Synthesis and application of a novel, crystalline phosphoramidite monomer with thiol terminus, suitable for the synthesis of DNA conjugates

A new, crystalline 5'-thiol modifier phosphoramidite monomer (3), suitable for DNA synthesis, has been prepared. This monomer has been built into an oligonucleotide using the standard protocol. After cleavage, purification and removal of the trityl group with Ag(+), a free 5'-thiol terminal oligonucleotide (15) has been obtained which was subsequently coupled to a cysteine derivative via a disulfide bridge to afford conjugate 16.     

A novel solid support for synthesis of oligonucleotide 3'-phosphorothioate monoesters

A new reagent immobilized on solid support allowing for solid-phase synthesis of oligonucleotides with a 3'-terminal phosphorothioate monoester is described. The support is compatible with phosphoramidite chemistry for automated oligonucleotide synthesis. Final deprotection with ammonia under standard conditions leads to oligonucleotide 3'-terminal phosphorothioate.     

A convenient solid-phase method for synthesis of 3'-conjugates of oligonucleotides.

We present a new procedure for the preparation of 3'-conjugates of oligonucleotides through solid-phase synthesis. A suitable universal solid support was readily prepared using a series of peptide-like coupling reactions to incorporate first a spacer and then an L-homoserine branching unit. The N-alpha-position of the homoserine carries an Fmoc protecting group that is removed by treatment with piperidine to liberate an amino group suitable for attachment of the conjugate (e.g., small organic molecule, fluorescent group, cholesterol, biotin, amino acid, etc.) or for assembly of a short peptide. The side-chain hydroxyl group of the homoserine carries a trityl protecting group. After TFA deprotection, the hydroxyl group acts as the site for oligonucleotide assembly. An additional spacer, such as aminohexanoyl, may be incorporated easily between the conjugate molecule and the oligonucleotide. A number of examples of synthesis of 3'-conjugates of oligonucleotides and their analogues are described that involve standard automated oligonucleotide assembly and use of commercially available materials. The linkage between oligonucleotide and 3'-conjugate is chirally pure and is stable to conventional ammonia treatment used for oligonucleotide deprotection and release from the solid support. The homoserine-functionalized solid support system represents a simple and universal route to 3'-conjugates of oligonucleotides and their derivatives.     

A new method for introducing amidate linkages in oligonucleotides using phosphoramidite chemistry.

Cyanoethyl-protected phosphotriester links in oligonucleotides made with standard pophosporamidite chemistry were converted to pbosphoramidate linkages during oligonucleotide synthesis on solid support. The cyanoethyl group was removed with piperidine, and the resulting phosphodiester was activated with p-tosyl chloride. An amine nucleophile displaced the tosyl to yield a phosphoramidate linkage.     

Further improvements on the phosphotriester synthesis of deoxyribooligonucleotides and the oligonucleotide directed site-specific mutagenesis of E. coli lipoprotein gene.

Two improvements that greatly enhance the rate of phosphotriester oligonucleotide synthesis are described: 1) use of hindered primary amines, e.g. t-butyl amine for decyanoethylation of oligonucleotide triester intermediates, and 2) a simplified isolation procedure that eliminates the tedious bicarbonate extraction after each condensing reaction. Using the improved procedures, oligonucleotide fragments can be synthesized as rapidly as using solid phase chemistry. The final products are purer than those obtained by solid phase chemistry since each intermediate block is purified by chromatography. The technique has been used to synthesize five oligonucleotide fragments (size 15 to 20) for the purpose of performing guided site-specific mutagenesis on a cloned E. coli lipoprotein gene.     

The synthesis of polyamide-oligonucleotide conjugate molecules.

We have developed methods for the synthesis of peptide-oligodeoxyribonucleotide conjugate molecules in particular, and polyamide-oligonucleotide conjugates in general. Synthesis is carried out by a solid-phase procedure and involves the assembly of a polyamide on the solid support, conversion of the terminal amino group to a protected primary aliphatic hydroxy group by reaction with alpha, omega-hydroxycarboxylic acid derivatives, and finally oligonucleotide synthesis using phosphoramidite chemistry. The conjugate molecules can be used as DNA probes, with the polyamide component carrying one or more non-radioactive markers. These conjugates also have the potential to be used as anti-sense inhibitors of gene expression, with the peptide segment acting as a targeting moiety.     

Synthesis of high quality phosphorothioate oligonucleotides as antisense drugs. Use of I-linker in the elimination of 3'-terminal phosphorothioate monoesters

Detritylation of a 5'-O-DMT-2'-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3'-terminal phosphorothiaote (3'-TPT) monoester (n-1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3'-TPT formation thereby improving the quality of oligonucleotide synthesized.     

A general method for the synthesis of 3''-sulfhydryl and phosphate group containing oligonucleotides.

The syntheses are described of polymer supports useful for the synthesis of 3'-partially protected sulfhydryl, free sulfhydryl or phosphate group containing oligonucleotides. The supports are compatible with established phosphoramidite chemistry of oligonucleotide synthesis giving rise to oligonucleotides with terminal 3'-partially protected sulfhydryl, free sulfhydryl or phosphate function during final deprotection. Crosslinking of the thiol group containing oligonucleotide to sulfhydryl group specific fluorescent probes was carried out with high selectivity, in high yields under mild conditions. 3-Aminopropylated Controlled Pore Glass (CPG) was succinylated with succinic anhydride followed by the reaction with S-(2-thio-5-nitropyridyl)-2-mercaptoethanol in the presence of dicyclohexylcarbodiimide (DCC). The resultant polymer support was reacted with 4,4'-dimethoxytrityloxyalkanthiol 5(a - c) to yield the derivatized polymer supports 5(a - c). The support 5a directly leads to oligonucleotide-3'-phosphate on deprotection with ammonical DTT at 55 degrees C while the supports 5b and 5c lead to oligonucleotide-3'-thiols or partially protected 3'-sulfhydryl group containing oligonucleotides during final deprotection.     

Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups.

Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates.     

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.     

Synthesis and properties of oligodeoxyribonucleotide-polyethylene glycol conjugates.

Pools of oligonucleotide conjugates consisting of 10-400 different molecular species were synthesized. The conjugates contained a varying number of ethylene glycol units attached to 3'-terminal, 5'-terminal and internal positions of the oligonucleotides. Conjugate synthesis was performed by phosphoramidite solid phase chemistry using suitably protected polyethylene glycol phosphoramidites and PEG-derivatized solid supports containing polydisperse PEGs of various molecular weight ranges. The pools were analyzed and fractionated by chromatographic and electrophoretic techniques, and the composition of isolated conjugates was revealed by matrix-assisted laser desorption/ionization mass spectrometry. The number and attachment sites of coupled ethylene glycol units greatly influence the hydrophobicity of the conjugates, as well as their electrophoretic mobilities. Conjugation had little effect on the hybridization behavior of oligonucleotide conjugates with unmodified complementary oligonucleotide strands. Melting temperatures were between 67 and 73 degrees C, depending on the size and number of coupled PEG chains, compared to 68 degrees C for the unmodified duplex. Conjugates with PEG coupled to both 3'- and 5'-terminal positions showed a more than 10-fold increase in exonuclease stability.     

Synthesis of High Quality Phosphorothioate Oligonucleotides as Antisense Drugs. Use of I-Linker in the Elimination of 3′-Terminal Phosphorothioate Monoesters

Abstract

Detritylation of a 5′-O-DMT-2′-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3′-terminal phosphorothiaote (3′-TPT) monoester (n?1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3′-TPT formation thereby improving the quality of oligonucleotide synthesized.     

Preactivated carboxyl linker for the rapid conjugation of alkylamines to oligonucleotides on solid support

A C10 linker phosphoramidite reagent terminated with a succinimidyl-activated carboxyl group was prepared and used to couple to the 5'-end of an oligonucleotide synthesized on a solid support. The succinimidyl-activated carboxyl functionality can be used for rapid conjugation of amines to oligonucleotides on solid support or it can be hydrolyzed to form a carboxylic acid functionality. The activated linker was successfully used for conjugation of several primary and secondary aliphatic amine derivatives (including biotin and fluorescein cadaverine) onto a solid support-bound 12-mer DNA oligonucleotide at scales ranging from 0.15 to 1.0 micromol. The overall yields of the conjugation products after AMA deprotection and cleavage from the solid support ranged from 43 to 75% of the total oligonucleotide product. This value is significant, as it includes oligonucleotide synthesis, coupling of the linker, and conjugation of the amine. In addition, the entire process of oligonucleotide synthesis, linker coupling, amine conjugation, deprotection, and cleavage of the oligonucleotide from solid support can be accomplished in 1 day.     

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.     

Synthesis of 3'-thioribonucleosides and their incorporation into oligoribonucleotides via phosphoramidite chemistry.

Oligoribonucleotides containing 3'-S-phosphorothiolate linkages are valuable probes in nucleic acid biochemistry, but their accessibility has been limited because 3'-thioribonucleoside phosphoramidites have not been available. We synthesized 3'-thioribonucleoside derivatives (C, G, and U) via glycosylations of nucleoside bases with 3-S-thiobenzoyl-5-O-toluoyl-1,2-O-diacetylfuranose 5, which was obtained from 1 ,2-O-isopropylidene-5-O-toluoyl-3-trifluoromethane-sulfonyl-alpha-D-x ylofuranose 2 by SN2 displacement with sodium thiobenzoate. Additionally, a 3'-thioinosine derivative was prepared from inosine via direct modification of the ribose, analogous to the previously reported synthesis of 3'-thioadenosine, except that the intermediate 2',3'-epoxide 9 was first protected as the 5'-O-tert-butyldiphenylsilyl ether prior to subsequent synthetic steps. This hydrophobic silyl group facilitated extraction and isolation of synthetic intermediates. After removal of the protecting groups, the 3'-thionucleosides (C, G, U, and I) were treated with 2,2'-dipyridyl disulfide to protect the free thiol group as a disulfide. The 3'-thionucleosides were converted to the corresponding phosphorothioamidites using procedures analogous to those for standard phosphoramidites. The amino groups of 3'-thiocytidine and 3'-thioguanosine were protected as benzoyl and isobutyryl amides, respectively, and the 5'- and 2'-hydroxyl groups of each nucleoside were protected as dimethoxytrityl and tert-butyldimethylsilyl ethers, respectively. The 3'-thiol group was deprotected by reduction with DTT and phosphitylated to afford analytically pure 3'-S-phosphorothioamidites 15, which were incorporated into oligoribonucleotides by solid-phase synthesis. Chemical assays and mass spectrometry of the synthetic RNA showed that ribose-3'-S-phosphorothiolate linkages were installed correctly and efficiently into RNA oligonucleotides using phosphoramidite chemistry.     

Dimethoxytrityl Removal in Organic Medium: Efficient Oligonucleotide Synthesis Without Chlorinated Solvents

Abstract

Oligonucleotides are finding widespread utility in various applications in diagnostics and molecular biology and as therapeutic agents. In standard synthesis of such oligonucleotides through phosphoramidite coupling, removal of the typical acid-labile 4,4′-dimethoxytrityl 5′-protecting group (DMTr), from the support-bound oligonucleotide plays a crucial role in each synthesis cycle in achieving high product yield and oligonucleotide quality. Although several reagents have been developed for this purpose, many have limited applicability to automated oligonucleotide synthesis on solid supports. The most commonly used reagents today are dilute solutions (2–15%) of an organic acid, typically trichloroacetic acid (TCA, pKa 0.8) or dichloroacetic acid (DCA, pKa 1.5) in dichloromethane. The high volatility (boiling point 40 °C) of dichloromethane and its high toxicity and carcinogenicity pose a hazard for personnel and the environment. In addition, as oligonucleotide synthesizers are now available to allow syntheses of up to 0.5 mole scale, the quantities of chlorinated waste generated have become quite large. In this context we became interested in replacing dichloromethane as deblocking reagent solvent with a less harmful solvent while preserving product yield and quality. We now report that it is not necessary to use halogenated solvents such as dichloromethane in the deblocking step of automated oligonucleotide synthesis in order to obtain high yields of high quality oligonucleotide product.     

Immobilization of acrylamide-modified oligonucleotides by co-polymerization.

A flexible chemistry for solid phase attachment of oligonucleotides is described. Oligonucleotides bearing 5'-terminal acrylamide modifications efficiently co-polymerize with acrylamide monomers to form thermally stable DNA-containing polyacrylamide co-polymers. Co-polymerization attachment is specific for the terminal acrylamide group. Stable probe-containing layers are easily fabricated on supports bearing exposed acrylic groups, including plastic microtiter plates and silanized glass. Attachment can be accomplished using standard polyacrylamide gel recipes and polymerization techniques. Supports having a high surface density of hybridizable oligonucleotide (approximately 200 fmol/mm2) can be produced.     

The synthesis of oligonucleotides containing an aliphatic amino group at the 5'' terminus: synthesis of fluorescent DNA primers for use in DNA sequence analysis.

A rapid and versatile method has been developed for the synthesis of oligonucleotides which contain an aliphatic amino group at their 5' terminus. This amino group reacts specifically with a variety of electrophiles, thereby allowing other chemical species to be attached to the oligonucleotide. This chemistry has been utilized to synthesize several fluorescent derivatives of an oligonucleotide primer used in DNA sequence analysis by the dideoxy (enzymatic) method. The modified primers are highly fluorescent and retain their ability to specifically prime DNA synthesis. The use of these fluorescent primers in DNA sequence analysis will enable DNA sequence analysis to be automated.     

Thermolytic release of covalently linked DNA oligonucleotides and their conjugates from controlled-pore glass at near neutral pH

The functionalization of long chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and its conversion to the support 7 has led to the synthesis of DNA oligonucleotides and their 3'- or (3',5')-conjugates. Indeed, CPG support 7 has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. Unlike conventional succinylated CPG supports, this distinctively functionalized support allows oligonucleotide deprotection and removal of the deprotection side products to proceed without releasing the oligonucleotide into the aqueous milieu. When freed from deprotection side products, the DNA oligonucleotide is thermolytically released from the support within 2 h under nearly neutral conditions (pH 7.2, 90 degrees C). The quality of these oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated CPG supports in terms of shorter than full length oligonucleotide contaminants and overall yields. The versatility of the thermolytic CPG support 7 is further demonstrated by the synthesis of a DNA oligonucleotide (20-mer) and its conjugation with an azido and alkynyl groups at both 5'-and 3'-termini, respectively. The functionality of the (3',5')-heteroconjugated oligonucleotide 18 is verified by its circularization to the DNA oligonucleotide 19 under "click" chemistry conditions.     

Introduction of 5′-Terminal Amino and Thiol Groups into Synthetic Oligonucleotides

Abstract

Oligonucleotides terminating in a 5′-primary amine group are synthesized using solid phase phosphoramidite chemistry. The 5′-terminal amine group in the deprotected oligonucleotide is further derivatized with N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP) followed by treatment with dithiothreitol (DTT) to produce 5′-thiol terminated oligonucleotides. Introduction of 5′-thiol group is further confirmed by reading the absorbance of the released chromophore, pyridine-2-thione at 343 nm; ?₃₄₃=8080/M.