Identification and analysis of a retinoblastoma binding motif in the replication protein of a plant DNA virus: requirement for efficient viral DNA replication.

Geminiviruses are plant DNA viruses with small genomes whose replication, except for the viral replication protein (Rep), depends on host proteins and, in this respect, are analogous to animal DNA tumor viruses, e.g. SV40. The mechanism by which these animal viruses create a cellular environment permissive for viral DNA replication involves the binding of a virally encoded oncoprotein, through its LXCXE motif, to the retinoblastoma protein (Rb). We have identified such a LXCXE motif in the Rep protein of wheat dwarf geminivirus (WDV) and we show its functional importance during viral DNA replication. Using a yeast two-hybrid system we have demonstrated that WDV Rep forms stable complexes with p130Rbr2, a member of the Rb family of proteins, and single amino acid changes within the LXCXE motif abolish the ability of WDV Rep to bind to p130Rbr2. The LXCXE motif is conserved in other members of the same geminivirus subgroup. The presence of an intact Rb binding motif is required for efficient WDV DNA replication in cultured wheat cells, strongly suggesting that one of the functions of WDV Rep may be the linking between viral and cellular DNA replication cycles. Our results point to the existence of a Rb-like protein(s) in plant cells playing regulatory roles during the cell cycle.     

Inhibition of Binding of Tomato Yellow Leaf Curl Virus Rep to its Replication Origin by Artificial Zinc-Finger Protein

Previously we demonstrated that inhibition of replication-associated protein (Rep) binding to its replication origin by artificial zinc-finger proteins (AZPs) is a powerful method to prevent plant virus infection in vivo. In the present study, we applied the AZP technology to Tomato yellow leaf curl virus (TYLCV), which is a limiting factor in tomato cultivation worldwide. First, we determined 5′-ATCGGTGT ATCGGTGT-3′ in the 195-bp intergenic region of the TYLCV-Israel strain, a strain reported first among TYLCV strains, as the Rep-binding site by gel shift assays. We then constructed a 6-finger AZP that bound to a 19-bp DNA including the Rep-binding site. We demonstrated that the binding affinity of the AZP was >1,000-fold greater than that of Rep and that the AZP inhibited Rep binding completely in vitro. Because the binding capability of the AZP was same as that of the AZP previously designed for geminivirus-resistant Arabidopsis thaliana, we predict that the present AZP will prevent TYLCV infection in vivo.     

An adeno-associated virus (AAV) initiator protein, Rep78, catalyzes the cleavage and ligation of single-stranded AAV ori DNA

The Rep78 protein of adeno-associated virus (AAV) contains amino acid sequence motifs common to rolling-circle replication (RCR) initiator proteins. In this report, we describe RCR initiator-like activities of Rep78. We demonstrate that a maltose-binding protein (MBP)-Rep78 fusion protein can catalyze the cleavage and ligation of single-stranded DNA substrates derived from the AAV origin of replication. Rep-mediated single-stranded DNA cleavage was strictly dependent on the presence of certain divalent cations (e.g., Mn(2+) or Mg(2+)) but did not require the presence of a nucleoside triphosphate cofactor. Electrophoretic mobility shift assays demonstrated that binding of single-stranded DNA by MBP-Rep78 was influenced by the length of the substrate as well as the presence of potential single-stranded cis-acting sequence elements. Site-directed mutagenesis was used to examine the role of specific tyrosine residues within a conserved RCR motif (motif 3) of Rep78. Replacement of Tyr-156 with phenylalanine abolished the ability of MBP-Rep78 to mediate the cleavage and ligation of single-stranded DNA substrates but not the ability to stably bind single-stranded DNA. The cleaving-joining activity of Rep78 is consistent with the mechanism of replicative intermediate dimer resolution proposed for the autonomous parvoviruses and may have implications for targeted integration of recombinant AAV vectors.     

Adeno-Associated Virus Type 2 Rep68 Can Bind to Consensus Rep-Binding Sites on the Herpes Simplex Virus 1 Genome

Adeno-associated virus type 2 is known to inhibit replication of herpes simplex virus 1 (HSV-1). This activity has been linked to the helicase- and DNA-binding domains of the Rep68/Rep78 proteins. Here, we show that Rep68 can bind to consensus Rep-binding sites on the HSV-1 genome and that the Rep helicase activity can inhibit replication of any DNA if binding is facilitated. Therefore, we hypothesize that inhibition of HSV-1 replication involves direct binding of Rep68/Rep78 to the HSV-1 genome.     

Analysis of the Effects of Charge Cluster Mutations in Adeno-Associated Virus Rep68 Protein In Vitro

The Rep78 and Rep68 proteins of adeno-associated virus type 2 (AAV) are multifunctional proteins which are required for viral replication, regulation of AAV promoters, and preferential integration of the AAV genome into a region of human chromosome 19. These proteins bind the hairpin structures formed by the AAV inverted terminal repeat (ITR) origins of replication, make site- and strand-specific endonuclease cuts within the AAV ITRs, and display nucleoside triphosphate-dependent helicase activities. Additionally, several mutant Rep proteins display negative dominance in helicase and/or endonuclease assays when they are mixed with wild-type Rep78 or Rep68, suggesting that multimerization may be required for the helicase and endonuclease functions. Using overlap extension PCR mutagenesis, we introduced mutations within clusters of charged residues throughout the Rep68 moiety of a maltose binding protein-Rep68 fusion protein (MBP-Rep68Δ) expressed in Escherichia coli cells. Several mutations disrupted the endonuclease and helicase activities; however, only one amino-terminal-charge cluster mutant protein (D40A-D42A-D44A) completely lost AAV hairpin DNA binding activity. Charge cluster mutations within two other regions abolished both endonuclease and helicase activities. One region contains a predicted alpha-helical structure (amino acids 371 to 393), and the other contains a putative 3,4 heptad repeat (coiled-coil) structure (amino acids 441 to 483). The defects displayed by these mutant proteins correlated with a weaker association with wild-type Rep68 protein, as measured in coimmunoprecipitation assays. These experiments suggest that these regions of the Rep molecule are involved in Rep oligomerization events critical for both helicase and endonuclease activities.     

DNA-binding activity of adeno-associated virus Rep is required for inverted terminal repeat-dependent complex formation with herpes simplex virus ICP8

Herpes simplex virus (HSV) helper functions for (AAV) replication comprise HSV ICP8 and helicase-primase UL5/UL52/UL8. Here we show that N-terminal amino acids of AAV Rep78 that contact the Rep-binding site within the AAV inverted terminal repeat (ITR) are required for ternary-complex formation with infected-cell protein 8 (ICP8) on AAV single-strand DNA (ssDNA) in vitro and for colocalization in nuclear replication domains in vivo. Our data suggest that HSV-dependent AAV replication is initiated by Rep contacting the AAV ITR and by cooperative binding of ICP8 on AAV ssDNA.     

Demonstration of nicking/joining activity at the origin of DNA replication associated with the rep and rep' proteins of porcine circovirus type 1

The replication of porcine circovirus type 1 (PCV1) is thought to occur by rolling-circle replication (RCR), whereby the introduction of a single-strand break generates a free 3'-hydroxyl group serving as a primer for subsequent DNA synthesis. The covalently closed, single-stranded genome of PCV1 replicates via a double-stranded replicative intermediate, and the two virus-encoded replication-associated proteins Rep and Rep' have been demonstrated to be necessary for virus replication. However, although postulated to be involved in RCR-based virus replication, the mechanism of action of Rep and Rep' is as yet unknown. In this study, the ability of PCV1 Rep and Rep' to "nick" and "join" strand discontinuities within synthetic oligonucleotides corresponding to the origin of replication of PCV1 was investigated in vitro. Both proteins were demonstrated to be able to cleave the viral strand between nucleotides 7 and 8 within the conserved nonanucleotide motif (5'-TAGTATTAC-3') located at the apex of a putative stem-loop structure. In addition, the Rep and Rep' proteins of PCV1 were demonstrated to be capable of joining viral single-stranded DNA fragments, suggesting that these proteins also play roles in the termination of virus DNA replication. This joining activity was demonstrated to be strictly dependent on preceding substrate cleavage and the close proximity of origin fragments accomplished by base pairing in the stem-loop structure. The dual "nicking/joining" activities associated with PCV1 Rep and Rep' are pivotal events underlying the RCR-based replication of porcine circoviruses in mammalian cells.     

Functional analysis of cis- and trans-acting replication factors of porcine circovirus type 1

The replication proteins Rep and Rep' of porcine circovirus type 1 (PCV1) are both capable of introducing and resealing strand discontinuities at the viral origin of DNA replication in vitro underlying genome amplification by rolling-circle replication. The PCV1 origin of replication encompasses the minimal binding site (MBS) of the Rep and Rep' proteins and an inverted repeat with the potential to form a stem-loop. In this study, both elements of the PCV1 origin were demonstrated to be essential for viral replication in transfected cells. Furthermore, investigation of conserved amino acid motifs within Rep and Rep' proteins revealed that the mutation of motifs I, II, and III and of the GKS box interfered with viral replication. In vitro studies demonstrated that motifs I to III were essential for origin cleavage, while the GKS box was dispensable for the initiation of viral replication. A covalent link between Rep/Rep' and the DNA after origin cleavage was demonstrated, providing a mechanism for energy conservation for the termination of replication.     

Creating a Novel Origin of Replication through Modulating DNA-Protein Interfaces

Background

While the molecular mechanisms of DNA-protein specificity at the origin of replication have been determined in many model organisms, these interactions remain unknown in the majority of higher eukaryotes and numerous vertebrate viruses. Similar to many viral origins of replication, adeno-associated virus (AAV) utilizes a cis-acting origin of replication and a virus specific Replication protein (Rep) to faithfully carry out self-priming replication. The mechanisms of AAV DNA replication are generally well understood. However, the molecular basis of specificity between the Rep protein and the viral origin of replication between different AAV serotypes remains uncharacterized.

Methodology/Principal Findings

By generating a panel of chimeric and mutant origins between two AAV serotypes, we have mapped two independent DNA-Protein interfaces involved in replicative specificity. In vivo replication assays and structural modeling demonstrated that three residues in the AAV2 Rep active site are necessary to cleave its cognate origin. An analogous origin (AAV5) possesses a unique interaction between an extended Rep binding element and a 49 aa region of Rep containing two DNA binding interfaces.

Conclusions/Significance

The elucidation of these structure-function relationships at the AAV origin led to the creation of a unique recombinant origin and compatible Rep protein with properties independent of either parent serotype. This novel origin may impact the safety and efficacy of AAV as a gene delivery tool. This work may also explain the unique ability of certain AAV serotypes to achieve site-directed integration into the human chromosome. Finally, this result impacts the study of conserved DNA viruses which employ rolling circle mechanisms of replication.     

Sequence-specific interactions of Rep proteins with ssDNA in the AT-rich region of the plasmid replication origin

The DNA unwinding element (DUE) is a sequence rich in adenine and thymine residues present within the origin region of both prokaryotic and eukaryotic replicons. Recently, it has been shown that this is the site where bacterial DnaA proteins, the chromosomal replication initiators, form a specific nucleoprotein filament. DnaA proteins contain a DNA binding domain (DBD) and belong to the family of origin binding proteins (OBPs). To date there has been no data on whether OBPs structurally different from DnaA can form nucleoprotein complexes within the DUE. In this work we demonstrate that plasmid Rep proteins, composed of two Winged Helix domains, distinct from the DBD, specifically bind to one of the strands of ssDNA within the DUE. We observed nucleoprotein complexes formed by these Rep proteins, involving both dsDNA containing the Rep-binding sites (iterons) and the strand-specific ssDNA of the DUE. Formation of these complexes required the presence of all repeated sequence elements located within the DUE. Any changes in these repeated sequences resulted in the disturbance in Rep-ssDNA DUE complex formation and the lack of origin replication activity in vivo or in vitro.     

The nuclease domain of adeno-associated virus rep coordinates replication initiation using two distinct DNA recognition interfaces

Integration into a particular location in human chromosomes is a unique property of the adeno-associated virus (AAV). This reaction requires the viral Rep protein and AAV origin sequences. To understand how Rep recognizes DNA, we have determined the structures of the Rep endonuclease domain separately complexed with two DNA substrates: the Rep binding site within the viral inverted terminal repeat and one of the terminal hairpin arms. At the Rep binding site, five Rep monomers bind five tetranucleotide direct repeats; each repeat is recognized by two Rep monomers from opposing faces of the DNA. Stem-loop binding involves a protein interface on the opposite side of the molecule from the active site where ssDNA is cleaved. Rep therefore has three distinct binding sites within its endonuclease domain for its different DNA substrates. Use of these different interfaces generates the structural asymmetry necessary to regulate later events in viral replication and integration.     

The Rep protein binding elements of the plasmid ColE2-P9 replication origin

The plasmid ColE2-P9 (ColE2) origin (32bp) is specifically recognized by the plasmid-specified Rep protein that initiates DNA replication. The ColE2 origin is divided into at least three functional subregions (I, II, and III), and three sites (a, b, and c) found in subregions I and II play important roles in Rep protein binding. We performed SELEX experiments of plasmid ColE2 to determine the optimal sequences for specific binding of the Rep protein. From these experiments, we obtained a common 16-bp sequence (5'-TGAGACCANATAAGCC-3'), which corresponds to about one half of the minimal ColE2 origin and contains sites a and b. Gel mobility shift assays using single-point mutant origins and the Rep protein further indicated that high affinity sequence-specific recognition by the Rep protein requires sites a, b, and c, but that mutations in site c were less disruptive to this recognition than those in sites a and b.     

Open strands adjacent to iterons promote the binding of the replication initiator protein (Rep) of pSC101 to the unit sequence of the iterons in vitro

The purified dimeric form of the Rep protein, a replication initiator protein of the plasmid pSC101, has a low affinity for repeated sequences, iterons, in the replication origin of the plasmid, and higher affinities for two inverted repeats in the operator region of the rep gene resulting in its functioning as an autorepressor. Studies of binding to various synthetic DNA have established that Rep can bind to duplex iteron-sequence carrying open (non-complementary) strands at one end proximal to the rep gene. Open strands at the opposite end of the iteron have no effect on Rep-binding. One open strand seems to be required in a sequence-specific fashion. A randomly sequenced duplex DNA with the open strands cannot bind to Rep but can function as a significant competitor. This suggests that Rep has some affinity for the open strands and forms a stable complex with the adjacent iteron. The mutated Rep protein, Rep1, which causes an increase in the plasmid copy number in vivo, has equally high affinity for the iteron with the open strands as wild type Rep, though it has a lower affinity for the inverted repeats than the wild type. The Rep dimer might bind to these DNA sequences with different modes.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Expression of the oligomerization domain of the replication-associated protein (Rep) of Tomato leaf curl New Delhi virus interferes with DNA accumulation of heterologous geminiviruses

The minimal DNA binding domain of the replication-associated protein (Rep) of Tomato leaf curl New Delhi virus was determined by electrophoretic mobility gel shift analysis and co-purification assays. DNA binding activity maps to amino acids 1-160 (Rep-(1-160)) of the Rep protein and overlaps with the protein oligomerization domain. Transient expression of Rep protein (Rep-(1-160)) was found to inhibit homologous viral DNA accumulation by 70-86% in tobacco protoplasts and in Nicotiana benthamiana plants. The results obtained showed that expression of N-terminal sequences of Rep protein could efficiently interfere with DNA binding and oligomerization activities during virus infection. Surprisingly, this protein reduced accumulation of the African cassava mosaic virus, Pepper huasteco yellow vein virus and Potato yellow mosaic virus by 22-48%. electrophoretic mobility shift assays and co-purification studies showed that Rep-(1-160) did not bind with high affinity in vitro to the corresponding common region sequences of heterologous geminiviruses. However, Rep-(1-160) formed oligomers with the Rep proteins of the other geminiviruses. These data suggest that the regulation of virus accumulation may involve binding of the Rep to target DNA sequences and to the other Rep molecules during virus replication.