Resolution of poxvirus telomeres: processing of vaccinia virus concatemer junctions by conservative strand exchange.

The replication of vaccinia virus proceeds through concatemeric intermediates which are resolved into unit-length DNA. In vaccinia virus-infected cells, plasmids containing the vaccinia virus DNA junction fragment that connects concatemers are resolved into linear minichromosomes of vector DNA flanked by hairpin loops. Resolution requires two copies of a specific nucleotide sequence conserved among poxviruses and found proximal to the hairpin loop. This study demonstrates that orientation of each sequence with respect to the other as well as to the axis of symmetry is critical for resolution, the processing of plasmids containing heterologous pairs of resolution sites is influenced by mismatched nucleotides between the sites, and the vaccinia virus hairpin in the linear minichromosome is a heteroduplex composed of DNA from each strand of the concatemer junction. A model incorporating site-specific recombination and orientated branch migration is proposed to account for resolution of the vaccinia virus concatemer junction.     

Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions

The junctions, separating unit-length genomes in intracellular concatemeric forms of vaccinia virus DNA, are duplex copies of the hairpin loops that form the ends of mature DNA molecules present in infectious virus particles. Circular E. coli plasmids with palindromic junction fragments were replicated in vaccinia virus-infected cells and resolved into linear minichromosomes with vector DNA in the center and vaccinia virus DNA hairpins at the two ends. Resolution did not occur when the concatemer joint was less than 250 bp or when plasmids were transfected into uninfected cells, indicating requirements for a specific DNA structure and viral trans-acting factors. These studies indicate that concatemers can serve as replicative intermediates and account for the generation of flip-flop sequence variation of the hairpins at the ends of the mature vaccinia virus genome.     

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Cloning of the vaccinia virus telomere in a yeast plasmid vector

The vaccinia virus DNA telomere, which contains a covalently closed hairpin structure, has been cloned in a yeast plasmid vector. Restriction mapping indicates that the cloned vaccinia telomere is maintained in yeast not in its native hairpin configuration but as an inverted repeat structure, within a circular plasmid, with the sequences of the viral hairpin now at the axis of symmetry of an imperfect palindrome. As such, the cloned telomere resembles the telomeric replicative intermediate observed during vaccinia virus DNA replication. Small deletions and duplications in the viral inverted repeats of different clones suggest a model in which the observed circular plasmids were generated in yeast by the replication of hybrid linear DNA molecules consisting of the linearized yeast vector flanked by two hairpin-containing vaccinia termini.     

A vaccinia virus DNase preparation which cross-links superhelical DNA.

Multiple DNA-dependent enzyme activities have been detected in highly purified preparations of a single-strand-specific nuclease from vaccinia virus. These enzyme preparations were extensively purified and characterized by using superhelical DNAs as substrates. In particular, the nuclease activity was monitored by the extent of conversion of supercoiled closed duplex DNA (DNA I) to nicked circular DNA (DNA II), which could subsequently be converted to duplex linear DNA (DNA III) by prolonged incubation with the enzyme. DNA species which were not substrates for the enzyme included relaxed closed duplex DNA, DNA II which had been prepared by nuclease S1 treatment or by photochemical nicking of DNA I, and DNA III. With plasmid pSM1 DNA as substrate, the extent of cleavage of DNA I to DNA II was found to increase with superhelix density above a threshold value of about -0.06. The linear reaction products were examined by gel electrophoresis after restriction enzyme digestion of the DNAs from plasmids pSM1 and pBR322 and of the viral DNAs from bacteriophage phi X174 (replicative form) and simian virus 40, and the map coordinate locations of the scissions were determined. These products were further examined by electron microscopy and by gel electrophoresis under denaturing conditions. Electron micrographs taken under partially denaturing conditions revealed molecules with terminal loops or hairpins such as would result from the introduction of cross-links at the cutting sites. These species exhibited snapback renaturation. The denaturing gel electrophoresis experiments revealed the appearance of new bands at locations consistent with terminal cross-linking. With pSM1 and pBR322 DNAs, this band was shown to contain DNA that was approximately twice the length of a linear single strand. The terminal regions of the cross-linked linear duplex reaction products were sensitive to nuclease S1 but insensitive to proteinase K, suggesting that the structure is a hairpin loop not maintained by a protein linker. A similar structure is found in mature vaccinia virus DNA.     

Intramolecular homologous recombination in cells infected with temperature-sensitive mutants of vaccinia virus.

I have used a plasmid containing two copies of the Saccharmyces cerevisiae his3 gene to study intramolecular homologous recombination in vaccina virus-infected cells. Recombination of the plasmid was monitored by restriction enzyme digestion and Southern blot hybridization in cells infected with representatives from each of 32 complementation groups of temperature-sensitive mutants ts42 and ts17 did not replicate nor detectably recombine the input plasmid. All except one of the mutants that synthesized normal amounts of viral DNA and protein replicated and recombined the plasmid in a manner indistinguishable from wild-type virus. The remaining mutant, ts13, only poorly replicated and recombined the input plasmid. Thus, the processes of replication and recombination could not be separated by using this battery of mutants. Viral mutants defective in late protein synthesis were unable to resolve the vaccinia virus concatemer junction in plasmids but carried out intramolecular homologous recombination with plasmids as efficiently as did wild-type virus at the conditionally lethal temperature. This result distinguishes homologous recombination, which requires early gene products, from resolution of concatemer junctions, which requires additional late gene products.     

Efficient resolution of replicated poxvirus telomeres to native hairpin structures requires two inverted symmetrical copies of a core target DNA sequence.

The terminal hairpin sequences of the linear double-stranded DNA genome of the leporipoxvirus Shope fibroma virus (SFV) has been cloned in Saccharomyces cerevisiae and in recombination-deficient Escherichia coli as a palindromic insert within circular plasmid vectors. This sequence configuration is equivalent to the inverted repeat structure detected as a telomeric replicative intermediate during poxvirus replication in vivo. Previously, it has been shown that when circular plasmids containing this palindromic insert were transfected into SFV-infected cells, efficient replication and resolution generated linear minichromosomes with bona fide viral hairpin termini (A. M. DeLange, M. Reddy, D. Scraba, C. Upton, and G. McFadden, J. Virol. 59:249-259, 1986). To localize the minimal target DNA sequence required for efficient resolution, a series of staggered unidirectional deletions were constructed at both ends of the inverted repeat. Analyses of the resolution efficiencies of the various clones indicate that up to 240 base pairs (bp) centered at the symmetry axis were required for maximal resolution to minichromosomes. To investigate the role of the AT-rich central axis sequences, which in SFV include 8 nonpalindromic bp, a unique AflII site at the symmetry axis was exploited. Bidirectional deletions extending from this AflII site and insertions of synthetic oligonucleotides into one of the deletion derivatives were constructed and tested in vivo. The efficiency with which these plasmids resolved to linear minichromosomes with hairpin termini has enabled us to define the minimal target DNA sequence as two inverted copies of an identical DNA sequence between 58 and 76 bp in length. The nonpalindromic nucleotides, which, after resolution, constitute the extrahelical residues characteristic of native poxviral telomeres, were not required for resolution. The close resemblance of the SFV core target sequence to the analogous region from the orthopoxvirus vaccinia virus is consistent with a conserved mechanism for poxviral telomere resolution.     

Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression.

Vaccinia virus replicates in the cytoplasm of infected cells, generating transient replicative intermediates containing the DNA for the terminal sequences as concatemeric junctions. The processing of the terminal sequences for a series of vaccinia virus conditional lethal mutants at the nonpermissive temperature was analyzed by restriction enzyme digestion and Southern blot hybridization of DNA isolated from infected cells. Three phenotypes were observed: DNA replication negative (Rep-), DNA replication positive but concatemer resolution negative (Rep+ Res-), and DNA replication positive and concatemer resolution positive (Rep+ Res+). Interestingly, all six Rep+ Res- mutants from separate complementation groups were defective in late protein synthesis. Isatin beta-thiosemicarbazone, a drug that blocks late protein synthesis, also prevented resolution of concatemers. Orthogonal field gel electrophoresis of the DNA generated by the late defective mutants revealed a distribution of linear genome multimers. The multimers were processed into mature monomers after a shift to the permissive temperature in the presence of cytosine arabinoside for all the Rep+ Res- mutants except ts22, an irreversible mutant which cleaves RNA late in infection (R.F. Pacha and R.C. Condit, J. Virol. 56:395-403, 1985). Genome formation can be divided into two stages: DNA replication, which generates concatemers, and resolution, which processes concatemers into monomers with hairpin termini. Early viral genes are required for the former, and late viral genes are required for the latter.     

Hairpin loop structure of African swine fever virus DNA.

The ends of African swine fever virus genome are formed by a 37 nucleotide-long hairpin loop composed, almost entirely, of incompletely paired A and T residues. The loops at each DNA end were present in two equimolar forms that, when compared in opposite polarities, were inverted and complementary (flip-flop), as in the case of poxvirus DNA. The hairpin loops of African swine fever and vaccinia virus DNAs had no homology, but both DNAs had a 16 nucleotide-long sequence, close to the hairpin loops, with an homology of about 80%. An analysis of African swine fever virus replicating DNA showed head-to-head and tail-to-tail linked molecules that may be replicative intermediates.     

DNA Binding and Cleavage by the Fowlpox Virus Resolvase

The first steps of poxvirus DNA synthesis yield concatemeric arrays of covalently linked genomes. The virus-encoded Holliday junction resolvase is required to process concatemers into unit-length genomes for packaging. Previous studies of the vaccinia virus resolvase have been problematic due to poor protein solubility. We found that fowlpox virus resolvase was much more tractable. Fowlpox resolvase formed complexes with a variety of branched DNA substrates, but not linear DNA, and had the highest affinity for a Holliday junction substrate, illustrating a previously unappreciated affinity for Holliday junctions over other substrates. The cleavage activity was monitored in fixed time assays, showing that, as with vaccinia resolvase, the fowlpox enzyme could cleave a wide array of branched DNA substrates. Single turnover kinetic analysis revealed the Holliday junction substrate was cleaved 90-fold faster than a splayed duplex substrate containing a single to double strand transition. Multiple turnover kinetic analysis, however, showed that the cleavage step was not limiting for the full reaction cycle. Cleavage by resolvase was also tightly coupled at symmetrical positions across the junction, and coupling required the complete Holliday junction structure. Last, we found that cleavage of an extruded cruciform yielded a product, which after treatment with ligase, had the properties expected for covalently closed DNA hairpin ends, as is seen for poxvirus genome monomers. These findings provide a tractable poxvirus resolvase usable for the development of small molecule inhibitors.Poxvirus DNA replication is proposed to proceed by a “rolling hairpin” mechanism to yield linear concatemers, in which genomes are arranged in mostly head-to-head and tail-to tail orientation (Fig. 1, step 1) (1). The terminal sequences at each junction form an inverted repeat, which can be extruded to form a cruciform structure (step 2) (2). Cleavage of the resulting Holliday junctions on each end frees the monomer genome from the concatemer (step 3). The nicks left behind after resolution of the Holliday junction can then be ligated, yielding the hairpin DNA ends characteristic of poxviruses (step 4).Open in a separate windowFIGURE 1.Role of poxvirus resolvase during viral replication. Black lines indicate single DNA strands. Half-arrows indicate repeated sequences. Small arrows indicate resolvase cleavage sites. 1) Poxvirus genome replication yields concatemers; 2) inverted repeat sequences at concatemer junctions extrude to form cruciform structures; 3) Holliday junction cleavage by resolvase at cruciform structures yields unit-length genomes with preserved hairpin ends; 4) ligase seals nicks to yield mature genome monomers.The vaccinia virus resolvase gene, A22R, was first recognized in bioinformatic surveys to encode a member of the RNase H superfamily of polynucleotide phosphotransfer enzymes (3). These enzymes catalyze attack of a hydroxyl group on a phosphodiester bond, thereby supporting a variety of nuclease or DNA joining reactions. Garcia et al. (3) purified recombinant vaccinia resolvase and showed that it displayed cleaving activity on model Holliday junctions. They also generated a conditional A22R recombinant vaccinia virus and showed that in the absence of A22R expression, vaccinia failed to replicate and concatemer junctions accumulated, indicating that A22 resolvase indeed is required for concatemer resolution in vivo (4). Subsequent studies by Garcia et al. (5) and Culyba et al. (6) showed that vaccinia resolvase had little sequence specificity, and that cleavage yielded a 3′-hydroxyl group suitable for subsequent DNA ligation. Culyba et al. (7) also showed that several further branched DNA molecules could be cleaved by vaccinia resolvase, establishing that the enzyme could potentially process a variety of branched DNA forms expected to arise during recombination or replication, suggesting possible additional roles for poxvirus resolvase.Progress in studying poxvirus resolvase has been limited by the poor solubility of the purified vaccinia protein. For example, in Garcia et al. (5), the vaccinia resolvase was fused to maltose-binding protein to improve solubility, but consequently the properties of the maltose-binding protein portion of the fusion must be considered in interpreting the results. Pilot studies from our laboratory showed that the insolubility and low activity of the vaccinia virus resolvase precluded its use in high-throughput screens for inhibitors (data not shown).In an effort to identify a more tractable poxvirus resolvase protein, we attempted to clone four other poxvirus resolvase genes and purify the gene products after overexpression in bacteria. We found that the fowlpox resolvase was much more soluble and active than the others tested. Analysis of cleavage revealed that a wide range of branched DNA forms were substrates, paralleling results with vaccinia resolvase and establishing that these activities are a conserved property of poxvirus resolvases. Binding analysis on these same DNA forms also revealed a strict specificity for branched DNA, with the highest affinity binding for the Holliday junction, suggesting that DNA binding specificity is the major discriminatory mechanism for DNA cleavage activity. Kinetic analysis was feasible with fowlpox resolvase, allowing us to show that the first-order rate constant for strand cleavage under single turnover conditions is 90-fold greater for a Holliday junction substrate than for a splayed duplex substrate. However, this rate constant was not limiting for the Holliday junction under multiple turnover conditions, where the rate of strand cleavage is 1.9-fold slower for the Holliday junction than for the splayed duplex. Last, we show that fowlpox resolvase cleavage at Holliday junctions is coupled, so that nicking on one strand also promoted nicking on the strand located across the junction from it. These studies indicate that fowlpox resolvase is well suited to in vitro analysis and suggests approaches to high-throughput screening for resolvase inhibitors.     

Cruciform-resolvase interactions in supercoiled DNA

T4 endonuclease VII, which cleaves Holliday-like junctions in DNA, specifically cleaves short inverted repeats in supercoiled plasmids. These sequences are subject to site-specific cleavage by single-strand-specific nucleases, and cruciform formation has been suggested as an explanation for this observation. This proposal is greatly strengthened by the present data, since a formal analogy between cruciform structures and Holliday junctions exists. Resolution of a variety of unrelated cruciform sequences demonstrates that the cleavage process results in a linear molecule with hairpin ends and single ligatable nicks at positions corresponding to the stem-base of the cruciform. In two examples mapped in detail, the cleavages are exclusively introduced at two or three nucleotides from the end of the symmetric sequence at the 5' side on each strand. These studies demonstrate the potential of endonuclease VII as a probe of cruciform structure and the utility of short cruciform structures as Holliday junction models.     

Shope fibroma virus DNA topoisomerase catalyses holliday junction resolution and hairpin formation in vitro

The telomeres of poxviral chromosomes comprise covalently closed hairpin structures bearing mismatched bases. These hairpins are formed as concatemeric replication intermediates and are processed into mature, unit-length genomes. The structural transitions and enzymes involved in telomere resolution are poorly understood. Here we show that the type I topoisomerase of Shope fibroma virus (SFV) can promote a recombination reaction which converts cloned SFV replication intermediates into hairpin-ended molecules resembling mature poxviral telomeres. Recombinant SFV topoisomerase linearised a palindromic plasmid bearing 1.5 kb of DNA encoding the SFV concatemer junction, at a site near the centre of inverted-repeat symmetry. Most of these linear reaction products bore hairpin tips as judged by denaturing gel electrophoresis. The resolution reaction required palindromic SFV DNA sequences and was inhibited by compounds which block branch migration (MgCl2) or poxviral topoisomerases. The resolution reaction was also slow, needed substantial quantities of topoisomerase, and required that the palindrome be extruded in a cruciform configuration. DNA cleavage experiments identified a pair of suitably oriented topoisomerase recognition sites, 90 bases from the centre of the cloned SFV terminal inverted repeat, which may mark the resolution site. These data suggest a resolution scheme in which branch migration of a Holliday junction through a site occupied by covalently bound topoisomerase molecules, could lead to telomere resolution.     

Patterns of integration of DNA microinjected into cultured mammalian cells: evidence for homologous recombination between injected plasmid DNA molecules.

We examined the fate of DNA microinjected into nuclei of cultured mammalian cells. The sequence composition and the physical form of the vector carrying the selectable gene affected the efficiency of DNA-mediated transformation. Introduction of sequences near the simian virus 40 origin of DNA replication or in the long terminal repeat of avian sarcoma provirus into a recombinant plasmid containing the herpes simplex virus thymidine kinase gene. (pBR322/HSV-tk) enhanced the frequency of transformation of LMtk- and RAT-2tk- cells to the TK+ phenotype 20- to 40-fold. In cells receiving injections of only a few plasmid DNA molecules, the transformation frequency was 40-fold higher after injection of linear molecules than after injection of supercoiled molecules. By controlling the number of gene copies injected into a recipient cell, we could obtain transformants containing a single copy or as many as 50 to 100 copies of the selectable gene. Multiple copies of the transforming gene were not scattered throughout the host genome but were integrated as a concatemer at one or a very few sites in the host chromosome. Independent transformants contained the donated genes in different chromosomes. The orientation of the gene copies within the concatemer was not random; rather, the copies were organized as tandem head-to-tail arrays. By analyzing transformants obtained by coinjecting two vectors which were identical except that in one a portion of the vector was inverted, we were able to conclude that the head-to-tail concatemers were generated predominantly by homologous recombination. Surprisingly, these head-to-tail concatemers were found in transformants obtained by injecting either supercoiled or linear plasmid DNA. Even though we demonstrated that cultured mammalian cells contain the enzymes for ligating two DNA molecules very efficiently irrespective of the sequences or topology at their ends, we found that even linear plasmid DNA was recruited into the concatemer by homologous recombination.     

Replication and resolution of cloned poxvirus telomeres in vivo generates linear minichromosomes with intact viral hairpin termini.

The covalently closed terminal hairpins of the linear duplex-DNA genomes of the orthopoxvirus vaccinia and the leporipoxvirus Shope fibroma virus (SFV) have been cloned as imperfect palindromes within circular plasmids in yeast cells and recombination-deficient Escherichia coli. The viral telomeres inserted within these recombinant plasmids are equivalent to the inverted-repeat structures detected as telomeric replicative intermediates during poxvirus replication in vivo. Although the telomeres of vaccinia and SFV show little sequence homology, the termini from both viral genomes exist as AT-rich terminal hairpins with extrahelical bases and alternate "flip-flop" configurations. Using an in vivo replication assay in which circular plasmid DNA was transfected into poxvirus-infected cells, we demonstrated the efficient replication and resolution of the cloned imperfect palindromes to bona fide hairpin termini. The resulting linear minichromosomes, which were readily purified from transfected cells, were shown by restriction enzyme mapping and by electron microscopy to have intact covalently closed hairpin termini at both ends. In addition, staggered unidirectional deletion derivatives of both the cloned vaccinia and SFV telomeric palindromes localized an approximately 200-base-pair DNA region in which the sequence organization was highly conserved and which was necessary for the resolution event. These data suggest a conserved mechanism of the resolution of poxvirus telomeres.     

S1 sensitive sites in adenovirus DNA.

S1 nuclease has been used as a probe for regions of DNA secondary structure in supercoiled recombinant plasmids containing adenovirus (Ad) DNA sequences. In the sequences examined two S1 sensitive sites were identified in the left-terminal 16.5% of Ad 12 DNA, one of which aligned approximately with an inverted repeat region in the DNA sequence. In addition an S1 sensitive site was dictated by a potential cruciform structure in the region of the Ad 2 major late promoter. In contrast to the expected cleavage site at the loop of the cruciform, cleavage occurred at the base of the stem in the region of the TATA box. All three S1 sensitive sites identified were more sensitive to S1 than the endogenous sites in the parent plasmids.     

Cruciform extrusion in plasmids bearing the replicative intermediate configuration of a poxvirus telomere

The transition from lineform DNA to cruciform DNA (cruciformation) within the cloned telomere sequences of the Leporipoxvirus Shope fibroma virus (SFV) has been studied. The viral telomere sequences have been cloned in recombination-deficient Escherichia coli as a 322 base-pair, imperfect palindromic insert in pUC13. The inverted repeat configuration is equivalent to the arrangement of the telomere structures observed within viral DNA replicative intermediates. A major cruciform structure in the purified recombinant plasmid has been identified and mapped using, as probes, the enzymes AflII, nuclease S1 and bacteriophage T7 endonuclease I. It was extruded from the central axis of the cloned viral inverted repeat and, by unrestricted branch migration, attained a size commensurate with the superhelical density of the plasmid molecule at native superhelical densities. This major cruciform extrusion event was the only detectable duplex DNA perturbation, induced by negative superhelical torsion, in the insert viral sequences. No significant steady-state pool of extruded cruciform was identified in E. coli. However, the identification of a major deletion variant generated even in the recombination-deficient E. coli strain DB1256 (recA recBC sbcB) suggested that the cruciform may be extruded transiently in vivo. The lineform to cruciform transition has been further characterized in vitro using two-dimensional agarose gel electrophoresis. The transition was marked by a high energy of formation (delta Gf = 44 kcal/mol), and an apparently low activation energy that enabled facile transitions at physiological temperatures provided there was sufficient torsional energy. By comparing cruciformation in a series of related bidirectional central axis deletions of the telomeric insert, it has been concluded that the presence of extrahelical bases in the terminal hairpin structures contributes substantially to the high delta Gf value. Also, viral sequences flanking the extruded cruciform were shown to influence the measured delta Gf value. Several general features of poxvirus telomere structure that would be expected to influence the facility of cruciform extrusion are discussed along with the implications of the observed cruciform transition event on the replicative process of poxviruses in vivo.     

Cruciform DNA structure underlies the etiology for palindrome-mediated human chromosomal translocations

There is accumulating evidence to suggest that palindromic AT-rich repeats (PATRRs) represent hot spots of double-strand breakage that lead to recurrent chromosomal translocations in humans. As a mechanism for such rearrangements, we proposed that the PATRR forms a cruciform structure that is the source of genomic instability. To test this hypothesis, we have investigated the tertiary structure of a cloned PATRR. We have observed that a plasmid containing this PATRR undergoes a conformational change, causing temperature-dependent mobility changes upon agarose gel electrophoresis. The mobility shift is observed in physiologic salt concentrations and is most prominent when the plasmid DNA is incubated at room temperature prior to electrophoresis. Analysis using two-dimensional gel electrophoresis indicates that the mobility shift results from the formation of a cruciform structure. S1 nuclease and T7 endonuclease both cut the plasmid into a linear form, also suggesting cruciform formation. Furthermore, anti-cruciform DNA antibody reduces the electrophoretic mobility of the PATRR-containing fragment. Finally, we have directly visualized cruciform extrusions from the plasmid DNA with the size expected of hairpin arms using atomic force microscopy. Our data imply that for human chromosomes, translocation susceptibility is mediated by PATRRs and likely results from their unstable conformation.     

Large-scale stable opening of supercoiled DNA in response to temperature and supercoiling in (A + T)-rich regions that promote low-salt cruciform extrusion.

We have studied the properties of (A + T)-rich sequences derived from ColE1 that promote cruciform extrusion at low ionic strength in supercoiled plasmids. We compared the chemical reactivity of the sequences in negatively supercoiled DNA (using osmium tetroxide and bromoacetaldehyde) with the results of two-dimensional gel electrophoresis performed under the same conditions. Taken together, the results indicate the occurrence of cooperative helix-coil transitions in the (A + T)-rich DNA at low ionic strength, to form stable, denatured regions. The extent of the open region is a function of temperature and superhelix density, with an additional local destabilization brought about by the presence of cruciform structures. We present a simple statistical mechanical model of the helix-coil transition in the (A + T)-rich DNA, from which we have obtained estimates of the free energy for average base-pair opening of 0.31 kcal mol-1 and that for the formation of a helix-coil junction of 4.9 kcal mol-1, in 45 mM Tris-borate, pH 8.3, 0.5 mM EDTA. The results offer a model for the C-type mechanism of cruciform extrusion. Inverted repeats that are incorporated into the melted region undergo hairpin loop formation below 50 degrees C, and upon closure of the melted region, by reduction of temperature or increased ionic strength, they remain as a fully extruded cruciform structure.