The triazatruxene derivative azatrux binds to the parallel form of the human telomeric G-quadruplex under molecular crowding conditions: biophysical and molecular modeling studies

The present study has employed a combination of spectroscopic, calorimetric and computational methods to explore the binding of the three side-chained triazatruxene derivative, termed azatrux, to a human telomeric G-quadruplex sequence, under conditions of molecular crowding. The binding of azatrux to the tetramolecular parallel [d(TGGGGT)]₄ quadruplex in the presence and absence of crowding conditions, was also characterized. The data indicate that azatrux binds in an end-stacking mode to the parallel G-quadruplex scaffold and highlights the key structural elements involved in the binding. The selectivity of azatrux for the human telomeric G-quadruplex relative to another biologically relevant G-quadruplex (c-Kit87up) and to duplex DNA was also investigated under molecular crowding conditions, showing that azatrux has good selectivity for the human telomeric G-quadruplex over the other investigated DNA structures.     

Conformational change of a G-quadruplex under molecular crowding conditions

Abstract

This study examined the influence of the molecular crowding condition induced by polyethylene glycol (PEG) on the G-quadruplex structure of the thrombin-binding aptamer sequence, 5′-GGGTTGGGTGTGGGTTGGG (G3), in a solution containing a sufficient concentration of mono cations (K⁺ and Na⁺). Although the G3 sequence preferably formed the antiparallel type G-quadruplex structure in a Na⁺ solution, conversion to the parallel type occurred when PEG was added. The antiparallel type was maintained at low PEG concentrations. When the PEG concentration reached 30%, the antiparallel type and parallel type coexist. At PEG concentrations above 40%, the G-quadruplex structure adopted the parallel type completely. In the presence of K⁺ ions, G3 showed a parallel conformation and remained as a parallel conformation with increasing PEG concentration. The dissociation temperature increased with increasing PEG concentration in all cases, suggesting that the G-quadruplex conformation is more stable under molecular crowding conditions.

Communicated by Ramaswamy H. Sarma     

The role of positive charges on G-quadruplex binding small molecules: Learning from bisaryldiketene derivatives

Background

G-quadruplexes are promising therapeutic targets for small molecules. In general, the introduction of steady positive charges through the in situ alkylation of nitrogen atoms within potential G-quadruplex ligands can significantly improve their quadruplex binding and stabilization abilities. However, our previous studies on bisaryldiketene derivatives showed that the derivative M4, whose central piperidone moiety is quaternized, exhibits a poor G-quadruplex stabilization ability.

Methods

To clarify this unusual finding, CD, ITC, UV and NMR analyses were performed to determine the binding behaviors of M4 and its non-quaternized analog M2 to G-quadruplex DNA [d(TGGGT)]₄. Molecular modeling approaches were also employed to help illustrate ligand–quadruplex DNA interactions.

Results

The CD melting and ITC analyses revealed that M2 exhibited much stronger stabilization and binding abilities to [d(TGGGT)]₄ compared to M4. Moreover, the CD and ITC analyses in combination with UV, NMR and MD simulations revealed that M2 tended to be end-stacked on the G-quartet, whereas M4 tended to be bound in the groove region. Analysis of the electrostatic potential showed that the charged surface of M4 was more positive than that of M2 and other reported ligands that bind to the G-quadruplex via end-stacking interactions.

Conclusions

The results indicated that the different positively charged surfaces of M2 and M4 might be the key reason for their different binding modes. These different binding modes also lead to different binding affinities and stabilization abilities for [d(TGGGT)]₄.

General significance

These results provide new clues for the rational design of G-quadruplex-binding small molecules with steady positive charges.     

Identification of nonplanar small molecule for G-quadruplex grooves: molecular docking and molecular dynamic study

DNA G-quadruplex is an attractive drug target for anticancer therapy. Most G-quadruplex ligands have little selectivity, due to π-stacking interaction with common G-tetrads surface. Thanks to the varieties of G-quadruplex grooves, the groove-binding ligand is expected to create high selectivity. Therefore, developing novel molecular geometries that target G-quadruplex groove has been paid growing attention. In this work, steroid FG, a special nonplanar and nonaromatic small molecule, interacting with different conformations of G-quadruplexes has been studied by molecular docking and molecular dynamics simulations. The results showed the selectivity of the hydrophobic group of steroid FG for the wide groove of antiparallel G-quadruplex. The methyl groups on the tetracyclic ring of steroid represent the specific binding ability for the small hydrophobic cavity formed by reversed stacking of G-tetrads in antiparallel G-quadruplex groove. This work provides new insight for developing new classes of G-quadruplex groove-binding ligands.     

Molecular crowders and cosolutes promote folding cooperativity of RNA under physiological ionic conditions

Folding mechanisms of functional RNAs under idealized in vitro conditions of dilute solution and high ionic strength have been well studied. Comparatively little is known, however, about mechanisms for folding of RNA in vivo where Mg²⁺ ion concentrations are low, K⁺ concentrations are modest, and concentrations of macromolecular crowders and low-molecular-weight cosolutes are high. Herein, we apply a combination of biophysical and structure mapping techniques to tRNA to elucidate thermodynamic and functional principles that govern RNA folding under in vivo–like conditions. We show by thermal denaturation and SHAPE studies that tRNA folding cooperativity increases in physiologically low concentrations of Mg²⁺ (0.5–2 mM) and K⁺ (140 mM) if the solution is supplemented with physiological amounts (∼20%) of a water-soluble neutral macromolecular crowding agent such as PEG or dextran. Low-molecular-weight cosolutes show varying effects on tRNA folding cooperativity, increasing or decreasing it based on the identity of the cosolute. For those additives that increase folding cooperativity, the gain is manifested in sharpened two-state-like folding transitions for full-length tRNA over its secondary structural elements. Temperature-dependent SHAPE experiments in the absence and presence of crowders and cosolutes reveal extent of cooperative folding of tRNA on a nucleotide basis and are consistent with the melting studies. Mechanistically, crowding agents appear to promote cooperativity by stabilizing tertiary structure, while those low molecular cosolutes that promote cooperativity stabilize tertiary structure and/or destabilize secondary structure. Cooperative folding of functional RNA under physiological-like conditions parallels the behavior of many proteins and has implications for cellular RNA folding kinetics and evolution.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

The investigation of the G-quadruplex aptamer selectivity to Pb2+ ion: a joint molecular dynamics simulation and density functional theory study

Abstract

The aptamers with the ability to form a G-quadruplex structure can be stable in the presence of some ions. Hence, study of the interactions between such aptamers and ions can be beneficial to determine the highest selective aptamer toward an ion. In this article, molecular dynamics (MD) simulations and quantum mechanics (QM) calculations have been applied to investigate the selectivity of the T30695 aptamer toward Pb²⁺ in comparison with some ions. The Free Energy Landscape (FEL) analysis indicates that Pb²⁺ has remained inside the aptamer during the MD simulation, while the other ions have left it. The Molecular Mechanics Poisson-Boltzmann Surface Area (MM-PBSA) binding energies prove that the conformational stability of the aptamer is the highest in the presence of Pb²⁺. According to the compaction parameters, the greatest compressed ion-aptamer complex, and hence, the highest ion-aptamer interaction have been induced in the presence of Pb²⁺. The contact maps clarify the closer contacts between the nucleotides of the aptamer in the presence of Pb²⁺. The density functional theory (DFT) results show that Pb²⁺ forms the most stable complex with the aptamer, which is consistent with the MD results. The QM calculations reveal that the N-H bonds and the O…H distances are the longest and the shortest, respectively, in the presence of Pb²⁺. The obtained results verify that the strongest hydrogen bonds (HBs), and hence, the most compressed aptamer structure are induced by Pb²⁺. Besides, atoms in molecules (AIM) and natural bond orbital (NBO) analyses confirm the results.

Communicated by Ramaswamy H. Sarma     

Spectroscopic,biological, and molecular modeling studies on the interactions of [Fe(III)-meloxicam] with G-quadruplex DNA and investigation of its release from bovine serum albumin (BSA) nanoparticles

The guanine-rich sequence, specifically in DNA, telomeric DNA, is a potential target of anticancer drugs. In this work, a mononuclear Fe(III) complex containing two meloxicam ligands was synthesized as a G-quadruplex stabilizer. The interaction between the Fe(III) complex and G-quadruplex with sequence of 5′-G₃(T₂AG₃)₃-3′ (HTG21) was investigated using spectroscopic methods, molecular modeling, and polymerase chain reaction (PCR) assays. The spectroscopic methods of UV–vis, fluorescence, and circular dichroism showed that the metal complex can effectively induce and stabilize G-quadruplex structure in the G-rich 21-mer sequence. Also, the binding constant between the Fe(III) complex and G-quadruplex was measured by these methods and it was found to be 4.53(±0.30)?×?10⁵ M^?1). The PCR stop assay indicated that the Fe(III) complex inhibits DNA amplification. The cell viability assay showed that the complex has significant antitumor activities against Hela cells. According to the UV–vis results, the interaction of the Fe(III) complex with duplex DNA is an order of magnitude lower than G-quadruplex. Furthermore, the release of the complex incorporated in bovine serum albumin nanoparticles was also investigated in physiological conditions. The release of the complex followed a bi-phasic release pattern with high and low releasing rates at the first and second phases, respectively. Also, in order to obtain the binding mode of the Fe(III) complex with G-quadruplex, molecular modeling was performed. The molecular docking results showed that the Fe(III) complex was docked to the end-stacked of the G-quadruplex with a π–π interaction, created between the meloxicam ligand and the guanine bases of the G-quadruplex.     

Human expression patterns: qualitative and quantitative analysis of thrombospondin‐1 under physiological and pathological conditions

Thrombospondin‐1 (TSP‐1), a matricellular protein and one of the first endogenous anti‐angiogenic molecules identified, has long been considered a potent modulator of human diseases. While the therapeutic effect of TSP‐1 to suppress cancer was investigated in both research and clinical settings, the mechanisms of how TSP‐1 is regulated in cancer remain elusive, and the scientific answers to the question of whether TSP‐1 expressions can be utilized as diagnostic or prognostic marker for patients with cancer are largely inconsistent. Moreover, TSP‐1 plays crucial functions in angiogenesis, inflammation and tissue remodelling, which are essential biological processes in the progression of many cardiovascular diseases, and therefore, its dysregulated expressions in such conditions may have therapeutic significance. Herein, we critically analysed the literature pertaining to TSP‐1 expression in circulating blood and pathological tissues in various types of cancer as well as cardiovascular and inflammation‐related diseases in humans. We compare the secretion rates of TSP‐1 by different cancer and non‐cancer cells and discuss the potential connection between the expression changes of TSP‐1 and vascular endothelial growth factor (VEGF) observed in patients with cancer. Moreover, the pattern and emerging significance of TSP‐1 profiles in cardiovascular disease, such as peripheral arterial disease, diabetes and other related non‐cancer disorders, are highlighted. The analysis of published TSP‐1 data presented in this review may have implications for the future exploration of novel TSP‐1‐based treatment strategies for cancer and cardiovascular‐related diseases.     

Human duodenal spheroids for noninvasive intracellular pH measurement and quantification of regulation mechanisms under physiological conditions

Three-dimensional cell cultures (spheroids) of biopsies of human duodenum were used to develop a new noninvasive method for studying intercellular and intracellular mechanisms. Through examinations of intracellular pH regulation, high functional similarity to native tissue could be shown, as already evidenced morphologically. A special microperfusion chamber was developed to fix individual spheroids physically to a nylon net, via laminar perfusion flow through the chamber. A significant improvement over current fixation methods was shown by the increase of cell viability almost up to 100%. Viability of the spheroids was confirmed by trypan blue exclusion, by a LIVE/DEAD viability/cytotoxicity kit, and by BCECF distribution. Intracellular pH was measured by use of the pH-sensitive fluorescence dye BCECF. To investigate the intracellular pH regulation, spheroid-like vesicles were acidified by NH4Cl prepulse technique. The subsequent active intracellular pH recovery was blocked with Na+-free Krebs Henseleit (KH) solution, with amiloride KH (inhibitor of the Na+-H+-exchanger), or with H2DIDS KH (inhibitor of the HCO3(-)-Cl(-)-exchanger and Na+-HCO3(-)-cotransporter). The intracellular pH of the spheroids was 7.31 +/- 0.05. pH-backregulation after acidification was prevented by sodium-free buffer, amiloride, and H2DIDS. These experiments indicated the presence of a Na+-H+-exchanger and a Na+-HCO3(-)-cotransporter. In conclusion, the human duodenal spheroid is an excellent physiological system for in vitro studies of the human duodenum.     

Copper-glutathione complexes under physiological conditions: structures in solution different from the solid state coordination

The physiologically important copper complexes of oxidized glutathione have been examined by electron spin resonance (ESR) spectroscopy in aqueous solution at neutral pH. Low temperature measurements show that the Cu(II) binding site in oxidized glutathione has the same ligand arrangement as in the copper complexes of S-methylglutathione, glutamine, glutamate and glycine. The site is composed of the amino nitrogens and the carboxyl oxygens of two -glutamyl residues; there is no interaction with amide nitrogens, the sulphur bond or the glycyl carboxyl groups. At high metal to ligand ratios a binuclear species exists, in which each Cu(II) binds only to one -glutamyl residue. The previously reported forbidden transition detected at g = 4 is due to non-specific aggregation and not to spin coupling of intramolecular sites. Liquid solution ESR spectra show the Cu(II)-glutathione complex has a lower mobility than the corresponding Cu(II)-S'-methylglutathione species. From the degree of spectral anisotropy the complex with glutathione is calculated to exist as a dimer. These results demonstrate that the physiologically relevant complex between copper and oxidized glutathione in solution is completely different from the known solid state structure determined by crystallography.     

Aldocyanoin microspheres: Partial amino acid analysis of the microparticulates formed from simple reactants under various conditions

Summary The work of Kenyon and Nissenbaum on aldocyanoin microspheres was repeated and extended. It was determined that the microspheres contained amino acids and that specific amino acids could be incorporated into the microspheres by adding the requisite aldehyde or ketone precursor to the model mixture. Microsphere formation was found to be dependent on the availability of oxygen. Under anaerobic conditions of synthesis, no micro-spheres formed in the time allotted and the amino acid composition of the macromolecular material was simple. Microparticulate material synthesized by C. Folsome using a quenched spark technique was analyzed and found to contain amino acids that had a qualitative composition similar to both a Miller-Urey discharge and the Kenyon-Nissenbaum microspheres.     

Nitrite-driven nitrous oxide production under aerobic soil conditions: kinetics and biochemical controls

Nitrite (NO₂⁻) can accumulate during nitrification in soil following fertilizer application. While the role of NO₂⁻ as a substrate regulating nitrous oxide (N₂O) production is recognized, kinetic data are not available that allow for estimating N₂O production or soil‐to‐atmosphere fluxes as a function of NO₂⁻ levels under aerobic conditions. The current study investigated these kinetics as influenced by soil physical and biochemical factors in soils from cultivated and uncultivated fields in Minnesota, USA. A linear response of N₂O production rate () to NO₂⁻ was observed at concentrations below 60 μg N g⁻¹ soil in both nonsterile and sterilized soils. Rate coefficients (K_p) relating to NO₂⁻ varied over two orders of magnitude and were correlated with pH, total nitrogen, and soluble and total carbon (C). Total C explained 84% of the variance in K_p across all samples. Abiotic processes accounted for 31–75% of total N₂O production. Biological reduction of NO₂⁻ was enhanced as oxygen (O₂) levels were decreased from above ambient to 5%, consistent with nitrifier denitrification. In contrast, nitrate (NO₃⁻)‐reduction, and the reduction of N₂O itself, were only stimulated at O₂ levels below 5%. Greater temperature sensitivity was observed for biological compared with chemical N₂O production. Steady‐state model simulations predict that NO₂⁻ levels often found after fertilizer applications have the potential to generate substantial N₂O fluxes even at ambient O₂. This potential derives in part from the production of N₂O under conditions not favorable for N₂O reduction, in contrast to N₂O generated from NO₃⁻ reduction. These results have implications with regard to improved management to minimize agricultural N₂O emissions and improved emissions assessments.     

Human treponematosis and tuberculosis: evidence from the New World.

The purpose of this study has been first, to critically review the evidence for the presence of human treponematosis and tuberculosis in the skeletal remains of prehistoric natives in the New World, and second, to report on nine new cases dated to before contact and suggesting the presence of these two disease conditions. A review of the medical history and findings by human paleopathologists leaves little doubt that both diseases originated in the Old World. The findings of this study lend further support to the fact that, although rare, human treponematosis and tuberculosis were indeed endemic in the pre-Columbia New World before contact. There is no evidence that these two diseases could have arisen independently and de novo, especially during the relatively short time since man's arrival in the New World. Where a disease has been endemic for quite some time as appears to be the case with human treponematosis and tuberculosis, milder forms of the disease and improved host response could have developed in which only the most severe cases would be observable. This explains the rarity of skeletal lesions suggestive of these two human disease conditions in prehistoric human populations.     

Equilibrium constants under physiological conditions for the reactions of L-phosphoserine phosphatase and pyrophosphate: L-serine phosphotransferase

The observed equilibrium constants (K_obs) for the l-phosphoserine phosphatase reaction [EC 3.1.3.3] have been determined under physiological conditions of temperature (38 °C) and ionic strength (0.25 m) and physiological ranges of pH and free [Mg²⁺]. Using Σ and square brackets to indicate total concentrations $\text{K}{}_{\mathrm{<mtext>obs</mtext>}}\text{=}\text{Σ L-serine][Σ P}{}_{\mathrm{i}}\text{]}\text{Σ L-phosphoserine]H}{}_2\text{O]}\text{, K =}\text{L-H · serine}{}^{\mathrm{\pm }}\text{]HPO}{}_4{}^{\mathrm{2?}}\text{]}\text{[L-H · phosphoserine}{}^{\mathrm{2?}}\text{]H}{}_2\text{O]}$. The value of K_obs has been found to be relatively sensitive to pH. At 38 °C, K⁺] = 0.2 m and free [Mg²⁺] = 0; K_obs = 80.6 m at pH 6.5, 52.7 m at pH 7.0 [ΔG_obs⁰ = ?10.2 kJ/mol (?2.45 kcal/mol)], and 44.0 m at pH 8.0 ([H₂O] = 1). The effect of the free [Mg²⁺] on K_obs was relatively slight; at pH 7.0 ([K⁺] = 0.2 m) K_obs = 52.0 m at free [Mg²⁺] = 10^?3, m and 47.8 m at free [Mg²⁺] = 10^?2, m. K_obs was insignificantly affected by variations in ionic strength (0.12–1.0 m) or temperature (4–43 °C) at pH 7.0. The value of K at 38 °C and I = 0.25 m has been calculated to be 34.2 ± 0.5 m [ΔG_obs⁰ = ?9.12 kJ/mol (?2.18 kcal/ mol)]([H₂O] = 1). The K for the phosphoserine phosphatase reaction has been combined with the K for the reaction of inorganic pyrophosphatase [EC 3.6.1.1] previously estimated under the same physiological conditions to calculate a value of 2.04 × 10⁴, m [ΔG_obs⁰ = ?28.0 kJ/mol (?6.69 kcal/mol)] for the K of the pyrophosphate:l-serine phosphotransferase [EC 2.7.1.80] reaction. $\text{K}{}_{\mathrm{<mtext>obs</mtext>}}\text{=}\text{[}\text{Σ L-serine}\text{][}\text{Σ}\text{P}{}_{\mathrm{<mtext>i</mtext>}}\text{]}\text{[}\text{Σ L-phosphoserine}\text{][}\text{H}{}_2\text{O}\text{]}\text{, K =}\text{[L-H · serine}{}^{\mathrm{\pm }}\text{]HPO}{}_4{}^{\mathrm{2?}}\text{]}\text{[L-H · phosphoserine}{}^{\mathrm{2?}}\text{]H}{}_2\text{O}$. Values of K_obs for this reaction at 38 °C, pH 7.0, and I = 0.25 m are very sensitive to the free [Mg²⁺], being calculated to be 668 [ΔG_obs⁰ = ?16.8 kJ/mol (?4.02 kcal/mol)] at free [Mg²⁺] = 0; 111 [ΔG_obs⁰ = ?12.2 kJ/mol (?2.91 kcal/mol)] at free [Mg²⁺] = 10^?3, m; and 9.1 [ΔG_obs⁰ = ?5.7 kJ/mol (?1.4 kcal/mol) at free [Mg²⁺] = 10^?2, m). K_obs for this reaction is also sensitive to pH. At pH 8.0 the corresponding values of K_obs are 4000 [ΔG_obs⁰ = ?21.4 kJ/mol (?5.12 kcal/mol)] at free [Mg²⁺] = 0; and 97.4 [ΔG_obs⁰ = ?11.8 kJ/ mol (?2.83 kcal/mol)] at free [Mg²⁺] = 10^?3, m. Combining K_obs for the l-phosphoserine phosphatase reaction with K_obs for the reactions of d-3-phosphoglycerate dehydrogenase [EC 1.1.1.95] and l-phosphoserine aminotransferase [EC 2.6.1.52] previously determined under the same physiological conditions has allowed the calculation of K_obs for the overall biosynthesis of l-serine from d-3-phosphoglycerate. $\text{K}{}_{\mathrm{<mtext>obs</mtext>}}\text{=}\text{[}\text{Σ L-serine}\text{][}\text{Σ NADH}\text{][}\text{Σ}\text{P}{}_{\mathrm{<mtext>i</mtext>}}\text{][}\text{Σ}\text{α-}\text{ketoglutarate}\text{]}\text{[Σ d-3-}\text{phosphoglycerate}\text{][Σ NAD}{}^{\mathrm{+}}\text{][Σ L-glutamat0]}$ The value of K_obs for these combined reactions at 38 °C, pH 7.0, and I = 0.25 m (K⁺ as the monovalent cation) is 1.34 × 10^?2, m at free [Mg²⁺] = 0 and 1.27 × 10^?2, m at free [Mg²⁺] = 10^?3, m.     

New insights into pioneer root xylem development: evidence obtained from Populus trichocarpa plants grown under field conditions

Background and Aims

Effective programmed xylogenesis is critical to the structural framework of the plant root system and its central role in the acquisition and long-distance transport of water and nutrients. The process of xylem differentiation in pioneer roots under field conditions is poorly understood. In this study it is hypothesized that xylogenesis, an example of developmental programmed cell death (PCD), in the roots of woody plants demonstrates a clearly defined sequence of events resulting in cell death. A comprehensive analysis was therefore undertaken to identify the stages of xylogenesis in pioneer roots from procambial cells to fully functional vessels with lignified cell walls and secondary cell wall thickenings.

Methods

Xylem differentiation was monitored in the pioneer roots of Populus trichocarpa at the cytological level using rhizotrons under field conditions. Detection and localization of the signalling molecule nitric oxide (NO) and hydrogen peroxide (H₂O₂) was undertaken and a detailed examination of nuclear changes during xylogenesis was conducted. In addition, analyses of the expression of genes involved in secondary cell wall synthesis were performed in situ.

Key Results

The primary event in initially differentiating tracheary elements (TEs) was a burst of NO in thin-walled cells, followed by H₂O₂ synthesis and the appearance of TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling)-positive nuclei. The first changes in nuclear structure were observed in the early stages of xylogenesis of pioneer roots, prior to lignification; however, the nucleus was detectable under transmission electron microscopy in differentiating cells until the stage at which vacuole integrity was maintained, indicating that their degradation was slow and prolonged. The subsequent sequence of events involved secondary cell wall formation and autophagy. Potential gene markers from the cinnamyl alcohol dehydrogenase (CAD) gene family that were related to secondary wall synthesis were associated with primary xylogenesis, showing clear expression in cells that undergo differentiation into TEs and in the thin-walled cells adjacent to the xylem pole.

Conclusions

The early events of TE formation during pioneer root development are described, together with the timing of xylogenesis from signalling via NO, through secondary cell wall synthesis and autophagy events that are initiated long before lignification. This is the first work describing experiments conducted in planta on roots under field conditions demonstrating that the process of xylogenesis in vivo might be gradual and complex.     

Functional anatomy of haustoria formed by Rhinanthus minor: linking evidence from histology and isotope tracing

The root parasite Rhinanthus minor feeds on the xylem of a diverse range of species. Grasses and legumes are the best hosts, while on forbs R. minor typically shows poorer growth. It has been hypothesized that host quality is linked to the expression of defences against the parasite seen in forb roots, but never in grasses. The efficacy of these defence mechanisms in preventing resource loss has not, however, been measured directly. Here we combine histological characterization of haustoria formed on Cynosurus cristatus (a grass), Leucanthemum vulgare and Plantago lanceolata (forbs) with (15)N tracers supplied to the host to quantify the efficacy of these defence responses. Rhinanthus minor penetrated only the xylem of C. cristatus, abstracting an average of 17% of the (15)N tracer taken up, but only 2.5 and 0.2%, respectively, when attached to L. vulgare and P. lanceolata. For the first time, this study has established that the resistance mechanisms of the forbs are effective in preventing the parasite from directly accessing their xylem solutes.