NMR distance measurements in DNA duplexes: sugars and bases have the same correlation times

To evaluate whether the sugar moieties of short DNA duplexes exhibit local motion of sufficient amplitude to affect interproton distance measurements, we have carried out a series of time-dependent NOESY experiments at increasingly shorter mixing times on dodecamer DNA duplexes. By use of the cytosine H5-H6 vector as a known distance in the bases and the geminal 2'H-2'H vector as a known distance in the sugars, the corresponding apparent cross-relaxation rates were sampled at various mixing times. While the ratio of the inverse sixth power of these two fixed distances is in the range 6-7, when the system is sampled at 100 ms the apparent initial rate of growth of the 2'H-2'H NOESY crosspeak is only 1.9-2.0 times faster than that of the H5-H6 crosspeak--in agreement with the results of Clore and Gronenborn [Clore, G. M., & Gronenborn, A. M. (1984) FEBS Lett. 172, 219; (1984) FEBS Lett. 175, 117] and of Gronenborn and Clore [Gronenborn, A. M., & Clore, G. M. (1985) Prog. NMR Spectrosc. 17, 1]. This observation was interpreted to indicate the existence of internal mobility with a 3-fold shorter correlation time for the sugar moieties in DNA and led to the use of this shorter correlation time to estimate sugar-sugar proton distances and many sugar-base proton distances in subsequent DNA structure determination. We have examined 2'H-2"H cross-relaxation and H5-H6 cross-relaxation at 100, 90, 60, 30, and 15 ms in dodecamer DNA duplexes.(ABSTRACT TRUNCATED AT 250 WORDS)     

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.     

Characterization of the overall and internal dynamics of short oligonucleotides by depolarized dynamic light scattering and NMR relaxation measurements

The dynamics of three synthetic oligonucleotides d(CG)4, d(CG)6, and d(CGCGTTGTTCGCG) of different length and shape were studied in solution by depolarized dynamic light scattering (DDLS) and time-resolved nuclear Overhauser effect cross-relaxation measurements. For cylindrically symmetric molecules the DDLS spectrum is dominated by the rotation of the main symmetry axis of the cylinder. The experimental correlation times describe the rotation of the oligonucleotides under hydrodynamic stick boundary conditions. It is shown that the hydrodynamic theory of Tirado and Garcia de la Torre gives good predictions of the rotational diffusion coefficients of cylindrically symmetric molecules of the small axial ratios studied here. These relations are used to calculate the solution dimensions of the DNA fragments from measured correlation times. The hydrodynamic diameter of the octamer and dodecamer is 20.5 +/- 1.0 A, assuming a rise per base of 3.4 A. The tridecamer, d(CGCGTTGTTCGCG), adopts a hairpin structure with nearly spherical dimensions and a diameter of 23.0 +/- 2.0 A. The DDLS relaxation measurements provide a powerful method for distinguishing between different conformations of the oligonucleotides (e.g., DNA double-helix versus hairpin structure). Furthermore, the rotational correlation times are a very sensitive probe of the length of different fragments. The NMR results reflect the anisotropic motion of the molecules as well as the amount of local internal motion present. The experimental correlation time from NMR is determined by the rotation of both the short and long axes of the oligonucleotide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Electro-optical analysis of 'curved' DNA fragments

The structure of some 'short' DNA fragments with 106-108 base-pairs and of a 'long' kinetoplast DNA fragment with 419 base-pairs has been analyzed by electro-optical procedures. According to their electrophoretic mobilities and circularization probabilities, it was concluded that two of our short fragments with clusters of four and five and six adenosines phased at the period of the double helix are inherently curved with an approximate curvature around 200 degrees. The dichroism decay curves of our short fragments exhibited two processes. A fast one with time constants of approx. 100 ns is attributed to bending; the bending amplitudes observed for the fragments with dA4 and dA5/6 clusters are slightly higher (23 and 29%, respectively) than those observed for control fragments (17-20%). The second process reflects the overall rotational diffusion of the whole fragments and shows some variation with the DNA sequence, but on average the rotation of fragments with dA4 and dA5/6 clusters corresponds to that observed for standard DNA. Since the rotational diffusion coefficients are very strongly dependent on the effective hydrodynamic lengths, we must conclude that the effective lengths of our fragments, including the 'curved' ones, are very similar under the conditions of our experiments. The rotation time constant for the long kinetoplast DNA is also rather close to those observed for the usual DNA fragments of corresponding length. One way to resolve the conflict of our results with conclusions obtained from other investigations would invoke the assumption that the curved fragments are not 'elastic'. According to this hypothesis, electric field pulses would stretch the curved fragments to an almost straight form and the stretched DNA would return to its equilibrium state with a time constant longer than the rotation time constant.     

Rotational dynamics of transfer ribonucleic acid: effect of ionic strength and concentration

We have investigated the influence of ionic strength and nucleic acid concentration on the rotational Brownian motion of Escherichia coli tRNA1Val by studying the decay of the fluorescence polarization anisotropy (FPA) of intercalated ethidium on a nanosecond time scale. The rotational relaxation time tau R remains essentially constant as the ionic strength is varied from 2 to 100 mM at a tRNA concentration of 54 mg/mL. tau R also remains practically unchanged as the tRNA concentration is varied from 0.3 to 54 mg/mL at an ionic strength of 130 mM. Present hydrodynamic theories generally predict a more pronounced concentration dependence for rotational diffusion than we observe. This disagreement may result from a nonrandom distribution of the tRNA molecules in solution due to electrostatic interactions. By combining independent data from time-resolved nuclear Overhauser effect (NOE) cross-relaxation experiments and FPA experiments on the same tRNA, we are able to estimate the interproton spacing for the guanine N1-H and the uracil N3-H of the GU-50 base pair in E. coli tRNA1Val. This distance is 0.272 nm.     

Transient electric birefringence study of the length and stiffness of short DNA restriction fragments

Transient electric birefringence measurements of the rotational diffusion constant of five short restriction fragments of the plasmid pBR322 show that the hydrodynamic length is independent of sodium ion concentration in the range of 0.2 to 2.5 mM. The fragments are too stiff to be modeled as wormlike molecules. The rotational relaxation times of the fragments, which range from 64 to 124 base pairs, have been used to calculate the rise per base pair using six different theoretical expressions for the length dependence of the rotational diffusion coefficient of straight cylinder. The best estimate for the rise per base pair of Na-DNA in solution is 3.3 ± 0.1 Å.     

Structure determination of a DNA octamer in solution by NMR spectroscopy. Effect of fast local motions.

NMR structures of biomolecules are primarily based on nuclear Overhauser effects (NOEs) between protons. For the interpretation of NOEs in terms of distances, usually the assumption of a single rotational correlation time corresponding to a rigid molecule approximation is made. Here we investigate the effect of fast internal motions of the interproton vectors in the context of the relaxation matrix approach for structure determination of biomolecules. From molecular dynamics simulations generalized order parameters were calculated for the DNA octamer d(GCGTTCGC).d(CGCAACGC), and these were used in the calculation of NOE intensities. The magnitudes of the order parameters showed some variation for the different types of interproton vectors. The lowest values were observed for the interresidue base H6/H8-H2" proton vectors (S2 = 0.60), while the cytosine H5-H6 interproton vectors were among the most motionally restricted (S2 = 0.92). Inclusion of the motion of the interproton vectors resulted in a much better agreement between theoretically calculated NOE spectra and the experimental spectra measured by 2D NOE spectroscopy. The interproton distances changed only slightly, with a maximum of 10%; nevertheless, the changes were significant and resulted in constraints that were better satisfied. The structure of the DNA octamer was determined by using restrained molecular dynamics simulations with H2O as a solvent, with and without the inclusion of local internal motions. Starting from A- or B-DNA, the structures showed a high local convergence (0.86 A), while the global convergence for the octamer was ca. 2.6 A.     

Internal mobility in a double-stranded B DNA hexamer and undecamer. A time-dependent proton-proton nuclear Overhauser enhancement study

The internal mobility of the deoxyribose H2'-H2" and base C(H5)-C(H6) and T(CH3)-T(H6) vectors has been investigated by means of time-dependent nuclear Overhauser enhancement (NOE) measurements in a B DNA hexamer and undecamer. Cross-relaxation rates between these proton pairs are determined from the initial slopes of the time development of the NOEs, and, as the interproton distances between these proton pairs are fixed, apparent correlation times for the 3 interproton vectors are calculated from the cross-relaxation rate data. It is shown that there is little residue to residue variation in the cross-relaxation rates of the interproton vectors within each oligonucleotide, that the mean apparent correlation times of the C(H5)-C(H6) and T(CH3)-T(H6) vectors are approximately equal and significantly greater than that of the H2'-H2" vectors, and that the data for the H2'-H2" vectors of both oligonucleotides and the C(H5)-C(H6) and T(CH3)-T(H6) vectors of the undecamer cannot be accounted for by isotropic tumbling alone. The data are analysed in terms of a two motion model with isotropic tumbling and a single internal motion. The relaxation time of the internal motion at 23 degrees C is less than or equal to 1 ns for the H2'-H2" vectors of both oligonucleotides and less than or equal to 3 ns for the C(H5)-C(H6) and T(CH3)-T(H6) vectors of the undecamer. In the case of the H2'-H2" vectors, however, the amplitude of the internal motion is found to be too large to be compatible with the known stereochemistry of DNA. This finding can only be explained by invoking additional degrees of internal freedom with a larger number of internal motions of small amplitude of the type deduced from the analysis of crystallographic thermal factors [(1984) J. Mol. Biol. 173, 361-388].     

Lac repressor-operator interaction: DNA length dependence

The interaction of the E. coli lac operon repressor with its operator DNA has been directly examined as a function of the length of operator-containing DNA. The apparent bimolecular association rate constants were calculated as ka = (kd/KD), where the dissociation equilibrium constant, KD and the dissociation rate constant, kd, were measured by nitrocellulose filter adsorption assays. The values obtained for the overall association rate constants are compared with theoretical association rate curves for specific mechanisms. Association of the repressor with short operator containing DNA fragments (less than 70 base pairs) occurs at rates expected of three-dimensional diffusion. Our data also imply that at longer DNA lengths a combination of three-dimensional diffusion with one-dimensional sliding along with hopping and/or intersegment transfer must be involved to facilitate the repressor operator association.     

A 300 MHz and 600 MHz proton NMR study of a 12 base pair restriction fragment: investigation of structure by relaxation measurements.

The 1H NMR spectrum of a 12 base pair DNA restriction fragment has been measured at 300 and 600 MHz and resonances from over 70 protons are individually resolved. Relaxation rate measurements have been carried out at 300 MHz and compared with the theoretical predictions obtained using an isotropic rigid rotor model with coordinates derived from a Dreiding model of DNA. The model gives results that are in excellent agreement with experiment for most protons when a 7 nsec rotational correlation time is used, although agreement is improved for certain base protons by using a shorter correlation time for the sugar group, or by increasing the sugar-base interproton distances. A comparison of non-selective and selective spin-lattice relaxation rates for carbon bound protons indicates that there is extensive spin diffusion even in this short DNA fragment. Examination of the spin-spin relaxation rates for the same type of proton on different base pairs reveals little sequence effect on conformation.     

On the nature of the cytosine-methylated sequence in DNA of Bacillus brevis var. G.-B.

On growing the cells of Bacillus brevis S methionine-auxotroph mutant in the presence of [Me-3H]methionine, practically all the radioactivity incorporated into DNA is found to exist in 5-methylcytosine and N6-methyladenine. The analysis of pyrimidine isopliths isolated from DNA shows that radioactivity only exists in mono- and dinucleotides and the content of 5-methylcytosine in R-m5 C-R and R-m5 C-T-R oligonucleotides is equal. The analysis of dinucleotides isolated from DNA by means of pancreatic DNAase hydrolysis allows the nature of purine residues neighbouring 5-methylcytosine to be identified and shows that 5-methylcytosine localizes in G-m5 C-A and G-m5 C-Tr fragments. B. brevis S DNA methylase modifying cytosine residues recognizes the GCA/TGC degenerate nucleotide sequence which is a part of the following complementary structure with a two-fold rotational axis of symmetry: (5')...N'-G-C-T-G-C-N... (3') (3')...N-C-G-A-C-G-N'... (5') (Methylated cytosine residues are askerisked). Cytosine-modifying DNA methylase activity is isolated from B. brevis cells; it is capable of methylating in vitro homologous and heterologous DNA. Hence DNA in bacterial cells can be undermethylated. This enzyme methylates cytosine residues in native and denatured DNA in the same nucleotide sequences. Specificity of methylation of cytosine residues in vitro and in vivo does not depend on the nature of substrate DNA. DNA methylases of different variants of B. brevis (R, S, P+, P-)) methylate cytosine residues in the same nucleotide sequences. It means that specificity or methylation of DNA cytosine residues in the cells of different variants of B. brevis is the same.     

Exploring a DNA Sequence for the Three-Dimensional Structure Determination of a Silver(I)-Mediated C-C Base Pair in a DNA Duplex By 1H NMR Spectroscopy

Recently, we discovered novel silver(I)-mediated cytosine–cytosine base pair (C–Ag^I–C) in DNA duplexes. To understand the properties of these base pairs, we searched for a DNA sequence that can be used in NMR structure determination. After extensive sequence optimizations, a non-symmetric 15-base-paired DNA duplex with a single C–Ag^I–C base pair flanked by 14 A–T base pairs was selected. In spite of its challenging length for NMR measurements (30 independent residues) with small sequence variation, we could assign most non-exchangeable protons (254 out of 270) and imino protons for structure determination.     

Structure of the Tet repressor and Tet repressor-operator complexes in solution from electrooptical measurements and hydrodynamic simulations

The Tet repressor protein and tet operator DNA fragments and their complexes have been analyzed by electrooptical procedures. The protein shows a positive linear dichroism at 280 nm, a negative linear dichroism at 248 nm, and a strong permanent dipole moment of 3.5 X 10(-27) C m, which is independent of the salt concentration within experimental accuracy. Its rotation time constant of 40 ns indicates an elongated structure, which is consistent with a prolate ellipsoid of 100 A for the long axis and 40 A for the short axis. The time constant can also be fitted by a cylinder of length 78 A and diameter 37 A, which is consistent with nuclease protection data reported on repressor-operator complexes, if the cylinder axis is aligned parallel to the DNA axis. Addition of tetracycline induces changes of the limit dichroism but very little change of the rotation time constant. The rotation time constants observed for the operator DNA fragments show some deviations from the values expected from their contour length; however, these deviations remain relatively small. Formation of repressor-operator complexes leads to some increase of the DNA rotation time constants. Simulations by bead models demonstrate that these time constants can be explained without any major change of the hydrodynamic dimension of the components. The data for the complexes are fitted by bead models with smooth bending of the DNA corresponding to a radius of curvature of 500 A, but at the given accuracy, we cannot rule out that the DNA in the complex remains straight or is bent to a smaller radius of approximately 400 A. Thus, binding of the Tet repressor, which is a helix-turn-helix protein as judged from its sequence, to its operator seems to induce minor bending but does not induce strong bending of the DNA double helix.     

Specificity of methylation of cytosine risidues in DNA of Bacillus brevis var. G-B]

On growing the cells of Bacillus brevis S methionine-auxotroph mutant in the presence of (methyl-3H)-methionine practically the total radioactivity included into DNA is found to exist in 5-methylcytosine (MC) and 6N-methyladenine (MA). The analysis of pyrimidine isopliths isolated from DNA shows that radioactivity only exists in mono- and dinucleotides and the content of MC in Pur-MC-Pur and Pur-MC-T-Pur oligonucleotides is equal. The analysis of dinucleotides isolated from DNA by means of pancreatic DNAase hydrolysis allows the nature of purine residues neighbouring with MC to be revealed and shows that MC localizes in G-MC-A and G-MC-T-Pu fragments. Bac. brevis S DNA-methylase modifying cytosine residues recognizes the GCAT GC degenerative nucleotide sequence which is a part of the following complementary structure with rotational symmetry: (5') ... N'--G--MC--T--G--C--N ... (3') (3') ... N--C--G--A--MC--G--N' ... (5') Cytosine modifying DNA-methylase activity is isolated from Bac. brevis cells; it is capable of methylating in vitro homologous and heterologous DNA. Hence, DNA in bacterial cells can be partially undermethylated. This enzyme methylates cytosine residues in native and deneaturated DNA in the same nucleotide sequences. As compared to the native DNA, the denaturated DNA is indicative of a decrease in the level of methylation of adenine, rather than cytosine residues. Specificity of methylation of cytosine residues in vitro and in vivo does not depend on the nature of substrate DNA (calf thymus, Pseudomonas aeruginosa etc.). DNA-methylases of different variants of Bac. brevis (R, S, P+, P-) methylate cytosine residues in the same nucleotide sequences. It means that specificity of methylation of DNA cytosine residues in the cells of different variants of Bac. brevis is the same.     

Separation of large DNA restriction fragments on a size-exclusion column by a nonideal mechanism

Double-strand DNA (dsDNA) restriction fragments were chromatographed on the DuPont Bioseries GF-250 column. Two anomolous chromatographic properties were observed. (1) A triphasic dependence of retention on dsDNA chain length was observed. Small DNA fragments (less than 500 base pairs) displayed typical size exclusion, intermediate size DNA (800-5000 base pairs) eluted in the void volume, and larger DNA fragments were increasingly retained. (2) The void volume for nucleic acids was less than that for large polypeptides. The retention of moderately large DNA fragments increased linearly as the square root of the chain length over the range 5.5 to 50 kilobase pairs (ca. 3-30 X 10(6) Mr). A number of eluant manipulations were carried out in order to examine the mechanism by which the larger DNA fragments were being retained and separated. Evidence was not obtained to support either ion exchange or reverse phase as the retention mechanism. The usefulness of such a column for molecular biological manipulations is illustrated by the rapid isolation of homogeneous viral DNA fragments resected from their cloning vectors with restriction endonucleases.