Computational analysis of base composition pattern and promoter elements in the putative promoter regions in relation to expression profiles of 682 human genes on chromosome 22.

Abstract The base composition pattern (BCP) in the putative promoter region (PPRs) up to 5 Kb lengths of 682 human genes on Chromosome 22 (Chr22) was examined. Two-dimensional (2D) and three-dimensional (3D) functions were designed to delineate the DNA base composition, with four major patterns identified. It is found that 17.6% genes include TATA box, 28.0% GC box, 18.9% CAAT box and 38.4% CpG islands, and approximately 10% genes have one of four putative initiator (Inr) motifs. The occurrence of the promoter elements is tightly associated with the base composition features in the promoter regions, and the associations of the base composition features with occurrence of the promoter elements in the promoter regions mediate tissue-wide expression of the genes in human. The occurrence of two or more promoter elements in the promoter regions is required for the medium- and wide-range expression profiles of the human genes on Chr22. Thus, the reported data shed light on the characteristics of the PPRs of the human genes on Chr22, which may improve our understanding of regulatory roles of the PPRs with occurrence of the promoter elements in gene expression.     

Dissection of cis-regulatory elements in the C. elegans Hox gene egl-5 promoter

Hox genes are highly conserved segmental identity genes well known for their complex expression patterns and divergent targets. Here we present an analysis of cis-regulatory elements in the Caenorhabditis elegans Hox gene egl-5, which is expressed in multiple tissues in the posterior region of the nematode. We have utilized phylogenetic footprinting to efficiently identify cis-regulatory elements and have characterized these with gfp reporters and tissue-specific rescue experiments. We have found that the complex expression pattern of egl-5 is the cumulative result of the activities of multiple tissue or local region-specific activator sequences that are conserved both in sequence and near-perfect order in the related nematode Caenorhabditis briggsae. Two conserved regulatory blocks analyzed in detail contain multiple sites for both positively and negatively acting factors. One of these regions may promote activation of egl-5 in certain cells via the Wnt pathway. Positively acting regions are repressed in inappropriate tissues by additional negative pathways acting at other sites within the promoter. Our analysis has allowed us to implicate several new regulatory factors significant to the control of egl-5 expression.     

Regulatory elements involved in Drosophila Adh gene expression are conserved in divergent species and separate elements mediate expression in different tissues.

Alcohol dehydrogenase (ADH) is expressed in a complex temporal and spatial pattern from tandem promoters (proximal and distal) in Drosophila melanogaster, and from two closely linked genes (Adh-1 and Adh-2) in D. mulleri. The expression patterns of Adh-1 and the proximal promoter, and Adh-2 and the distal promoter are similar, but not identical. We show that the mulleri Adh genes are appropriately expressed when introduced into the melanogaster genome, indicating that the cis- and trans-acting elements which regulate the corresponding promoters are functionally equivalent in the two species. By analyzing the expression of in vitro generated mutants of the mulleri Adh locus, we define at least three regulatory regions of the mulleri Adh genes and show that different control elements mediate the expression of Adh in different tissues.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Phylogenetic footprinting and genome scanning identify vertebrate BMP response elements and new target genes

The complex gene regulatory networks governed by growth factor signaling are still poorly understood. In order to accelerate the rate of progress in uncovering these networks, we explored the usefulness of interspecies sequence comparison (phylogenetic footprinting) to identify conserved growth factor response elements. The promoter regions of two direct target genes of Bone Morphogenetic Protein (BMP) signaling in Xenopus, Xvent2 and XId3, were compared with the corresponding human and/or mouse counterparts to identify conserved sequences. A comparison between the Xenopus and human Vent2 promoter sequences revealed a highly conserved 21 bp sequence that overlaps the previously reported Xvent2 BMP response element (BRE). Reporter gene assays using Xenopus animal pole ectodermal explants (animal caps) revealed that this conserved 21 bp BRE is both necessary and sufficient for BMP responsiveness. We combine the same phylogenetic footprinting approach with luciferase assays to identify a highly conserved 49 bp BMP responsive region in the Xenopus Id3 promoter. GFP reporters containing multimers of either the Xvent2 or XId3 BREs appear to recapitulate endogenous BMP signaling activity in transgenic Xenopus embryos. Comparison of the Xvent2 and the XId3 BRE revealed core sequence features that are both necessary and sufficient for BMP responsiveness: a Smad binding element (SBE) and a GC-rich element resembling an OAZ binding site. Based on these findings, we have implemented genome scanning to identify over 100 additional putative target genes containing 2 or more BRE-like sequences which are conserved between human and mouse. RT-PCR and in situ analyses revealed that this in silico approach can effectively be used to identify potential BMP target genes.     

Control of Relative Timing and Stoichiometry by a Master Regulator

Developmental processes in cells require a series of complex steps. Often only a single master regulator activates genes in these different steps. This poses several challenges: some targets need to be ordered temporally, while co-functional targets may need to be synchronized in both time and expression level. Here we study in single cells the dynamic activation patterns of early meiosis genes in budding yeast, targets of the meiosis master regulator Ime1. We quantify the individual roles of the promoter and protein levels in expression pattern control, as well as the roles of individual promoter elements. We find a consistent expression pattern difference between a non-cofunctional pair of genes, and a highly synchronized activation of a co-functional pair. We show that dynamic control leading to these patterns is distributed between promoter, gene and external regions. Through specific reciprocal changes to the promoters of pairs of genes, we show that different genes can use different promoter elements to reach near identical activation patterns.     

Genomic P elements content of a wild M' strain of Drosophila melanogaster: KP elements do not always function as type II repressor elements

The P element is one of the best-studied DNA transposons as a model system to study evolution of mobile DNAs. The P element is a causative factor for P-M hybrid dysgenesis in Drosophila melanogaster and the P-M phenotype (P, Q, or M) has been thought to reflect genomic P elements content. Recent survey of natural populations showed that full-size P (FP) and KP elements are predominant in almost all current populations, irrespective of their phenotype variation. It was also suggested that some P elements are functionally inactive and their inactivation plays an important role in determining P-M phenotype. In order to know how the genomic P elements are inactivated, we characterized molecular features and insertion sites of them in an M' strain. We isolated 20 P elements, one FP, 15 KP, and four other internally deleted defective elements, all of which appeared thoroughly inactive. These FP and KP elements had canonical sequences in each case, but no mutations abolishing their function. In addition, they were mostly located in or within the vicinity of presumably active genes. Our results suggest that inactivation of P elements is associated with neither mutations nor constitutional suppression by heterochromatinization in M' strains and that only a few elements inserted in some special chromosomal regions are likely to be involved in determination of the phenotype of individual flies. Existence of many copies of canonical, but inactive, KP elements in the M' strain is inconsistent with the assumption that type II repression of the KP element is the main reason for its increase in the wild populations of D. melanogaster.