Efficient methodology for the cyclization of linear peptide libraries via intramolecular S-alkylation using Multipin solid phase peptide synthesis.

Methodology is described here for the efficient parallel synthesis and cyclization of linear peptide libraries using intramolecular S-alkylation chemistry in combination with Multipin solid phase peptide synthesis (Multipin SPPS). The effective use of this methodology was demonstrated with the synthesis of a 72-member combinatorial library of cyclic thioether peptide derivatives of the conserved four-residue structural motif DD/EXK found in the active sites of the five crystallographically defined orthodox type II restriction endonucleases, EcoRV, EcoRI, PvuII, BamHI and BglI.     

C-terminal N-alkylated peptide amides resulting from the linker decomposition of the Rink amide resin: a new cleavage mixture prevents their formation.

Decomposition of the resin linkers during TFA cleavage of the peptides in the Fmoc strategy leads to alkylation of sensitive amino acids. The C-terminal amide alkylation, reported for the first time, is shown to be a major problem in peptide amides synthesized on the Rink amide resin. This side reaction occurs as a result of the Rink amide linker decomposition under TFA treatment of the peptide resin. The use of 1,3-dimethoxybenzene in a cleavage cocktail prevents almost quantitatively formation of C-terminal N-alkylated peptide amides. Oxidized by-product in the tested Cys- and Met-containing peptides were not observed, even if thiols were not used in the cleavage mixture.     

Solid phase synthesis of polynucleotides. VI. Further studies on polystyrene copolymers for the solid support.

A simple solid phase method for the synthesis of oligodeoxyribonucleotides has been developed using the phosphotriester approach. Mononucleotide coupling units are sequentially added to the polystyrene copolymer with 1% divinylbenzene and two kinds of oligonucleotides, d(CACGACCCCTCCACGT) and d(AACTGGTATTACTGGGCG), are synthesized in a relatively high yield. One cycle of the mononucleotide addition is about 70 minutes, and this method is particularly suitable for the automation of the synthesis upon availability of an automatic synthesizer.     

Solid phase peptide synthesis in water VI: evaluation of water-soluble coupling reagents for solid phase peptide synthesis in aqueous media

Solid phase peptide synthesis requires large amounts of organic solvents, the safe disposal of which is an important environmental issue. Peptide synthesis, if performed in water and using less or nontoxic reagents, circumvents the disposal problem. Our ultimate aim is to develop an "environment-friendly" solid phase peptide synthesis (SPPS) methodology. Previously, we showed that SPPS in water is feasible. To perform SPPS in water, the coupling reagent must be water-soluble and maintain its reactivity in water. For this report, we tested the efficacy of the water-soluble coupling reagents, 2-(5-norbornene-2,3-dicarboximido)-1,1,3,3-tetramethyluronium tetrafluoroborate (TNTU) and 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMT-MM), towards SPPS in water. We successfully synthesized Leu-enkephalin amide on a solid support suspended in aqueous 50% EtOH using DMT-MM and 2-(4-sulfophenylsulfonyl)ethoxycarbonylamino acids.     

Solid phase peptide synthesis on epoxy-bearing methacrylate monoliths.

Monoliths based on a copolymer of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) can be used directly as sorbents for affinity chromatography after solid phase peptide synthesis. The quality of the synthesized products, the amount of grown peptides on a support and the reproducibility of the process must be considered. A determination of the quantity of the introducing beta-Ala (and, consequently, the total amount of synthesized peptide) was carried out. Three peptides complementary to recombinant tissue plasminogen activator (t-PA) have been synthesized using Fmoc-chemistry on GMA-EDMA disks. The peptidyl ligands were analysed by amino acid analysis, ES-MS and HPLC methods. The affinity binding parameters were obtained from frontal elution data. The results were compared with those established for GMA-EDMA affinity sorbents formed by the immobilization of the same but separately synthesized and purified ligands. The immobilization on GMA-EDMA disks was realized using a one-step reaction between the amino groups of the synthetic ligand and the original epoxy groups of monolithic material. The affinity constants found for two kinds of sorbent did not vary significantly. Finally, the directly obtained affinity sorbents were tested for t-PA separation from a cellular supernatant.     

Preparation of protected peptide amides using the Fmoc chemical protocol. Comparison of resins for solid phase synthesis.

Different resins were examined for their potential use in the solid phase synthesis of protected peptide amides using the 9-fluorenylmethoxycarbonyl (Fmoc) chemical protocol. The model protected peptide amide BocTyr-Gly-Gly-Phe-Leu-Arg(Pmc)NH2 (1) was synthesized on both the acid-labile 4-(2',4'-dimethoxyphenyl-Fmoc-aminomethyl)phenoxy resin (Rink amide resin) (2) and on resins containing the base-labile linker 4-hydroxymethylbenzoic acid. Of the resins examined only the methylbenzhydrylamine resin containing the 4-hydroxymethylbenzoic acid linkage, which was cleaved by ammonolysis in isopropanol, gave the model peptide 1 in good overall yield (53% including functionalization). Thus the synthesis of protected peptide amides by solid phase synthesis using Fmoc-protected amino acids with t-butyl-type side chain protecting groups is feasible. The choice of peptide-resin linkage and its cleavage conditions, however, are critical to the success of such syntheses. The potential application of this synthetic strategy to the preparation of novel peptide amides is discussed.     

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.     

Novel alpha-hydroxyethyl-polystyrene, alpha-chloroethyl-polystyrene and alpha-amino-oxyethyl-polystyrene linkers on the Multipin solid support for solid-phase organic synthesis

A simple method for the generation of three novel linkers, alpha-hydroxyethyl-polystyrene, alpha-chloroethyl-polystyrene and alpha-amino-oxyethyl-polystyrene on Multipin supports (SynPhase Crowns) has been developed. Applications of these linkers have been successfully demonstrated for solid-phase synthesis of dipeptide, oxime, and hydroxamic acid compounds in good yields and purities.     

Solid phase synthesis of a GHRP analog containing C-terminal thioamide group

[Lyst6]GHRP, the C-terminally thionated analog of the highly potent growth hormone releasing hexapeptide His-D-Trp-Ala-Trp-D-Phe-Lys-NH2 was prepared by using solid support. The success of the synthesis showed that Lawesson's reagent can be used for selective thionation of an amide group not only in solution but also on the surface of a resin. The C-terminal thioamide group proved to be stable under the conditions of the solid phase synthesis.     

Solid phase peptide synthesis of alpha-factor, a yeast mating pheromone.

Based on analysis of highly purified preparations of natural $\text{α}$-factor and on the sequence recently reported by others, oligopeptides of the following structures were chemically synthesized by the solid phase method of Merrifield: N-Trp-His-Trp-Leu-Lys-Pro-Gly-G1N-Pro-Met-Tyr-C N-His-Trp-Leu-Lys-Pro-Gly-G1N-Pro-Met-Tyr-C Both synthetic species arrested $\text{a}$ cells in G1, inhibited their DNA synthesis, caused them to elongate markedly, and induced an increase in their adhesivity toward $\text{α}$ cells. Neither synthetic material caused any of these effects in $\text{α}$ cells or in $\text{a}\text{α}$ diploids.     

An amalgamation of solid phase peptide synthesis and ribosomal peptide synthesis

Expressed protein ligation (EPL) is a protein semisynthesis technique that allows the site-specific introduction of unnatural amino acids and biophysical probes into proteins. In the present study, we illustrate the utility of the approach through the generation of two semisynthetic proteins bearing spectroscopic probes. Dihydrofolate reductase containing a single (13)C probe in an active site loop was generated through the ligation of a synthetic peptide-alpha-thioester to a recombinantly generated fragment containing an N-terminal Cys. Similarly, c-Crk-II was assembled by the sequential ligation of three recombinant polypeptide building blocks, allowing the incorporation of (15)N isotopes in the central domain of the protein. These examples showcase the scope of the protein ligation strategy for selective introduction of isotopic labels into proteins, and the protocols described will be of value to those interested in using EPL on other systems.     

Solid phase synthesis of peptidyl aldehydes from C-terminal thiazolidinyl peptides

Peptidyl aldehydes are potent transition stateanalogue inhibitors of cysteine and serineproteinases. The aldehyde function has recently beenused for chemoselective peptide ligation. Thepreparation of peptidyl aldehydes on a solid supportrequires that the aldehyde be masked during peptideelongation and generated in a final step under mildconditions. We report here the preparation of peptidylaldehydes by copper salt-mediated neutral hydrolysisof the corresponding C-terminal thiazolidinyl peptideswhich were elongated on a solid support.     

Solid phase synthesis of hydrophobic difficult sequence peptides on BDDMA-PS support.

This article illustrates the successful and efficient solid phase assembly of hydrophobic difficult sequence peptides following both t-Boc and Fmoc chemistry. The peptides were synthesized on an optimized 1,4-butanediol dimethacrylate-crosslinked polystyrene support (BDDMA-PS). Four difficult sequence test peptides, VAVAG, VIVIG, QVGQVELG and VQAAIDYING, were synthesized in relatively good yield and purity without any aggregation problems. The peptides were assembled on chloromethylated and 4-hydroxymethylphenoxymethyl (HMP) BDDMA-PS resins. The peptides were fabricated using Boc amino acid 1-hydroxybenzotriazolyl and Fmoc amino acid pentafluorophenyl active esters in coupling reactions. The peptides after synthesis were cleaved from the polymeric support by exposing the peptidyl resin to 90% trifluroacetic acid/5% thioanisole/5% EDT mixture. The HPLC and MALDI TOF MS studies of the peptides revealed the high homogeneity of the synthesized peptides. Chloromethylated resin having a functional group loading of 1.14 mmol Cl/g was used for the synthesis. The yield and homogeneity of these peptides synthesized using the new support were high when compared with the conventional DVB-PS resin.     

Optimization of butanediol dimethacrylate crosslinked polystyrene: A novel polymeric support for solid phase peptide synthesis

Studies leading to optimization of butanedioldimethacrylate-crosslinked polystyrene supports (BDDMA–PS) forsolid phase peptide synthesis are delineated. BDDMA–PScopolymers with different crosslink densities were prepared andfunctionalised with chloromethyl groups. The reactivity of theLys(2-Cl-Z)-OH residue bound to these polymers through a benzylester linkage was investigated by following the kinetics ofacylation by the HOBt active ester of Boc-Alanine. From theresults it was observed that the rate of peptide bond formationwas maximum for a 2% BDDMA crosslinked resin. This resin wascompared with a 2% DVB-crosslinked polystyrene resin (DVB–PS). Synthesis of an extremely insoluble, hydrophobic,antiparallel -sheeted difficult sequencepeptide LMVGGVVIA ( 34–42), C-terminal fragment of -amyloid protein, (1–42), wascarried out on both 2% DVB–PS and 2% BDDMA-crosslinkedpolystyrene supports. The synthesis of the peptide was carriedout using Boc amino acid strategy. Greater extent of swellingof the resino peptide, increased coupling efficiency during theassembly of amino acids and relatively high purity of synthesised peptide were observed in the case of 2% BDDMA–PS polymer.     

Solid phase synthesis of peptidyl aldehydes from C-terminal thiazolidinyl peptides

Summary Peptidyl aldehydes are potent transition state analogue inhibitors of cysteine and serine proteinases. The aldehyde function has recently been used for chemoselective peptide ligation. The preparation of peptidyl aldehydes on a solid support requires that the aldehyde be masked during peptide elongation and generated in a final step under mild conditions. We report here the preparation of peptidyl aldehydes by copper salt-mediated neutral hydrolysis of the corresponding C-terminal thiazolidinyl peptides which were elongated on a solid support.     

Optimization of butanediol dimethacrylate crosslinked polystyrene: A novel polymeric support for solid phase peptide synthesis

Summary Studies leading to optimization of butanediol dimethacrylate-crosslinked polystyrene supports (BDDMA-PS) for solid phase peptide synthesis are delineated. BDDMA-PS copolymers with different crosslink densities were prepared and functionalised with chloromethyl groups. The reactivity of the Lys(2-Cl−Z)−OH residue bound to these polymers through a benzyl ester linkage was investigated by following the kinetics of acylation by the HOBt active ester of Boc-Alanine. From the results it was observed that the rate of peptide bond formation was maximum for a 2% BDDMA crosslinked resin. This resin was compared with a 2% DVB-crosslinked polystyrene resin (DVB-PS). Synthesis of an extremely insoluble, hydrophobic, antiparallel β-sheeted difficult sequence peptide LMVGGVVIA (β 34–42), C-terminal fragment of β-amyloid protein, β (1–42), was carried out on both 2% DVB-PS and 2% BDDMA-crosslinked polystyrene supports. The synthesis of the peptide was carried out using Boc amino acid strategy. Greater extent of swelling of the resino peptide, increased coupling efficiency during the assembly of amino acids and relatively high purity of synthesised peptide were observed in the case of 2% BDDMA-PS polymer.     

An imidazoline pseudodipeptide suitable for solid phase peptide synthesis.

This paper describes the synthesis of two diastereoisomers of an imidazoline dipeptide mimetic (a 4,5 dihydroimidazole-4-carboxylic acid), suitably protected for incorporation into solid phase peptide synthesis (SPPS) using the Fmoc protocol, from a phenylalanine-derived thioimidate and an alpha,beta-diaminopropanoic acid ester, followed by protecting group manipulation.     

Practical approach to solid-phase synthesis of C-terminal peptide amides under mild conditions based on a photolysable anchoring linkage

Several 3-nitro-4-(N-protected aminomethyl)benzoic acids; with protection provided by tert.-butyloxycarbonyl (Boc), 9-fluorenylmethyloxycarbonyl (Fmoc), trifluoroacetyl (Tfa), dithiasuccinoyl (Dts), or phthaloyl (Phth), have been prepared by reproducible routes. Synthesis of Dts-handle 6 illustrates some particularly novel and efficient chemistry, and is preferred over more intricate routes to Boc-handle 3 and Fmoc-handle 4. The five handles were each evaluated for their application to the synthesis of peptide amides. Coupling onto amino-functionalized supports provided a general starting point for peptide chain assembly. The handle amino function was deblocked (Boc, Fmoc, Dts), the C-terminal residue was coupled as its N alpha-protected free acid, and ultimately the ortho-nitrobenzylamide anchorage linkage was cleaved photolytically to give the corresponding amide. Starting with handles 3, 4, and 6, several free and protected peptide amides were synthesized.