Comparative analysis of mitochondrial and nuclear DNA topoisomerase I from maize

We conducted a comparative study of the properties of topoisomerase I isolated from maize nuclei and mitochondria. We found that nuclear and mitochondrial enzymes possess different ability to bind single stranded DNA. Study of the enzyme activity dependence on Mg2+ demonstrated an absolute dependence of the mitochondrial topoisomerase activity. Contrary, nuclear enzyme activity was not absolutely dependent but stimulated by the magnesium cation. Mitochondrial topoisomerase formed covalent bond with the 5'-end of the cleaved DNA what is unique property of prokaryotic topoisomerase I. Nuclear enzyme bound covalently to the 3'-end like all eukaryotic topoisomerases I. The search through databases revealed genes which could encode mitochondrial topoisomerase I in the genomes of higher plants. Using both cDNA sequencing and in silico methods we demonstrated an existence of the ortholog gene in the maize genome. This gene shares significant homology with prokaryotic topoisomerase I genes that may explain differences in the properties of the mitochondrial and nuclear enzyme. Data obtained is of a significant interest both from the point of view of plant organelle evolution and mitochondrial genome expression mechanisms study.     

Biochemical characterization of topoisomerase I purified from avian erythrocytes.

A type I topoisomerase has been purified from avian erythrocyte nuclei. The most pure fraction contains one major polypeptide of Mr = 105,000 (80% of total) and several minor ones of lower molecular weight. Active forms of the topoisomerase were identified by covalently binding the enzyme to 32P-DNA, digesting with nuclease and detecting 32P labeled peptides by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Topoisomerase activity, as measured by the ability to covalently bind DNA, is associated with the following peptides: Mr = 105, 83, 54 and 30,000. The similar chromatographic properties of the various forms of topoisomerase suggests a common structural identity as previously proposed for the HeLa topoisomerase I (Liu, L.F. and Miller, K.G. (1981) Proc. Natl. Acad. Sci. USA 78, 3487-3491). The avian enzyme is similar to other eucaryotic type I DNA topoisomerases in that it covalently binds double and single stranded DNA forming an enzyme linked to the 3'-phosphoryl end and after binding to single stranded DNA it can transfer the single stranded donor DNA to an acceptor DNA possessing 5'-OH end groups. The binding site size of topoisomerase on DNA has also been determined using micrococcal nuclease to digest unprotected DNA in the native enzyme/DNA complex. The enzyme blocks access to the helix over a span of 25 bp. These findings are discussed in light of the distribution and function of topoisomerase I in chromatin.     

Purification and properties of type 1 topoisomerase from chicken erythrocytes: mechanism of eukaryotic topoisomerase action

A simple method for the purification of the major topoisomerase (topoisomerase 1) from chicken erythrocytes is described. Because of the generally repressed state of the chromatin from these nuclei, the heterogeneity of the non-histone proteins is reduced, and it is possible to purify this enzyme from a nuclear extract by a single chromatographic step. The chicken erythrocyte topoisomerase appears to be similar to previously described eukaryotic type I topoisomerases with respect to its physical and enzymological properties. The pattern of intermediate products generated during the action of chicken erythrocyte topoisomerase on a supercoiled closed circular DNA substrate has been examined quantitatively and has been shown to be consistent with a mechanism in which the enzyme closes its substrate DNA molecular after the removal of each superhelical turn and in which dissociation of the enzyme substrate complex may, but does not necessarily, occur after each cycle of the reaction.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Pea chloroplast topoisomerase I: purification,characterization, and role in replication

A DNA-relaxing enzyme was purified 5 000-fold to homogeneity from isolated chloroplasts of Pisum sativum. The enzyme consists of a single polypeptide of 112 kDa. The enzyme was able to relax negatively supercoiled DNA in the absence of ATP. It is resistant to nalidixic acid and novobiocin, and causes a unit change in the linkage number of supercoiled DNA. The enzyme shows optimum activity at 37°C with 50 mM KCl and 10 mM MgCl₂. From these properties, the enzyme can be classified as a prokaryotic type I topoisomerase.Using a partiall purified pea chloroplast DNA polymerase fraction devoid of topoisomerase I activity for in vitro replication on clones containing the pea chloroplast DNA origins of replication, a 2–6-fold stimulation of replication activity was obtained when the purified topoisomerase I was added to the reaction at 70–100 mM KCl. However, when the same reaction was carried out at 125 mM KCl, which does not affect DNA polymerase activity on calf thymus DNA but is completely inhibitory for topoisomerase I activity, a 4-fold drop in activity resulted. Novobiocin, an inhibitor of topoisomerase II, was not found to inhibit the in vitro replication of chloroplast DNA.     

Mapping of eukaryotic DNA topoisomerase I catalyzed cleavage without concomitant religation in the vicinity of DNA structural anomalies

Sensitive sites for covalent trapping of eukaryotic topoisomerase I at DNA structural anomalies were mapped by a new method using purified enzyme and defined DNA substrates. To insure that the obtained topoisomerase I trapping patterns were not influenced by DNA sequence variations, a single DNA imperfection was placed centrally within a homonucleotide track. Mapping of topoisomerase I-mediated irreversible cleavage sites on homopolymeric DNA substrates containing mismatches showed trapping of the enzyme in several positions in close vicinity of the DNA imperfection, with a strong preference for the 5' junction between the duplex DNA and the base-pairing anomaly. On homopolymeric DNA substrates containing a nick, sites of topoisomerase I-mediated cleavage on the intact strand were located just opposite to the nick and from one to ten nucleotides 5' to the nick. Sites of enzyme-mediated cleavage next to a nick and an immobile single-stranded branch were located 5' to the strand interruption in distances of two to six nucleotides and two to ten nucleotides, respectively. Taken together these findings suggest that covalent trapping of topoisomerase I proceeds at positions adjacent to mismatches, nicks and single-stranded branches, where the cleavage reaction is allowed and the ensuing ligation reaction prevented. In principle, the developed interference method might be of general utility to define topoisomerase-DNA interactions relative to different types of structural anomalies.     

Indispensable, functionally complementing N and C-terminal domains constitute site-specific topoisomerase I

Mycobacterium smegmatis topoisomerase I differs from the typical type IA topoisomerase in many properties. The enzyme recognizes both single and double-stranded DNA with high affinity and makes sequence-specific contacts during DNA relaxation reaction. The enzyme has a conserved N-terminal domain and a highly varied C-terminal domain, which lacks the characteristic zinc binding motifs found in most of the type I eubacterial enzymes. The roles of the individual domains of the enzyme in the topoisomerase I catalyzed reactions were examined by comparing the properties of full-length topoisomerase I with those of truncated polypeptides lacking the conserved N-terminal or the divergent C-terminal region. The N-terminal larger fragment retained the site-specific binding, DNA cleavage and religation properties, hallmark characteristics of the full-length M.smegmatis topoisomerase I. In contrast, the non-conserved C-terminal fragment lacking the typical DNA binding motif, exhibited non-specific DNA binding behaviour. The two polypeptide fragments, on their own do not catalyze DNA relaxation reaction. The relaxation activity is restored when both the fragments are mixed in vitro reconstituting the enzyme function. These results along with the DNA interaction pattern of the proteins implicate an essential role for the C-terminal region in single-strand DNA passage between the two transesterification reactions catalyzed by the N-terminal domain.     

Purification and characterization of a novel ATP-independent type I DNA topoisomerase from a marine methylotroph

DNA topoisomerase is involved in DNA repair and replication. In this study, a novel ATP-independent 30-kDa type I DNA topoisomerase was purified and characterized from a marine methylotroph, Methylophaga sp. strain 3. The purified enzyme composed of a single polypeptide was active over a broad range of temperature and pH. The enzyme was able to relax only negatively supercoiled DNA. Mg(2+) was required for its relaxation activity, while ATP gave no effect. The enzyme was clearly inhibited by camptothecin, ethidium bromide, and single-stranded DNA, but not by nalidixic acid and etoposide. Interestingly, the purified enzyme showed Mn(2+)-activated endonuclease activity on supercoiled DNA. The N-terminal sequence of the purified enzyme showed no homology with those of other type I enzymes. These results suggest that the purified enzyme is an ATP-independent type I DNA topoisomerase that has, for the first time, been characterized from a marine methylotroph.     

Escherichia coli DNA topoisomerase III: purification and characterization of a new type I enzyme

A new topoisomerase capable of relaxing negatively supercoiled DNA in Escherichia coli has been identified during chromatography on novobiocin-Sepharose. A simple and reproducible purification procedure is described to obtain this enzyme, called topoisomerase III (topo III), in a homogeneous form. The protein is a single polypeptide with a molecular weight of 74 000 +/- 2000 and is a type I topoisomerase, changing the linking number of DNA circles in steps of one. It is present in deletion strains lacking the topA gene and further differs from the well-studied topoisomerase I (omega protein; Eco topo I) in (1) its requirement for K+ in addition to Mg2+ to exhibit optimal activity and (2) its affinity to novobiocin-Sepharose. Positively supercoiled DNA is not relaxed during exposure to the enzyme. Topo III has no ATPase activity, and ATP does not show any discernible effect on the reduction of superhelical turns. The purified topoisomerase has no supercoiling activity and is unaffected by high concentrations of oxolinic acid and novobiocin in the relaxing reaction. Single-stranded DNA and spermidine strongly inhibit the topoisomerase activity.     

Furanocoumarins: Novel topoisomerase I inhibitors from Ruta graveolens L.

Topoisomerase I inhibitors from Ruta graveolens are reported for the first time. Potent topoisomerase I inhibitory activity from in vitro culture extracts R. graveolens were observed. Stabilization of DNA–topoisomerase covalent complex was observed in all the tested extracts. The mechanism of topoisomerase inhibition was determined by preincubation studies. The irreversible topoisomerase I mediated relaxation of plasmid in enzyme–substrate preincubation study, indicated that the observed inhibitory activity of extract constituents was not mediated through conformational changes in the DNA. Furthermore, the affinity of inhibitors with the enzyme was tested by enzyme–extract preincubation study. Increase in inhibition of topoisomerase activity and promotion of DNA–enzyme complex was observed after enzyme–extract preincubation. The activity could be assigned to furanocoumarins—psoralen, bergapten and xanthotoxin, identifying them as novel, potent topoisomerase I inhibitors.     

Inhibition of Flp recombinase by the topoisomerase I-targeting drugs, camptothecin and NSC-314622

Recombinases of the lambda-Int family and type IB topoisomerases act by introducing transient single strand breaks in DNA using chemically identical reaction schemes. Recent structural data have supported the relationship between the two enzyme groups by revealing considerable similarities in the architecture of their catalytic pockets. In this study we show that the Int-type recombinase Flp is inhibited by the two structurally unrelated topoisomerase I-directed anti-cancer drugs, camptothecin (CPT) and NSC-314622. The interaction of these drugs with topoisomerase I is very specific with several single amino acid substitutions conferring drug resistance to the enzyme. Thus, the observed interaction of CPT and NSC-314622 with Flp, which is comparable to their interaction with the cleavage complex formed by topoisomerase I, strongly supports a close mechanistic and evolutionary relationship between the two enzymes. The results suggest that Flp and other Int family recombinases may provide model systems for dissecting the molecular mechanisms of topoisomerase I-directed anti-cancer therapeutic agents.     

Regulation of Xenopus laevis DNA topoisomerase I activity by phosphorylation in vitro

DNA topoisomerase I has been purified to electrophoretic homogeneity from ovaries of the frog Xenopus laevis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the most purified fraction revealed a single major band at 110 kDa and less abundant minor bands centered at 62 kDa. Incubation of the most purified fraction with immobilized calf intestinal alkaline phosphatase abolished all DNA topoisomerase enzymatic activity in a time-dependent reaction. Treatment of the dephosphorylated X. laevis DNA topoisomerase I with a X. laevis casein kinase type II activity and ATP restored DNA topoisomerase activity to a level higher than that observed in the most purified fraction. In vitro labeling experiments which employed the most purified DNA topoisomerase I fraction, [gamma-32P]ATP, and the casein kinase type II enzyme showed that both the 110- and 62-kDa bands became phosphorylated in approximately molar proportions. Phosphoamino acid analysis showed that only serine residues became phosphorylated. Phosphorylation was accompanied by an increase in DNA topoisomerase activity in vitro. Dephosphorylation of DNA topoisomerase I appears to block formation of the initial enzyme-substrate complex on the basis of the failure of the dephosphorylated enzyme to nick DNA in the presence of camptothecin. We conclude that X. laevis DNA topoisomerase I is partially phosphorylated as isolated and that this phosphorylation is essential for expression of enzymatic activity in vitro. On the basis of the ability of the casein kinase type II activity to reactivate dephosphorylated DNA topoisomerase I, we speculate that this kinase may contribute to the physiological regulation of DNA topoisomerase I activity.     

'LeishMan' topoisomerase I: an ideal chimera for unraveling the role of the small subunit of unusual bi-subunit topoisomerase I from Leishmania donovani

The active site tyrosine residue of all monomeric type IB topoisomerases resides in the C-terminal domain of the enzyme. Leishmania donovani, possesses unusual heterodimeric type IB topoisomerase. The small subunit harbors the catalytic tyrosine within the SKXXY motif. To explore the functional relationship between the two subunits, we have replaced the small subunit of L.donovani topoisomerase I with a C-terminal fragment of human topoisomerase I (HTOP14). The purified LdTOP1L (large subunit of L.donovani topoisomerase I) and HTOP14 were able to reconstitute topoisomerase I activity when mixed in vitro. This unusual enzyme, ‘LeishMan’ topoisomerase I (Leish for Leishmania and Man for human) exhibits less efficiency in DNA binding and strand passage compared with LdTOP1L/S. Fusion of LdTOP1L with HTOP14 yielded a more efficient enzyme with greater affinity for DNA and faster strand passage ability. Both the chimeric enzymes are less sensitive to camptothecin than LdTOP1L/S. Restoration of topoisomerase I activity by LdTOP1L and HTOP14 suggests that the small subunit of L.donovani topoisomerase I is primarily required for supplying the catalytic tyrosine. Moreover, changes in the enzyme properties due to substitution of LdTOP1S with HTOP14 indicate that the small subunit contributes to subunit interaction and catalytic efficiency of the enzyme.     

Phosphorylation of mammalian DNA topoisomerase I and activation by protein kinase C

The influence of mammalian DNA topoisomerase I phosphorylation on enzyme activity has been investigated. Dephosphorylation by calf intestine alkaline phosphatase abolished the DNA relaxing activity of DNA topoisomerase I and the sensitivity of the enzyme to its specific inhibitor, camptothecin. DNA topoisomerase I could be reactivated by incubation with purified protein kinase C. DNA topoisomerase I was then able to relax supercoiled DNA processively, like the native enzyme, and to cleave 32P-end-labeled SV40 DNA fragments at the same sequences as the native enzyme in the presence of camptothecin. These results show that active DNA topoisomerase I is a phosphoprotein and suggest a possible regulatory role of protein kinase on topoisomerase I activity and on its sensitivity to camptothecin.     

Resolution of Holliday junction substrates by human topoisomerase I

Prompted by the close relationship between tyrosine recombinases and type IB topoisomerases we have investigated the ability of human topoisomerase I to resolve the typical intermediate of recombinase catalysis, the Holliday junction. We demonstrate that human topoisomerase I catalyzes unidirectional resolution of a synthetic Holliday junction substrate containing two preferred cleavage sites surrounded by DNA sequences supporting branch migration. Deleting part of the N-terminal domain (amino acid residues 1-202) did not affect topoisomerase I resolution activity, whereas a topoisomerase I variant lacking both the N-terminal domain and amino acid residues 660-688 of the linker domain was unable to resolve the Holliday junction substrate. The inability of the double deleted variant to mediate resolution correlated with the inability of this enzyme to introduce concomitant cleavage at the two preferred cleavage sites in a single Holliday junction substrate, which is a prerequisite for resolution. As determined by the gel electrophoretic mobility of native enzyme or enzyme crosslinked by disulfide bridging, the double deleted mutant existed almost entirely in a dimeric form. The impairment of this enzyme in performing double cleavages on the Holliday junction substrate may be explained by only one cleavage competent active site being formed at a time within the dimer. The assembly of only one active site within dimers is a well-known characteristic of the tyrosine recombinases. Hence, the obtained results may suggest a recombinase-like active site assembly of the double deleted topoisomerase I variant. Taken together the presented results consolidate the relationship between type IB topoisomerases and tyrosine recombinases.     

The predominant form of mammalian DNA topoisomerase Iin vivo has a molecular mass of 100 kDa

DNA topoisomerase I was purified to apparent homogeneity from human HeLa cells as a single polypeptide with a molecular mass of 100 kDa, as assayed by both gel filtration column chromatography and SDS-polyacrylamide gel electrophoresis. No smaller forms of the enzyme were detected in the purified fraction. Therefore, smaller forms, which have been observed by other investigators, are likely to be the result of proteolysis during isolation and are not relevant to thein vivo activity of DNA topoisomerase I.Abbreviations 2-ME 2-Mercaptoethanol - DTT Dithiothreitol - PMSF Phenylmethylsulfonyl Fluoride - SDS Sodium Dodecyl Sulfate     

The camptothecin-resistant topoisomerase I mutant F361S is cross-resistant to antitumor rebeccamycin derivatives. A model for topoisomerase I inhibition by indolocarbazoles.

DNA topoisomerase I is a major cellular target for antitumor indolocarbazole derivatives (IND) such as the antibiotic rebeccamycin and the synthetic analogue NB-506 which is undergoing phase I clinical trials. We have investigated the mechanism of topoisomerase I inhibition by a rebeccamycin analogue, R-3, using the wild-type human topoisomerase I and a well-characterized recombinant enzyme, F361S. The catalytic activity of this mutant remains fully intact, but the enzyme is resistant to inhibition by camptothecin (CPT). Here we show that the mutated enzyme is cross-resistant to the rebeccamycin analogue. Despite their profound structural differences, CPT and R-3 interfere similarly with the activity of the wild-type and mutant topoisomerase I enzymes, and the drug-induced cleavable complexes are equally sensitive to the NaCl concentration. CPT and IND likely recognize identical structural elements of the topoisomerase I-DNA covalent complex; however, differences do exist in terms of sequence-specificity of topoisomerase I-mediated DNA cleavage. For the first time, a molecular model showing that CPT and IND share common steric and electronic features is proposed. The model helps to identify a specific pharmacophore for topoisomerase I inhibitors.     

Leishmania donovani bisubunit topoisomerase I gene fusion leads to an active enzyme with conserved type IB enzyme function

All eukaryotic topoisomerase I enzymes are monomeric enzymes, whereas the kinetoplastid family (Trypanosoma and Leishmania) possess an unusual bisubunit topoisomerase I. To determine what happens to the enzyme architecture and catalytic property if the two subunits are fused, and to explore the functional relationship between the two subunits, we describe here in vitro gene fusion of Leishmania bisubunit topoisomerase I into a single ORF encoding a new monomeric topoisomerase I (LdTOPIL-fus-S). It was found that LdTOPIL-fus-S is active. Gene fusion leads to a significant modulation of in vitro topoisomerase I activity compared to the wild-type heterodimeric enzyme (LdTOPILS). Interestingly, an N-terminal truncation mutant (1-210 amino acids) of the small subunit, when fused to the intact large subunit [LdTOPIL-fus-Delta(1-210)S], showed reduced topoisomerase I activity and camptothecin sensitivity in comparison to LdTOPIL-fus-S. Investigation of the reduction in enzyme activity indicated that the nonconserved 1-210 residues of LdTOPIS probably act as a 'pseudolinker' domain between the core and catalytic domain of the fused Leishmania enzyme, whereas mutational analysis of conserved His453 in the core DNA-binding domain (LdTOPIL) strongly suggested that its role is to stabilize the enzyme-DNA transition state through hydrogen bonding to one of the nonbridging oxygens. Taken together, our findings provide an insight into the details of the unusual structure of bisubunit topoisomerase I of Leishmania donovani.     

Mechanism of strand passage by Escherichia coli topoisomerase I. The role of the required nick in catenation and knotting of duplex DNA

We studied the interaction between topoisomerase I and a nicked DNA substrate to determine how the nick permits Escherichia coli topoisomerase I to catenate and knot duplex DNA rings. The presence of just a single nick in a 6600-base pair DNA increased the amount of DNA bound to topoisomerase I by 6-fold. The enzyme acts at the nick, as shown by linearization of nicked circles and covalent attachment of an enzyme molecule opposite the nick. DNA breaks are also introduced by the enzyme at sites not opposite to a nick, but three orders of magnitude less efficiently. The break induced by the enzyme is within several base pairs of the nick and on the complementary strand, but the exact site cut is dictated by DNA sequence requirements. Because these sequence requirements are identical to those for cutting of single-stranded DNA, we conclude that the enzyme stabilizes a denatured region at the nick. Breaks in single-stranded DNA occur 98% of the time when a C residue is four bases to the 5' side unless G is adjacent and 5' to the break. For a DNA circle nicked at a unique location, the efficiency of DNA breakage opposite the nick correlates with the rate of catenation. We present a unified model for the relaxation, catenation, and knotting reactions of topoisomerase I in which the enzyme induces a break in a single-stranded region, but bridges that break with covalent and noncovalent interactions and allows passage of one duplex or single-stranded DNA segment.