T-rich sequences in other regions of the plasmid. The observed experimental results are consistent with a statistical mechanical, computational analysis of these supercoiled plasmids. For plasmids containing 29 repeats, which is just above the normal human size range, flanked by an A+T-rich sequence, atomic force microscopy detected the formation of a locally condensed structure at high superhelical densities. However, even at high superhelical densities, DNA strands within the presumably compact A+T-rich region were accessible to small chemicals and oligonucleotide hybridization. Thus, DNA strands in this "collapsed structure" remain unpaired and accessible for interaction with other molecules. The unpaired DNA structure functioned as an aberrant replication origin, in that it supported complete plasmid replication in a HeLa cell extract. A model is proposed in which unscheduled or aberrant DNA replication is a critical step in the expansion mutation.     

Conformational properties of DNA fragments containing GAC trinucleotide repeats associated with skeletal displasias

The human gene for cartilage oligomeric matrix protein contains five tandem repeats of the GAC trinucleotide. Its expansion by one repeat causes multiple epiphyseal dysplasia, while expansion by two repeats or, remarkably, deletion of one repeat causes pseudoachondroplasia. Here we used CD spectroscopy, PAGE and UV absorption spectroscopy to compare conformational properties of the DNA strands containing four, five, six and seven repeats of the GAC trinucleotide. The (GAC)n strands were found to form four distinct ordered conformations, depending on the solution conditions. The first was a foldback, stable at slightly alkaline pH values and low and medium ionic strengths. Increasing salt concentration induced a transition of the foldback into an antiparallel right-handed homoduplex. Both the conformers contained the Watson-Crick G.C pairs while the intervening adenines contributed little to their B-like conformation. Thirdly, the strands associated into a parallel homoduplex stabilized by the hemiprotonated C+.C pairs and by the GpA steps that both favor the parallel DNA strand orientation. The parallel homoduplex was stable even at neutral pH. The fourth conformation was the left-handed Z-DNA, which formed easier with (GAC)n than with (GC)n of comparable length, indicating that the adenines of (GAC)n promoted the left-handed duplex. The paper shows that stability of the above four conformers strongly depends on the GAC repeat number.     

Secondary structure and dynamics of the r(CGG) repeat in the mRNA of the fragile X mental retardation 1 (FMR1) gene.

The CGG triplet repeat found within the 5'UTR of the FMR1 gene is involved in the pathogenesis of both fragile X syndrome and fragile X-associated tremor/ataxia syndrome (FXTAS). The repeat has been shown to form both hairpins and tetraplexes in DNA; however, the secondary structure of CGG-repeat RNA has not been well defined. To this end, we have performed NMR spectroscopy on in vitro transcribed CGG-repeat RNAs and see clear evidence of intramolecular hairpins, with no evidence of tetraplex structures. Both C*G and G*G base pairs form in the hairpin stem, though in a dynamic equilibrium of conformations. In addition, we investigated the effect of an AGG repeat interruption on hairpin stability; such interruptions are often interspersed within the CGG repeat element and are thought to modulate secondary structure of the RNA. While the AGG repeat lowers the Tm of the hairpin at low Mg2+ concentrations, this difference disappears at physiological Mg2+ levels.     

Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881-15890). Blunt-ended and 3'-tailed or 3'- and 5'-tailed bimolecular tetraplex structures of d(CGG)(n) and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg(2+)-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG)(n) in the presence of K(+) or Na(+) ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG)(n) by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.     

Tetraplex folding of telomere sequences and the inclusion of adenine bases.

Telomeres are required for eukaryotic chromosome stability. They consist of regularly repeating guanine-rich sequences, with a single-stranded 3' terminus. Such sequences have been demonstrated to have the propensity to adopt four-stranded structures based on a tetrad of guanine bases. The formation of an intramolecular foldback tetraplex is associated with markedly increased mobility in polyacrylamide. Most telomeric sequences are based either on a repeat of d(TnGGGG) or d(TnAGGG) sequences. We have used a combination 7-deazaguanine or 7-deaza-adenine substitution, chemical modification and gel electrophoresis to address the following aspects of intramolecular tetraplex formation. (i) Intramolecular tetraplex formation by d(TTTTGGGG)4 sequences is prevented by very low levels of 7-deazaguanine substitution. This confirms the important role of guanine N7 in the formation of the tetraplex. (ii) The sequences d(TTAGGG)4 and d(TTTTAGGG)4 fold into tetraplexes. By contrast, the electrophoretic behaviour of d(TTTTGGGA)4, d(TTTTAGAG)4 and d(TTTTGAGA)4 does not indicate formation of stable intramolecular tetraplexes under available conditions. (iii) Selective 7-deazaguanine and 7-deaza-adenine substitutions in d(TTTTAGGG)4 give results consistent with tetraplex folding by the formation of three G4 tetrads, with the adenine bases formally part of the single-stranded loops, where they probably interact with thymine bases. These results demonstrate that eukaryotic cells appear to have selected just those sequences that can adopt the tetraplex conformation for their telomeres, while those that cannot have been avoided. This suggests that the conformation may be significant in the function of the telomere, such as attachment to nuclear structures.     

Intercalated cytosine motif and novel adenine clusters in the crystal structure of the Tetrahymena telomere.

The cytosine-rich strand of the Tetrahymena telomere consists of multiple repeats of sequence d(AACCCC). We have solved the crystal structure of the crystalline repeat sequence at 2.5 A resolution. The adenines form two different and previously unknown clusters (A clusters) in orthogonal directions with their counterparts from other strands, each containing a total of eight adenines. The clusters appear to be stable aggregates held together by base stacking and three different base-pairing modes. Two different types of cytosine tetraplexes are found in the crystal. Each four-stranded complex is composed of two intercalated parallel-stranded duplexes pointing in opposite directions, with hemiprotonated cytosine-cytosine (C.C+) base pairs. The outermost C.C+base pairs are from the 5'-end of each strand in one cytosine tetraplex and from the 3'-end of each strand in the other. The A clusters and the cytosine tetraplexes form two alternating stacking patterns, creating continuous base stacking in two perpendicular directions along the x - and z -axes. The adenine clusters could be organizational motifs for macromolecular RNA.     

Small-molecule ligand induces nucleotide flipping in (CAG)n trinucleotide repeats

DNA trinucleotide repeats, particularly CXG, are common within the human genome. However, expansion of trinucleotide repeats is associated with a number of disorders, including Huntington disease, spinobulbar muscular atrophy and spinocerebellar ataxia. In these cases, the repeat length is known to correlate with decreased age of onset and disease severity. Repeat expansion of (CAG)n, (CTG)n and (CGG)n trinucleotides may be related to the increased stability of alternative DNA hairpin structures consisting of CXG-CXG triads with X-X mismatches. Small-molecule ligands that selectively bound to CAG repeats could provide an important probe for determining repeat length and an important tool for investigating the in vivo repeat extension mechanism. Here we report that napthyridine-azaquinolone (NA, 1) is a ligand for CAG repeats and can be used as a diagnostic tool for determining repeat length. We show by NMR spectroscopy that binding of NA to CAG repeats induces the extrusion of a cytidine nucleotide from the DNA helix.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Informativeness of human (dC-dA)n.(dG-dT)n polymorphisms

Abundant human interspersed repetitive DNA sequences of the form (dC-dA)n.(dG-dT)n have been shown to exhibit length polymorphisms. Examination of over 100 human (dC-dA)n.(dG-dT)n sequences revealed that the sequences differed from each other both in numbers of repeats and in repeat sequence type. Using a set of precise classification rules, the sequences were divided into three categories: perfect repeat sequences without interruptions in the runs of CA or GT dinucleotides (64% of total), imperfect repeat sequences with one or more interruptions in the run of repeats (25%), and compound repeat sequences with adjacent tandem simple repeats of a different sequence (11%). Informativeness of (dC-dA)n.(dG-dT)n markers in the perfect sequence category was found to increase with increasing average numbers of repeats. PIC values ranged from 0 at about 10 or fewer repeats to above 0.8 for sequences with about 24 or more repeats. (dC-dA)n.(dG-dT)n polymorphisms in the imperfect sequence category showed lower informativeness than expected on the basis of the total numbers of repeats. The longest run of uninterrupted CA or GT repeats was found to be the best predictor of informativeness of (dC-dA)n.(dG-dT)n polymorphisms regardless of the repeat sequence category.     

Over-representation of the disease associated (CAG) and (CGG) repeats in the human genome.

Expansion of trimer repeats has recently been described as a new type of human mutation. Of the 64 possible trimer compositions, only the CGG and CAG repeats have been implicated in genetic diseases. This study intends to address two questions: (1) What makes the CGG and CAG repeats unique? (2) Could other trimer repeats be involved in this type of mutation? By computer analysis of trimer and hexamer frequency distributions in approximately 10 Mb of human DNA, twenty trimer motifs (ten complementary pairs) have been identified that are the most likely to be expanded. The frequency distribution study also indicated that the expanded trimer motif in Fragile-X syndrome is GGC instead of CGG. DNA linguistics studies revealed that the GGC/GCC and CAG/CTG repeats were over-represented in the human genome. Further analysis of base composition suggested that the CCA/TGG repeats may be involved in the trimer expansion mutation since they possessed many similar characteristics to GGC/GCC and CAG/CTG. The computer aided sequence analysis studies reported here may help to understand the molecular mechanisms of trimer repeat expansion.     

Variable (dG-dT)n.(dC-dA)n sequences in the porcine genome.

One of the more widely studied simple repeat sequences in the mammalian genome is the (dG-dT)n.(dC-dA)n dinucleotide repeat sequence. As these repeats are highly polymorphic and fairly evenly distributed in diverse mammalian genomes, they constitute a very powerful tool for genetic mapping in a wide variety of species. So far, the knowledge about repeat sequences in the porcine genome is sparse and only a few areas of this genome have been sequenced. We have isolated and characterized 108 porcine (dG-dT)n.(dC-dA)n sequences and studied the distribution of these, both by investigating random clones and by performing in situ hybridization. A remarkable correlation between humans and pigs was found with respect to the structure, to the number of repeat blocks, and to the chromosomal distribution.     

Isoguanine quartets formed by d(T4isoG4T4): tetraplex identification and stability.

The self-aggregation of the oligonucleotide d(T4isoG4T4) (1) is investigated. Based on ion exchange HPLC experiments and CD spectroscopy, a tetrameric structure is identified. This structure was formed in the presence of sodium ions and shows almost the same chromatographic mobility on ion exchange HPLC as d(T4G4T4) (2). The ratio of aggregate versus monomer is temperature dependent and the tetraplex of [d(T4isoG4T4)]4 is more stable than that of [d(T4G4T4)]4. A mixture of d(T4isoG4T4) and d(T4G4T4) forms mixed tetraplexes containing strands of d(T4isoG4T4) and d(T4G4T4).     

Structural analysis of slipped-strand DNA (S-DNA) formed in (CTG)n. (CAG)n repeats from the myotonic dystrophy locus.

The mechanism of disease-associated trinucleotide repeat length variation may involve slippage of the triplet-containing strand at the replication fork, generating a slipped-strand DNA structure. We recently reported formation in vitro of slipped-strand DNA (S-DNA) structures when DNAs containing triplet repeat blocks of myotonic dystrophy or fragile X diseases were melted and allowed to reanneal to form duplexes. Here additional evidence is presented that is consistent with the existence of S-DNA structures. We demonstrate that S-DNA structures can form between two complementary strands containing equal numbers of repeats. In addition, we show that both the propensity for S-DNA formation and the structural complexity of S-DNAs formed increase with increasing repeat length. S-DNA structures were also analyzed by electron microscopy, confirming that the two strands are slipped out of register with respect to each other and confirming the structural polymorphism expected within long tracts of trinucleotide repeats. For (CTG)50.(CAG)50 two distinct populations of slipped structures have been identified: those involving </=10 repeats per slippage, which appear as bent/kinked DNA molecules, and those involving >10 repeats, which have multiple loops or hairpins indicative of complex alternative DNA secondary structures.     

Tetraplex structure of fission yeast telomeric DNA and unfolding of the tetraplex on the interaction with telomeric DNA binding protein Pot1

To understand the regulation mechanism of fission yeast telomeric DNA, we analysed the structural properties of Gn: d(GnTTAC) (n=2-6) and 4Gn: d(GnTTAC)4 (n=3 and 4), and their interaction with the single-stranded telomeric DNA binding domain of telomere-binding protein Pot1 (Pot1DBD). G4, G5 and G6 formed a parallel tetraplex in contrast with no tetraplex formation by G2 and G3. Also, 4G4 adopted only an antiparallel tetraplex in spite of a mixture of parallel and antiparallel tetraplexes of 4G3. The variety of tetraplex structures was governed by the number of consecutive guanines in a single copy and the number of repeats. The antiparallel tetraplex of 4G4 became unfolded upon the interaction with Pot1DBD. The interaction with mutant Pot1DBD proteins revealed that the ability to unfold the antiparallel tetraplex was strongly correlated with the specific binding affinity for the single-stranded telomeric DNA. The result suggests that the decrease in the free single strand upon the complex formation with Pot1DBD may shift the equilibrium from the tetraplex to the single strand, which may cause the tetraplex unfolding. Considering that the antiparallel tetraplex inhibits telomerase-mediated telomere elongation, we conclude that the ability of Pot1 to unfold the antiparallel tetraplex is required for telomerase-mediated telomere regulation.     

(TG:CA)(n) repeats in human housekeeping genes

The unravelling of human genome sequence gives a new opportunity to investigate the role of repetitive sequences in gene regulation. Among the various types of repetitive sequences, the dinucleotide (TG:CA)(n) repeats are one of the most abundant in human genome and exhibit polymorphism. Early on, it was observed that the (TG:CA)(n) repeats could modulate gene expression and has the propensity to undergo conformational transitions in in vivo conditions. Recent reports describe the role of polymorphic (TG:CA)(n) repeats in gene regulation in several genes. In this work, we have analysed the distribution of (TG:CA)(n) (n >or= 6) repeats in human 'housekeeping genes' on which recently released Gene Chip data is available. Our results indicate that (i). The number of short intragenic (TG:CA)(n) repeats is significantly higher than the number of long repeats (ii). the proportion of genes with (TG:CA)(n) repeats (n >or= 12 units) had lower mean expression levels compared to those without these repeats, (iii). the genes belonging to the functional class of 'signalling and communication' had a positive association with repeats in contrast to the genes belonging to the 'information' class that were negatively associated with repeats.