Rapid nested PCR-based detection of Ramularia collo-cygni direct from barley

Ramularia collo-cygni is a barley pathogen of increasing importance in Northern and Central Europe, New Zealand and South America. Accurate visual and microscopic identification of the pathogen from diseased tissue is difficult. A nested PCR-based diagnostic test has been developed as part of an initiative to map the distribution of the pathogen in Scotland. The entire nuclear ribosomal internal transcribed spacer and 5.8S rRNA gene regions from 14 isolates of diverse global origin exhibited complete homology following sequence characterization. Two pairs of species-specific primers, based on inter-specific sequence divergence with closely related species, were designed and empirically evaluated for diagnostic nested PCR. Nested primers Rcc3 and Rcc4 consistently amplified a single product of 256 bp from DNA of 24 R. collo-cygni isolates of diverse global provenance, but not from other Ramularia species, or other fungi commonly encountered in cereal pathosystems, as well as Hordeum or Secale DNA preparations. Using this approach, R. collo-cygni was successfully identified from naturally infected barley leaf, awn and grain samples of diverse geographical provenance, in particular from symptoms that lacked the presence of characteristic conidiophores. It is envisaged that this assay will become established as an important tool in continuing studies into the ecology, aetiology and epidemiology of this poorly understood yet economically damaging plant pathogen.     

OIE white spot syndrome virus PCR gives false-positive results in Cherax quadricarinatus

White spot syndrome virus (WSSV) is an intranuclear bacilliform virus (IBV) that is a serious, notifiable crustacean pathogen. The Office International des Epizooties (OIE) PCR protocol for WSSV uses primer sets initially developed by Lo et al. (1996). It yields a first-step PCR amplicon of 1441 bp and a nested PCR amplicon of 941 bp. An amplicon (941 bp) purported to specifically detect WSSV was obtained when using template DNA extracted from Cherax quadricarinatus in a WSSV PCR detection protocol recommended by the OIE. Sequencing and analysis of the 941 bp amplicon and an occasional 550 bp amplicon from C. quadricarinatus revealed no phylogenetic relationship with WSSV, and suggested a possible lack of sufficient primer specificity for WSSV in the OIE test. This suggestion was supported by the fact that the OIE outer primer sequence (146F1) was present in both the forward and reverse position of the 941 bp and the forward position of the 550 bp nested amplicons from C. quadricarinatus. As WSSV is a notifiable pathogen, the consequences of false-positive results are harsh in WSSV-free zones and can lead to incorrect quarantine and unnecessary destruction of animals. Therefore, urgent attention and revision is necessary for the current OIE PCR protocol for WSSV detection.     

Development of a PCR-based Assay for the Detection of Plasmodiophora brassicae in Soil

A single-tube nested polymerase chain reaction (STN PCR) method was developed for detecting the causal agent of clubroot disease, Plasmodiophora brassicae. Outer primer PBTZS-2 (5′-CCGAATTCGCGTCAGCGTGA-3′) to amplify a 1457 bp-fragment from P. brassicae DNA and nested primers, PBTZS-3 (5′-CCACGTCGATCACGTTGCAAT-3′) and PBTZS-4 (5′-GCTGGCGTTGATGTACTGGAA-TT-3′), to amplify a 398 bp-fragment internal of the 1457 bp-fragment were used for the STN PCR. The 398 bp-fragment was amplified from as little as 1 fg of P. brassicae DNA with the STN PCR. A protocol for extracting P. brassicae DNA directly from soil was developed. By using the protocol, DNA was extracted from artificially infested soil containing various numbers of P. brassicae resting spores and the resulting DNA was used as template for the STN PCR. As little as one resting spore of P. brassicae per g of soil was detectable with the STN PCR. The STN PCR was applied to naturally infested soil from 3 fields and one canal bed. The 398 bp-fragment was amplified from soil of 2 fields and the canal bed. To improve the detection of P. brassicae, the STN PCR products were subjected to second PCR amplification (double PCR) using the nested primers PBTZS-3 and PBTZS-4. The double PCR amplification generated a single 398 bp-DNA band which was visualized clearly on the agarose gel for all the 4 soil samples tested. A combination of the STN PCR and the double PCR appears a useful assay method for detecting P. brassicae resting spores in field soil.     

A molecular marker diagnostic of a specific isolate of an arbuscular mycorrhizal fungus,Gigaspora margarita

To investigate the auto-ecology of a strain of Gigaspora margarita in a commercial inoculum, we found a pair of PCR primers amplifying a sequence of 235 bp diagnostic of the isolate. We designed an oligonucleotide probe based on the DNA sequence. The combination of PCR and the probing successfully detected the diagnostic sequence from both DNA preparations of single spores and colonized roots. This protocol enabled us to distinguish the isolate among several isolates from Japan, Nepal and the USA.     

Comparison of ITS RFLP patterns of Gracilaria (Rhodophyceae, Gracilariales) populations from Chile and New Zealand and an examination of interfertility of Chilean morphotypes

Restriction fragment length polymorphism (RFLP) patterns of the internal transcribed spacer (ITS) of the nuclear ribosomal cistron and crossability trials were used to characterize four morphotypes of Gracilaria from Lenga, Isla Santa María and Maullín, Chile, and two morphotypes from sites in New Zealand. PCR products from all Chilean morphotypes resulted in a major single band of ca. 1198 bp. ITS-RFLP profiles generated with the restriction enzymes Cla I, Hae III, Pst I, Hha I, Rsa I and Taq I, were identical in all cases. All crosses within, as well as between, morphotypes resulted in cystocarp differentiation, with the production of viable carpospores. Based upon these data, it is concluded that the four morphotypes from Chile correspond to a single species, G. chilensis, and that the ITS-RFLP pattern is a useful marker to predict genetic relatedness at the specific level in Gracilaria. A comparison of the ITS-RFLP patterns of the Chilean morphotypes with the patterns of two samples of G. chilensis from New Zealand revealed that the sample from Scorching Bay, Wellington, fits the Chilean ITS-RFLP patterns. The population from Blockhouse Bay, Auckland, appears to correspond to another species. This revised version was published online in July 2006 with corrections to the Cover Date.     

Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.     

Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis

A molecular method for profiling of fungal communities in soil was applied in experiments in soil microcosms, with two objectives, (1) to assess the persistence of two selected fungal species in soil, and (2) to analyze the response of the natural fungal community to a spill of sulphurous petrol in the same soil. To achieve the aims, two soil DNA extraction methods, one originally designed for the direct extraction of bacterial community DNA and the other one aimed to obtain fungal DNA, were tested for their efficiency in recovering DNA of fungal origin from soil. Both methods allowed for the efficient extraction of DNA from introduced Trichoderma harzianum spores as well as Arthrobotrys oligospora mycelial fragments, at comparable rates. Several PCR amplification systems based on primers specific for fungal 18S ribosomal RNA genes were tested to design strategies for the assessment of fungal communities in soil. The PCR systems produced amplicons of expected size with DNA of most fungi studied, which included members of the Ascomycetes, Basidiomycetes, Zygomycetes and Chytridiomycetes. On the other hand, the 18S rRNA genes of Oomycetes (including key plant pathogens) were poorly amplified. Plant (Solanum tuberosum), nematode (Meloidogyne sp.) and bacterial DNA was not amplified. For studies of soil fungal communities, a nested PCR approach was selected, in which the first PCR provided the required specificity for fungi, whereas the second (nested) PCR served to produce amplicons separable on denaturing gradient gels. Denaturing gradient gel electrophoresis (DGGE) allowed the resolution of mixtures of PCR products of several different fungi, as well as products resulting from mixed-template amplifications, into distinct banding patterns. The persistence of fungal species in soil was assessed using T. harzianum spores and A. oligospora hyphal fragments added to silt loam soil microcosms. Using PCR-DGGE, these fungi were detectable for about 14 days and 2 months, respectively. Both singly-inoculated soils and soils that had received mixed inoculants revealed, next to bands resulting from indigenous fungi, the expected bands in the DGGE profiles. The A. oligospora specific amplicon, by virtue of its unique migration in the denaturing gradient, was well detectable, whereas the T. harzianum specific product comigrated with products from indigenous fungi. PCR-DGGE analysis of DNA obtained from the silt loam soil treated with dibenzothiophene-containing petrol showed the progressive selection of specific fungal bands over time, whereas this selection was not observed in untreated soil microcosms. Cloning of individual molecules from the selected bands and analysis of their sequences revealed a complex of targets which clustered with the 18S rDNA sequences of the closely-related species Nectria haematococca, N. ochroleuca and Fusarium solani. Fungal isolates obtained from the treated soil on PDA plates were identified as Trichoderma sp., whereas those on Comada agar fell into the Cylindrocarpon group (anamorph of Nectria spp).     

Molecular detection of Fusarium oxysporum f. sp. niveum and Mycosphaerella melonis in infected plant tissues and soil

We developed two species-specific PCR assays for rapid and accurate detection of the pathogenic fungi Fusarium oxysporum f. sp. niveum and Mycosphaerella melonis in diseased plant tissues and soil. Based on differences in internal transcribed spacer (ITS) sequences of Fusarium spp. and Mycosphaerella spp., two pairs of species-specific primers, Fn-1/Fn-2 and Mn-1/Mn-2, were synthesized. After screening 24 isolates of F. oxysporum f. sp. niveum, 22 isolates of M. melonis, and 72 isolates from the Ascomycota, Basidiomycota, Deuteromycota, and Oomycota, the Fn-1/Fn-2 primers amplified only a single PCR band of approximately 320 bp from F. oxysporum f. sp.niveum, and the Mn-1/Mn-2 primers yielded a PCR product of approximately 420 bp from M. melonis. The detection sensitivity with primers Fn-1/Fn-2 and Mn-1/Mn-2 was 1fg of genomic DNA. Using ITS1/ITS4 as the first-round primers, combined with either Fn-1/Fn-2 and or Mn-1/Mn-2, two nested PCR procedures were developed, and the detection sensitivity increased 1000-fold to 1ag. The detection sensitivity for the soil pathogens was 100-microconidia/g soil. A duplex PCR method, combining primers Fn-1/Fn-2 and Mn-1/Mn-2, was used to detect F. oxysporum f. sp. niveum and M. melonis in plant tissues infected by the pathogens. Real-time fluorescent quantitative PCR assays were developed to detect and monitor the pathogens directly in soil samples. The PCR-based methods developed here could simplify both plant disease diagnosis and pathogen monitoring as well as guide plant disease management.     

Development and amplification of multiple co-dominant genetic markers from single spores of arbuscular mycorrhizal fungi by nested multiplex PCR

Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included in the multiplex PCR to ensure correct identification of the Glomus spp. spores. Single AM fungal spores were characterized as multilocus genotypes by combining alleles of each amplified locus. Only one copy of each putative single copy gene could be amplified from each spore, indicating that spores are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution.     

Efficient Detection of Leptosphaeria maculans from Infected Seed lots of Oilseed Rape

An efficient DNA extraction protocol and polymerase chain reaction (PCR) assay for detecting Leptosphaeria maculans from infected seed lots of oilseed rape were developed. L. maculans, the causal agent of blackleg, a damaging disease in oilseeds rape/canola worldwide, was listed as a quarantine disease by China in 2009. China imports several millions of tons of oilseeds every year. So there is a high risk that this pathogen will be introduced to China via contaminated seeds. Seed contamination is one of the most significant factors in the global spread of phytopathogens. Detection of L. maculans in infected seed lots by PCR assay is difficult due to the low level of pathogen mycelium/spores on seeds and PCR inhibitors associated with the seeds of oilseed rape. In our study, these two major obstacles were overcome by the development of a two‐step extraction protocol combined with a nested PCR. This extraction protocol (kit extraction after CTAB method) can efficiently extract high‐quality DNA for PCR. Amplification results showed that the detection threshold for conventional PCR and nested PCR was, respectively, 1 ng and 10 fg of DNA per μl in mycelia samples. On contaminated seed lots of oilseed rape, the detection threshold of conventional and nested PCR was 709 fg/μl and 709 ag/μl of DNA, respectively. The DNA extraction protocol and PCR assay developed in this study can be used for rapid and reliable detection of L. maculans from infected seeds of oilseed rape .     

Polymerase Chain Reaction Assay for Rapid, Sensitive Detection, and Identification of Colletotrichum gloeosporioides causing Greater Yam Anthracnose

Anthracnose caused by Colletotrichum gloeosporioides is an economically important disease which affects greater yam (Dioscorea alata L.) worldwide. Apart from airborne conidia, the pathogen propagules surviving in soil and planting material are the major sources of inoculum. A nested PCR assay has been developed for specific detection of C. gloeosporioides in soil and planting material. In conventional (single-round) PCR, the limit of detection was 20?pg, whereas in nested PCR the detection limit increased to 0.2?pg of DNA. The primers designed were found to be highly specific and could be used for accurate identification of the pathogen up to species level. The protocol was standardized for detection of the pathogen in artificially and naturally infected field samples.     

Isolation of actinophage that attack some maduromycete actinomycetes

Abstract During the course of natural product screening, two actinomycete strains, designated 3828E and 3913E, were isolated from soil collected in the Phillipines and New Zealand, respectively. Strain 3828E released without induction an actinophage. The host isolate was chemotaxonomically identical to members of the revised genus Microtetraspora having both wall chemotype III, sugar pattern B and phospholipid pattern PIV. On the basis of cultural and morphological characteristics, the isolate was most similar to Microtetraspora salmonea . Strain 3913E shared the same chemotaxonomic characteristics as strain 3828E; however, morphological examination revealed the presence of spores arranged distinctively as pairs along aerial hyphae. On this basis, strain 3913E was classified as a member of the genus Microbispora . When re-infected into the soil it had been isolated from, actinophage were recovered that specifically attacked strain 3931E. The presence of phage from both maduromycetes was confirmed by transmission electron microscopy. Neither phage was able to attack a range of other actinomycetes. We believe this to be the first reported isolation of actinophage that attack species of the genera Microtetraspora and Microbispora .     

Molecular characterization of European and Egyptian isolates of Sclerotium cepivorum,the incitant of onion white rot

Abstract

The tested European and Egyptian isolates of Sclerotium cepivorum were able to infect Giza 6 onion cultivar causing white rot disease with a different degrees of disease severity (ranging from sever to weak). The pattern of esterase isozymes produced by the tested isolates of the pathogen showed two main bands (arrows) which were different in density. Such differences in density of bands were present in every run and therefore appear to be indicators for differences among the tested isolates. Analysis of the protein pattern of the tested isolates of the pathogen indicated that the tested isolates had major proteins of a molecular weight of 52, 36, 23 and 16 kDa. Variation between isolates was detected by presence of bands of low molecular weight. Isolate Nos. 1, 4, 5, 7, 8, 9, 10 and 13 had a band at 17 kDa, whereas isolate Nos. 2, 3, 6, 11, 12, 14, and 15 had a band at 20 kDa. Using RAPD analysis to evaluate the genetic diversity of the tested isolates indicated that the tested field population of the pathogen was genetically heterogeneous but shared a number of common bands with molecular weights ranging from 650 to 2500 bp. Based on the DNA banding pattern the tested isolates can be assigned to seven genetically different groups. All tested isolates produced a band at 2500 bp except isolate No. 7. No correlation was exibited between patterns esterase isozmes, protein and DNA patterns of S. cepivorum isolates and their virulence or geographical origin.     

An evaluation of commercial DNA extraction kits for the isolation of bacterial spore DNA from soil

Aims: To evaluate six commercial DNA extraction kits for their ability to isolate PCR‐quality DNA from Bacillus spores in various soil samples. Methods and Results: Three soils were inoculated with various amounts of Bacillus cereus spores to simulate an outbreak or intentional release of the threat agent Bacillus anthracis. DNA was isolated from soil samples using six commercial DNA extraction kits. Extraction and purification efficiencies were assessed using a duplex real‐time PCR assay that included an internal positive control. The FastDNA^® SPIN kit for Soil showed the highest DNA extraction yield, while the E.Z.N.A.^® Soil DNA and PowerSoil^® DNA Isolation kits showed the highest efficiencies in removing PCR inhibitors from loam soil extracts. Conclusions: The results of this study suggest that commercially available extraction kits can be used to extract PCR‐quality DNA from bacterial spores in soil. The selection of an appropriate extraction kit should depend on the characteristics of the soil sample and the intended downstream application. Significance and Impact of the Study: The results of this study aid in the selection of an appropriate DNA extraction kit for a given soil sample. Its application could expedite sample processing for real‐time PCR detection of a pathogen in soil.     

Discrimination of viable Acanthamoeba castellani trophozoites and cysts by propidium monoazide real-time polymerase chain reaction

Even though the advent of quantitative polymerase chain reaction (PCR) has improved the detection of pathogen microorganisms in most of areas of microbiology, a serious limitation of this method may arise from the inability to discriminate between viable and nonviable pathogens. To overcome it, the use of real-time PCR and selective nucleic acid intercalating dyes like propidium monoazide (PMA) have been effectively evaluated for different microorganisms. To assess whether PMA pretreatment can inhibit PCR amplification of nonviable amoeba DNA, Acanthamoeba castellani survival was measured using cell culture and real-time PCR with and without PMA pretreatment. Autoclave and contact lens disinfecting solutions were used to inactivate amoebae. After these inactivation treatments, the results indicated that the PMA pretreatment approach is appropriate for differentiating viable A. castellani, both trophozoites and cysts. Therefore, the PMA-PCR approach could be useful as a rapid and sensitive analytical tool for monitoring treatment and disease control, assessing effective disinfection treatments, and for a more reliable understanding of the factors that contribute to the interaction amoeba-pathogenic bacteria.     

Immunomagnetic capture PCR to detect viable Cryptosporidium parvum oocysts from environmental samples.

A method to detect viable Cryptosporidium parvum oocysts was developed. Polyclonal immunoglobulin G against C. parvum oocyst and sporozoite surface antigens was purified from rabbit immune serum, biotinylated, and bound to streptoavidin-coated magnetic particles. C. parvum oocysts were captured by a specific antigen-antibody reaction and magnetic separation. The oocysts were then induced to excyst, and DNA was extracted by heating at 95 degrees C for 10 min. A 452-bp fragment of C. parvum DNA was amplified by using a pair of C. parvum-specific primers in PCR. The method detected as few as 10 oocysts in purified preparations and from 30 to 100 oocysts inoculated in fecal samples. The immunomagnetic capture PCR (IC-PCR) product was identified and characterized by a nested PCR that amplified a 210-bp fragment, followed by restriction endonuclease digestion of the IC-PCR and nested-PCR products at the StyI site and a nonradioactive hybridization using an internal oligonucleotide probe labeled with biotin. PCR specificity was also tested, by using DNAs from other organisms as templates. In the control experiments, inactivated oocysts were undetectable, indicating the ability of this method to differentiate between viable and nonviable oocysts. Thus, this system can be used to specifically detect viable C. parvum oocysts in environmental samples with great sensitivity, providing an efficient way to monitor the environment for C. parvum contamination.     

Sequence analysis and characterization of stutter products at the tetranucleotide repeat locus vWA.

The PCR amplification of tetranucleotide short tandem repeat (STR) loci typically produces a minor product band 4 bp shorter than the corresponding main allele band; this is referred to as the stutter band. Sequence analysis of the main and stutter bands for two sample alleles of the STR locus vWA reveals that the stutter band lacks one repeat unit relative to the main allele. Sequencing results also indicate that the number and location of the different 4 bp repeat units vary between samples containing a typical verses low proportion of stutter product. The results also suggest that the proportion of stutter product relative to the main allele increases as the number of uninterrupted core repeat units increases. The sequence analysis and results obtained using various DNA polymerases appear to support the slipped strand displacement model as a potential explanation for how these stutter products are generated.     

Development of amplified fragment length polymorphism (AFLP)‐derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot

Aims

The objective of this work was to design an amplified fragment length polymorphism (AFLP)‐derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot (PBRR) in plant material and soil.

Methods and Results

Specific primers for the detection of the pathogen were designed based on an amplified region using AFLPs. The banding patterns by AFLPs showed that isolates from diseased roots were clearly distinguishable from others members of the F. solani species complex. Many bands were specific to F. solani PBRR, one of these fragments was selected and sequenced. Sequence obtained was used to develop specific PCR primers for the identification of pathogen in pure culture and in plant material and soil. Primer pair FS1/FS2 amplified a single DNA product of 175 bp. Other fungal isolates occurring in soil, included F. solani non‐PBRR, were not detected by these specific primers. The assay was effective for the detection of pathogen from diseased root and infected soils.

Conclusions

The designed primers for F. solani causing PBRR can be used in a PCR diagnostic protocol to rapidly and reliably detect and identify this pathogen.

Significance and Impact of the Study

These diagnostic PCR primers will aid the detection of F. solani causing PBRR in diseased root and natural infected soils. The method developed could be a helpful tool for epidemiological studies and to avoid the spread of this serious disease in new areas.