Physical Map of the Channel Catfish Virus Genome: Location of Sites for Restriction Endonucleases EcoRI, HindIII, HpaI, and XbaI

The overall arrangement of nucleotide sequences in the DNA of channel catfish virus has been studied by cleavage with four restriction endonucleases. Physical maps have been developed for the location of sites for EcoRI, HindIII, HpaI, and XbaI. The sum of the molecular weights of fragments generated by each restriction enzyme indicates a molecular weight of approximately 86 × 10⁶ for the channel catfish virus genome. Fragments corresponding to the molecular ends of channel catfish virus DNA have been identified by their sensitivity to exonuclease treatment. The distribution of restriction sites in the genome shows that sequences included in a 12 × 10⁶-molecular weight region at one end are repeated with direct polarity at the other end, and that the overall genomic sequence order is nonpermuted.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.     

DNA of herpesvirus pan, a third member of the Epstein-Barr virus-Herpesvirus papio group

The DNA of herpesvirus pan, a primate B-lymphotropic herpesvirus, shares about 40% well-conserved sequence relatedness with Epstein-Barr virus (EBV) and herpesvirus papio DNAs. Labeled cloned fragments from the EBV recombinant DNA library were cross hybridized to blots of EcoRI, XbaI, and BamHI restriction endonuclease fragments of herpesvirus pan DNA to identify and map homologous sequences in the herpesvirus pan genome. Regions of colinear homology were demonstrated between 6 x 10(6) daltons and 108 x 10(6) daltons in the DNAs. The structural organization of herpesvirus pan DNA was similar to the format of Epstein-Barr virus and herpesvirus papio DNAs. The DNA consists of two domains of largely unique sequence complexity, a segment US of 9 x 10(6) daltons and a segment UL of 88 x 10(6) daltons. US and UL are separated by a variable number of tandem repetitions of a sequence IR (2 x 10(6) daltons). There was homology between DNA which mapped at 26 to 28 x 10(6) daltons and 93 to 95 x 10(6) daltons in UL. The terminal reiteration component, TR, of herpesvirus pan DNA and sequences which mapped to the left of 6 x 10(6) daltons and to the right of 108 x 10(6) daltons had no detectable homology with the corresponding regions of Epstein-Barr virus DNA.     

Physical maps for Herpes simplex virus type 1 DNA for restriction endonucleases Hind III, Hpa-1, and X. bad.

It has been proposed that the genome of herpes simplex virus type 1 (HSV-1) consists of two internal unique sequences, S and L, bounded by two sets of redundant sequences (P. Sheldrick and N. Berthelot, 1974). In this arrangement, terminal sequences (TRs and TRl) are repeated in an internal inverted form (IRs and IRl) and delimit S and L. Furthermore, a body of evidence has accumulated that suggests that S and L themselves are inverted, giving rise to four related forms of the HSV genome. In this study the ordering of restruction endonuclease fragments of HSV-1 DNA for physical maps has been studied using molecular hybridization techniques and the cleavage of isolated restriction endonuclease fragments with further restriction endonucleases. Physical maps for the fragments produced by Hind III, Hpa-1, and X. bad have been constructed for the four related forms of the HSV-1 genome. TRs and IRs were found to be between 3.5 x 10(6) and 4.5 x 10(6) daltons, TRl and IRl about 6 x 10(6) daltons, S about 8 x 10(6) to 9 x 10(6) daltons, and L about 6.8 x 10(6) daltons.     

Use of a restriction endonuclease in analyzing the genomes from two different strains of vaccinia virus.

A restriction endonuclease from Haemophilus influenzae (Hind III) specifically cleaved vaccinia DNA into 14 fragments. The molecular weights of these fragments were determined by gel electrophoresis and ranged from 0.5 x 10(6) to 30 x 10(6). Hind III digestion of the DNA from the WR and CV-1 strains of vaccinia revealed a small molecular difference in one of the resulting fragments. The average molecular weight of the entire vaccinia genome was calculated to be 125 x 10(6).     

Anatomy of bovine mammillitis DNA II. Size and arrangements of the deoxynucleotide sequences.

We previously reported that bovine mammillitis virus (BMV) DNA consists of two covalently linked components designated L and S and estimated to be 71.5 x 10(6) and 15.7 x 10(6) in molecular weight, respectively; the components invert relative to each other, giving rise to four equimolar populations differing soley in the relative orientation of the two components. We now report that (i) BMV DNA has a contour length corresponding to a molecular weight of 89 x 10(6). (ii) Component L consists of a unique sequence (Ul) bracketed by sequences ab and its inverted repeat b'a', estimated to be of molecular weights 66.1 x 10(6), 2.7 x 10(6), and 2.7 x 10(6), respectively. (iii) Component S consists of a unique sequence (Us) bracketed be sequence ca and its inverted repeat a'c', estimated to be of molecular weights 8.3 x 10(6), 3.7 x 10(6), and 3.7 x 10(6), respectively. (iv) The a sequences present at the termini of a complete linear molecule (abUlb'a'a'c'Usca) are arranged in tandem so that the DNA can circularize after limited digestion with arranged in tandem so that the DNA can circularize after limited digestion with lambda 5'-exonuclease. The size of the a sequences was estimated to be 0.7 x 10(6) in molecular weight. (v) At least portions of the a sequences are repeated in an inverted orientation immediately adjacent to or near the a sequence. Thus, BMV DNA mimics herpes simplex virus type 1 DNA with respect to the arrangement but not size of deoxynucleotide sequences. The evolutionary relationship of BMV DNA relative to other herpesvirus DNAs is discussed.     

Construction of a cloned library of the EcoRI fragments from the human cytomegalovirus genome (strain AD169).

The DNA genome of human cytomegalovirus (HCMV) strain AD169 is 158 x 10(6) Mr. Cleavage of the HCMV DNA with the restriction endonuclease EcoRI yields 35 major fragments ranging in size from 0.54 x 10(6) Mr. We have constructed a cloned library of the EcoRI fragments of this strain of HCMV, using the plasmid pACYC184 and the recipient bacterium Escherichia coli strain HB101 RecA-. The viral origin of the cloned inserts was determined by hybridization to viral DNA. The fragments were characterized further by digestion with other restriction enzymes. Several clones were obtained which contained sequences spanning the junction between the long (L) and short (S) components of the viral DNA sequences. These clones differed in molecular weight by multiples of 0.3 x 10(6) to 0.4 x 10(6) Mr. The variability found in the clones was also reflected in the genome. Each clone containing a junction sequence hybridized to a series of bands on Southern filters of EcoRI-digested HCMV DNA. This "ladder effect" provided evidence for a region of heterogeneity within the L-S junction.     

Anatomy of Bovine Mammillitis DNA I. Restriction Endonuclease Maps of Four Populations of Molecules That Differ in the Relative Orientation of Their Long and Short Components

In this paper, we report that the DNA of bovine mammillitis virus (BMV) consists of two covalently linked components that are 71.5 x 10(6) and 15.7 x 10(6) in molecular weight and designated L and S, respectively. We further report that the BMV DNA consists of four equimolar populations differing only in the orientation of the L and S components relative to each other. This conclusion is based on the following: (i) The sum molecular weight of fragments generated by digestion of BMV DNA with Hsu I, Hpa I, Bgl II, or Xba I significantly exceeds the established molecular weight of the intact DNA. (ii) In each digest, the fragments form three groups differing in molar concentration. In reference to the molar concentration of intact DNA, each enzyme digest contained a set of four fragments 0.25 M in concentration, a set of four fragments 0.5 M in concentration, and a variable size set, unique for each enzyme digest, 1.0 M in concentration. (iii) Experiments involving digestion of intact DNA by lambda exonuclease followed by restriction endonuclease digestion established that each of four 0.5 M fragments were positioned at the termini of the BMV DNA. (iv) Complete maps for the fragments generated by each enzyme established that the 0.25 M fragments arise by fusion of the sequences of the terminal fragments when these are juxtaposed as a consequence of the inversion of L and S components. The maps also established the dimensions of the L and S components. We conclude that the structure of BMV DNA is similar to that of HSV DNA previously shown to consist of two unequal size components that invert relative to each other.     

Genome organization of RNA tumor viruses II. Physical maps of in vitro-synthesized Moloney murine leukemia virus double-stranded DNA by restriction endonucleases.

Physical maps of the genome of Moloney murine leukemia virus (M-MLV) DNA were constructed by using bacterial restriction endonucleases. The in vitro-synthesized M-MLV double-stranded DNA was used as the source of the viral DNA. Restriction endonucleases Sal I and Hind III cleave viral DNA at only one site and, thus, generate two DNA fragments. The two DNA fragments generated by Sal I are Sal IA (molecular weight, 3.5 x 10(6)) and Sal IB (molecular weight, 2.4 x 10(6)) and by Hind III are Hind IIIA (molecular weight, 3.6 x 10(6) and Hind IIIB (molecular weight, 2.3 x 10(6)). Restriction endonuclease Bam I generates four fragments of molecular weights of 2.1 x 10(6) (Bam IA), 2 X 10(6) (Bam IB), 1.25 X 10(6) (Bam IC), and 0.24 x 10(6) (Bam ID), whereas restriction endonuclease Hpa I cleaves the M-MLV double-stranded DNA twice to give three fragments of molecular weights of 4.4 x 10(6) (Hpa IA), 0.84 X 10(6) (Hpa IB), and 0.74 x 10(6) (Hpa IC). Digestion of M-MLV double-stranded DNA with restriction endonuclease Sma I produces four fragments of molecular weights of 3.9 x 10(6) (Sma IA), 1.3 X 10(6) (Sma IB), 0.28 X 10(6) (Sma IC), and 0.21 x 10(6) (Sma ID). A mixture of restriction endonucleases Bgl I and Bgl II (Bgl I + II) cleaves the viral DNA at four sites generating five fragments of approximate molecular weights of 2 x 10(6) (Bgl + IIA), 1.75 X 10(6) (Bgl I + IIB), 1.25 X 10(6) (Bgl I + IIC), 0.40 X 10(6) (Bgl I + IID), and 0.31 x 10(6) (Bgl I + IIE). The order of the fragments in relation to the 5' end and 3' end of the genome was determined either by using fractional-length M-MLV double-stranded DNA for digestion by restriction endonucleases or by redigestion of Sal IA, Sal IB, Hind IIIA, and Hind IIIB fragments with other restriction endonucleases. In addition, a number of other restriction endonucleases that cleave in vitro-synthesized M-MLV double-stranded DNA have also been listed.     

Molecular Weight of Two Oncornavirus Genomes: Derivation from Particle Molecular Weights and RNA Content

Sedimentation analysis and intensity fluctuation spectroscopy have been used in conjunction with the Svedberg equation to determine the particle molecular weights of Rous sarcoma virus (Prague strain) and avian myeloblastosis virus (BAI strain). The molecular weights of these two viruses are (294 +/- 20) x 10(6) and (256 +/- 18) x 10(6), respectively. Values for the molecular weight of the RNA contained in each particle have been calculated as (5.58 +/- 0.5) x 10(6) and (5.88 +/- 0.5) x 10(6). Since the proportion of the viral RNA represented by 4 to 7S low-molecular-weight material is known, the molecular weight of the 60 to 70S genomes may be calculated to lie in the range (3.8 +/- 0.3 to 4.8 +/- 0.4) x 10(6) for both particles. These estimates for the molecular weight of the 60 to 70S genome are much lower than previous estimates and fall within the range of current estimates of the size of a single 35S subunit. The implications of this finding are discussed in terms of current theories for the structure of the genome of RNA tumor viruses.     

Cloning of the human cytomegalovirus genome as endonuclease XbaI fragments

Restriction enzyme XbaI DNA fragments that represent 99% of the sequences from the long and short unique as well as the repeat sequences of the human cytomegalovirus (CMV) genome have been cloned into bacterial plasmid pACYC184. The viral DNA sequences associated with the recombinant plasmids were analyzed by restriction mapping and by hybridization to fragments of authentic viral DNA. The relationship of the cloned viral DNA fragments to the XbaI physical map of the viral genome is demonstrated. Even though large recombinant plasmids ranging from approx. 39 to 1.8 kb were isolated, most if not all of the viral DNA fragments were stable during propagation in Escherichia coli HB101.     

Characterization of the guinea pig cytomegalovirus genome by molecular cloning and physical mapping.

Fragments of guinea pig cytomegalovirus (GPCMV) DNA produced by HindIII or EcoRI restriction endonuclease digestion were cloned into vectors pBR322 and pACYC184, and recombinant fragments representing ca. 97% of the genome were constructed. Hybridization of 32P-labeled cloned and gel-purified HindIII, EcoRI, and XbaI fragments to Southern blots of HindIII-, EcoRI-, and XbaI-cleaved GPCMV DNA verified the viral origin of cloned fragments and allowed construction of HindIII, EcoRI, and XbaI restriction maps. On the basis of the cloning and mapping experiments, the size of GPCMV DNA was calculated to include 239 kilobase pairs, corresponding to a molecular weight of 158 X 10(6). No cross-hybridization between any internal fragments was seen. We conclude that the GPCMV genome consists of a long unique sequence with terminal repeat sequences but without internal repeat regions. In addition, GPCMV DNA molecules exist in two forms. In the predominant form, the molecules demonstrate sequence homology between the terminal fragments; in the minor population, one terminal fragment is smaller by 0.7 X 10(6) daltons and is not homologous with the fragment at the other end of the physical map. The structural organization of GPCMV DNA is unique for a herpesvirus DNA, similar in its simplicity to the structure reported for murine cytomegalovirus DNA and quite dissimilar from that of human cytomegalovirus DNA.     

A restriction map of cauliflower mosaic virus DNA (strain PV 147). Mapping of the cleavage sites of HhaI, SacI, AvaI, PvuII, PstI, XbaI, EcoRI, Bg/II, HincII, HpaII and HindII + III.

The virion-extracted DNA (Mr5 x 10(6)) of cauliflower mosaic virus (CaMV) has three single-stranded interruptions. The mapping of this DNA using eleven restriction endonucleases (HhaI, SacI, AvaI, PvuII, PstI, XbaI, EcoRI, Bg/II, HincII, HpaII and HindII + III) is reported here. The existence of the three single-stranded breaks complicates the identification and the molecular weight determination of fragments produced by HpaII, HindIII and HindII + III. Indeed the electrophoretic mobility of some fragments in which a single-stranded discontinuity is located is modified, and the fluorescence of ethidium bromide complexed with these fragments is reduced as compared to that observed for the other fragments existing in a molar ratio. These drawbacks were overcome by performing experiments of nick-translation of CaMV DNA with Escherichia coli DNA polymerase I. FRom the data it follows that the CaMV DNA molecule bears bears 1 site for HhaI and SacI, 2 for AvaI and PvuII, 3 for PstI, 4 for XbaI, 5 for EcoRI, 6 for Bg/II and HincII, 11 for HpaII and 15 for HindII + III. The corresponding fragments have all been ordered and precisely located providing a suitable map for further investigations connected with the study of the fine structure and the function of the CaMV genome.     

Cleavage maps for human cytomegalovirus DNA strain AD169 for restriction endonucleases EcoRI, BglII, and HindIII.

We have used cloned EcoRI fragments of the human CMV (HCMV) genome, strain AD169, to prepare restriction endonuclease maps of the DNA. Individual 32P-labeled cloned fragments were hybridized to Southern blots of HCMV DNA cleaved to completion with the restriction endonucleases BglII and HindIII and cleaved partially with EcoRI. By determining which EcoRI fragments hybridized to the same band on a Southern blot, we were able to establish linkage groups. This information coupled with the data derived from digestion of the cloned fragments with the enzymes BglII and HindIII (Tamashiro et al., J. Virol. 42:547-557, 1982) provided the basis for the construction of detailed maps for the enzymes EcoRI, BglII, and HindIII. We also identified the EcoRI fragments derived from the termini of this genome and mapped them with respect to the BglII and HindIII terminal fragments. From our mapping data, we conclude that the genome of HCMV is approximately 240 kilobases in length and is divided into long (198 kilobases) and short (42 kilobases) regions. Both regions consist of a unique sequence bounded by inverted repeats (11 to 12 kilobases for the long region and 2 to 3 kilobases for the short region). Furthermore, the long and short regions can invert relative to each other.     

Structure of Herpesvirus saimiri genomes: arrangement of heavy and light sequences in the M genome.

Herpesvirus saimiri contains two species of DNA molecules. (i) The M genome is composed of 70% light (L) DNA (36% cytosine plus guanine; density in CsCl, 1.695 g/ml), which consists of unique sequences, and 30% heavy (H) DNA (71% cytosine plus guanine; density, 1.729 g/ml). (ii) The H genome contains heavy sequences exclusively. H sequences in M and H genomes cross-hybridize completely and are cleaved identically by restriction endonuclease R-Sma I into four classes of fragments with molecular weights of about 360,000, 300,000, 130,000 and 40,000, respectively. H sequences are chains of identical repeat units in tandem arrangement. The molecular weight of each repeat unit is about 830,000. L sequences have no cleavage site for endo R-Sma I H sequences are terminally arranged at both ends of the M genome, as seen by electron microscopy after partial denaturation. The length of the individual heavy ends varies between 21 mum and less than 1 mum, whereas the light region is uniform in size (35.3+/-0.35 mum). As a rule, molecules with a long heavy end at one side have a short heavy end at the other side, thus giving rise to a limited size heterogeneity. Orientation of M DNA molecules by the denaturation map of the light region shows that the longer heavy end may be located at the left or at the right side of the M genome.     

Molecular cloning of herpes simplex virus type 2 DNA

Restriction enzyme HindIII digestion of the whole genome of herpes simplex virus type 2 strain 186 yielded 10 DNA fragments with molecular weights ranging from approximately 22 X 10(6) to 1.2 X 10(6), which were cloned into the HindIII site of bacterial plasmid pACYC 184. The cloned fragments were identified by hybridization to HSV-2 virus DNA and by double digestion with restriction endonucleases. The recombinant plasmids, even if they carried DNA sequences with molecular weights of more than 10(7), were efficiently replicated in E. coli HB101.     

DNA nucleotide sequence heterogeneity between the Towne and AD169 strains of cytomegalovirus.

The results of reciprocal DNA-DNA reassociation kinetics indicated that although the DNAs of human cytomegalovirus (CMV) strains Towne and AD169 shared approximately 90% of their nucleotide sequences, about 10% heterogeneity did exist. The implication was that, with respect to one another, the DNAs of CMV Towne and CMV AD169 contained unique nucleotide sequences. To obtain more direct evidence, 32P-labeled DNA of one virus strain was reassociated in the presence of excess unlabeled DNA of the heterologous virus strain. Those 32P-labeled DNA sequences remaining single stranded were separated from double-stranded DNA on hydroxyapatite columns and incubated with Southern blots containing XbaI restriction enzyme fragments of the homologous virus DNA. This approach not only enriched for nucleotide sequences unique to each strain of virus, but also provided for the identification of the restriction enzyme fragments in which the unique sequences were contained. The CMV Towne unique sequences were found in XbaI fragments A, C, G, L, N, and Q of CMV Towne DNA. The CMV AD169 unique sequences were found in XbaI fragments A, C, G, and J of CMV AD169 DNA. The possible significance of these data with respect to variation among other CMV isolates is discussed.