The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

Spectroscopic studies on the interaction of riboflavin with bovine serum albumin

The mechanism of interaction of riboflavin (RF) with bovine serum albumin (BSA) using fluorometric and circular dichroism (CD) methods has been reported. The association constant (K) for RF-BSA binding shows that the interaction is non-covalent in nature. Stern-Volmer analysis of fluorescence quenching data shows that the fraction of fluorophore (BSA) accessible to the quencher (RF) is close to unity, indicating that both tryptophan residues of BSA are involved in the interaction. The high magnitude of rate constant for quenching kq (10(13) M(-1) s(-1) indicates that RF binding site is in close proximity to tryptophan residue of BSA. Thermodynamic parameters obtained from data at different temperatures showed that the binding of RF to BSA predominantly involves the formation of hydrophobic bonds. Binding studies in the presence of a hydrophobic probe 8-anilino-1-naphthalene sulphonic acid, sodium salt (ANS) showed that RF and ANS do not share common sites in BSA. The small decrease in critical micellar concentration of anionic surfactant, sodium dodecyl sulphate in the presence of RF shows that ionic character of RF also contributes to binding and is not solubilized inside the micelle. Significant decrease in concentration of free RF has been observed in the presence of paracetamol. The CD spectrum shows the binding of RF leads to a change in the alpha helical structure of BSA.     

Study of the interaction of artemisinin with bovine serum albumin

The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant K_q, K_sv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol⁻¹ and 107.419 J mol⁻¹ K⁻¹ using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA.     

Luminescence,circular dichroism and in silico studies of binding interaction of synthesized naphthylchalcone derivatives with bovine serum albumin

Chalcones possess various biological properties, for example, antimicrobial, anti‐inflammatory, analgesic, antimalarial, anticancer, antiprotozoal and antitubercular activity. In this study, naphthylchalcone derivatives were synthesized and characterized using ¹H NMR ¹³C NMR, Fourier transform infrared and mass techniques. Yields for all derivatives were found to be >90%. Protein–drug interactions influence the absorption, distribution, metabolism and excretion (ADME) properties of a drug. Therefore, to establish whether the synthesized naphthylchalcone derivatives can be used as drugs, their binding interaction toward a serum protein (bovine serum albumin) was investigated using fluorescence, circular dichroism and molecular docking techniques under physiological conditions. Fluorescence quenching of the protein in the presence of naphthylchalcone derivatives, and other derived parameters such as association constants, number of binding sites and static quenching involving confirmed non‐covalent binding interactions in the protein–ligand complex were observed. Circular dichroism clearly showed changes in the secondary structure of the protein in the presence of naphthylchalcones, indicating binding between the derivatives and the serum protein. Molecular modelling further confirmed the binding mode of naphthylchalcone derivatives in bovine serum albumin. A site‐specific molecular docking study of naphthylchalcone derivatives with serum albumin showed that binding took place primarily in the aromatic low helix and then in subdomain II. The dominance of hydrophobic, hydrophilic and hydrogen bonding was clearly visible and was responsible for stabilization of the complex.     

Fluorescence spectrometric study on the interaction of tamibarotene with bovine serum albumin

The interaction between tamibarotene and bovine serum albumin (BSA) was studied using fluorescence quenching technique and ultraviolet–visible spectrophotometry. The results of experiments showed that tamibarotene could strongly quench the intrinsic fluorescence of BSA by a dynamic quenching mechanism. The apparent binding constant, number of binding site and corresponding thermodynamic parameters at different temperatures were calculated respectively, and the main interaction force between tamibarotene and BSA was proved to be hydrophobic force. Synchronous fluorescence spectra showed that tamibarotene changed the molecular conformation of BSA. When BSA concentration was 1.00 × 10^?6 mol L^?1, the quenched fluorescence ΔF had a good linear relationship with the concentration of tamibarotene in the range 1.00 × 10^?6 to 12.00 × 10^?6 mol L^?1 with the detection limit of 6.52 × 10^?7 mol L^?1. Copyright © 2010 John Wiley & Sons, Ltd.     

Studies on the interaction between tetraphenylporphyrin compounds and bovine serum albumin.

The interaction of three porphyrin compounds with bovine serum albumin (BSA) was examined by fluorescence emission spectra at the excitation wavelength 280 nm and in UV-Vis absorption spectra. Through fluorescence quenching experiments, it was confirmed that the combination of three porphyrin compounds with BSA was a single static quenching process. The binding constant K(A), the thermodynamic parameters enthalpy change (DeltaH(0)), Gibbs free energy change (DeltaG(0)) and entropy change (DeltaS(0)) were obtained. It was found that hydrophobic interaction played a main role in tetraphenylporphyrin (TPP) or tetraparacholophenylporphyrin (TClPP) binding to BSA, while tetraparamethoxyphenylporphyrin (TMEOPP) mainly based on van der Waals' force. According to F?ster energy transfer, the separate distance r, the energy transfer efficiency E and F?ster radium R(0) were calculated. The results obtained from the above experiments showed that three porphyrin compounds were tightly bound to BSA.     

Spectroscopic study of the interaction of gossypol with bovine serum albumin

The interaction of gossypol with bovine serum albumin (BSA) at pH 7.6 in 0.02 M borax-borate buffer has been followed by circular dichroism (CD) and difference spectroscopy. From the extrinsic CD band at 390 nm, a binding constant of 2.7 X 10(3) M-1 was calculated. At 54 degrees the induced CD spectrum was abolished, suggesting that the interaction is not favoured at that temperature. The effect of various solvents and salts on the interaction has been followed by difference spectroscopy. The modification of epsilon-amino groups of lysine did not affect the interaction. Binding of gossypol to BSA does not cause a change in its secondary structure or sedimentation coefficient.     

Analysis of the calcium-dependent interaction of calmodulin with bovine serum albumin

An air-driven ultracentrifuge has been used to investigate the calcium-dependent association between calmodulin and bovine serum albumin. Procedures were described which allowed the interaction to be analyzed to yield the equilibrium constant. At low ionic strength (25 mm Tris-HCl, pH 7.5, pCa 6.68, 9°C) the equilibrium constant for the interaction was estimated to be 2.1 × 10⁴m⁻¹, while at high ionic strength (25 mm Tris-HCl, pH 7.5, 150 mm KCl, pCa 6.68, 9°C) the value was 4.5 × 10³m⁻¹. Under similar conditions, calmodulin was also found to interact with β-lactoglobulin A and gelatin, but no detectable association was observed with ovalbumin.     

Neoglycoconjugates of mannan with bovine serum albumin and their interaction with lectin concanavalin A.

Neoglycoconjugates were prepared from mannan isolated from yeast Saccharomyces cerevisiae and activated by periodate oxidation to create aldehyde groups. Various degrees of oxidation introduced 11-28 aldehyde groups per mannan molecule and simultaneously resulted in a molar mass decrease from 46 to 44.5-31 kDa. The activated mannans were subsequently conjugated with bovine serum albumin forming neoglycoconjugates. Some parameters of these mannan-bovine serum albumin conjugates were characterized: saccharide content 25-30% w/w, molar mass within the range 169-246 kDa, and polydispersion (M(w)/M(n)) from 2.8 to 3.6. The interaction of these conjugates with lectin concanavalin A was studied using three different methods: (i) quantitative precipitation in solution; (ii) sorption to concanavalin A immobilized on bead cellulose; and (iii) kinetic measurement of the interaction by surface plasmon resonance. Quantitative precipitation assay showed only negligible differences in the precipitation course of original mannan and the corresponding mannan-bovine serum albumin conjugates. Both the sorption method (equilibrium method) and the surface plasmon resonance measurement (kinetic method) demonstrates that the values of dissociation constant K(D) of all synthetic neoglycoconjugates were within the range 10(-7) - 10(-8) mol x L(-1) (close to K(D) = 10(-8) mol x L(-1) determined by the sorption method for the original mannan). In conclusion, characterization of synthetic neoglycoconjugates confirmed that the method used for their preparation retained the ability of mannan moiety to interact with concanavalin A.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Study on the interaction of chromate with bovine serum albumin by spectroscopic method

The interaction between two chromates [sodium chromate (Na₂CrO₄) and potassium chromate K₂CrO₄)] and bovine serum albumin (BSA) in physiological buffer (pH 7.4) was investigated by the fluorescence quenching technique. The results of fluorescence titration revealed that two chromates could strongly quench the intrinsic fluorescence of BSA through a static quenching procedure. The apparent binding constants K and number of binding sites n of chromate with BSA were obtained by the fluorescence quenching method. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) were negative, indicating that the interaction of two chromates with BSA was driven mainly by van der Waals forces and hydrogen bonds. The process of binding was a spontaneous process in which Gibbs free energy change was negative. The distance r between donor (BSA) and acceptor (chromate) was calculated based on Forster’s non-radiative energy transfer theory. The results of UV–Vis absorption, synchronous fluorescence, three-dimensional fluorescence and circular dichroism (CD) spectra showed that two chromates induced conformational changes of BSA.     

The interaction of tylophorinidine,a potential leukemic drug,with bovine serum albumin

Association of tylophorinidine with bovine serum albumin was indioated by the quenching of the protein fluorescence above pH 7.0. The association constant, Ka, at pH 9.2 was calculated to be 5 × 10⁴ litres/mole. The Ka increased with increasing temperature, and the change in enthalpy, ΔH, was calculated to be 4.5 Kcals. The stoichionetry of binding obtained from Job's plot was 1:1. The data suggest involvement of tryptophan and hydrophobic forces in the albumintylophorinidine complex.     

The interaction of folate-modified Bletilla striata polysaccharide-based micelle with bovine serum albumin

Glycoconjugate Journal - We fabricated an amphiphilic folate-modified Bletilla striata polysaccharide (FA-BSP-SA) copolymer that exhibited good biocompatibility and superior antitumor effects. This...     

The subsequent effect of interaction between Co(2+) and human serum albumin or bovine serum albumin.

A notable hysteretic effect has been observed in the interaction of Co(II) with human serum albumin (HSA) or bovine serum albumin (BSA) using UV-Visible spectrometry at physiological pH (7.43), which shows that the binding between Co(II) and HSA or BSA may induce a slow transition of HSA or BSA from the conformation of weaker affinity for Co(II) to one of stronger affinity (A-B transition). The rate constants and activation parameters of this transition were measured and are discussed. It is inferred that such a conformation transition may occur due to the binding of the first Co(II) ion with the peptide segment of N-terminal residues 1-3, which results in a 'hinged movement' of the relatively hydrophobic 'valley' in the IA subdomain. This process leads to a slow conformational transition in the albumins, makes the other binding sites of Co(II) exposed, and shows a positive cooperativity effect. The LMCT (ligand-to-metal charge transition) bands of the Co(II)-HSA and Co(II)-BSA systems also show a kind of hypochromic effect featuring a dipole-dipole interaction mechanism. This phenomenon is rarely reported.     

Spectroscopic investigation on the interaction of Cr(VI) with bovine serum albumin

The interaction of potassium dichromate (Cr(VI)) with bovine serum albumin (BSA) was investigated by fluorescence, synchronous fluorescence, resonance light scattering (RLS), ultraviolet-visible absorption, and circular dichroism (CD) spectroscopies under simulated physiological conditions. The experimental results showed that Cr(VI) could quench the intrinsic fluorescence of BSA following a static quenching process, which indicates the formation of a Cr(VI)-BSA complex. The binding constant (KA) and binding site (n) were measured at different temperatures. The spectroscopic results also revealed that the binding of Cr(VI) to BSA can lead to the loosening of the protein conformation and can change the microenvironment and skeleton of BSA.     

Multi-spectroscopic study on interaction of bovine serum albumin with lomefloxacin-copper(II) complex

The binding reactions of lomefloxacin-copper(II) complex (LMF-Cu) or LMF to bovine serum albumin (BSA) in physiological solution were investigated by multi-spectroscopy. The binding constant, the number of binding sites and the binding distance between LMF-Cu or LMF and BSA were obtained by a fluorescence quenching method and according to the mechanism of Forster-type dipole-dipole non-radioactive energy-transfer, respectively. Enthalpy and entropy changes for two systems were calculated to be -7.970 kJ mol(-1) and 47.438 J mol(-1)K(-1) for LMF-BSA, -12.469 kJ mol(-1) and 33.542 J mol(-1)K(-1) for LMF-Cu-BSA, respectively. The highly positive values observed for the entropy give evidence for a strong interaction. The values of DeltaH and DeltaS in two systems are similar, indicating that electrostatic interactions in two systems play major role. The effect of LMF-Cu or LMF on the conformation of BSA was also analyzed by synchronous fluorescence, three-dimensional fluorescence and circular dichroism spectra. The results showed that the presence of Cu ion in LMF-Cu can affect the conformation of BSA to some degree. All the results revealed that the addition of copper ion promotes the interaction of lomefloxacin with bovine serum albumin.     

Study on the synthesis of sulfonamide derivatives and their interaction with bovine serum albumin

Three sulfonamide derivatives (SAD) were first synthesized from p‐hydroxybenzoic acid and sulfonamides (sulfadimidine, sulfamethoxazole and sulfachloropyridazine sodium) and were characterized by elemental analysis, ¹H NMR and MS. The interaction between bovine serum albumin (BSA) and SAD was studied using UV/vis absorption spectroscopy, fluorescence spectroscopy, time‐resolved fluorescence spectroscopy and circular dichroism spectra under imitated physiological conditions. The experimental results indicated that SAD effectively quenched the intrinsic fluorescence of BSA via a static quenching process. The thermodynamic parameters showed that hydrogen bonding and van der Waal's forces were the predominant intermolecular forces between BSA and two SADs [4‐((4‐(N‐(4,6‐dimethylpyrimidin‐2‐yl)sulfamoyl)phenyl)carbamoyl)phenyl acetate and 4‐((4‐(N‐(5‐methylisoxazol‐3‐yl)sulfamoyl)phenyl)carbamoyl)phenyl acetate], but hydrophobic forces played a major role in the binding process of BSA and 4‐((4‐(N‐(6‐chloropyridazin‐3‐yl)sulfamoyl)phenyl) carbamoyl)phenyl acetate. In addition, the effect of SAD on the conformation of BSA was investigated using synchronous fluorescence spectroscopy and circular dichroism spectra. Molecular modeling results showed that SAD was situated in subdomain IIA of BSA. Copyright © 2014 John Wiley & Sons, Ltd.