Extension of G-quadruplex DNA by ciliate telomerase

Telomeric DNA can fold into four-stranded structures known as G-quadruplexes. Here we investigate the ability of G-quadruplex DNA to serve as a substrate for recombinant Tetrahymena and native Euplotes telomerase. Inter- and intramolecular G-quadruplexes were gel-purified and their stability examined using native gel electrophoresis, circular dichroism (CD) and thermal denaturation. While intermolecular G-quadruplexes were highly stable, they were excellent substrates for both ciliate telomerases in primer extension assays. In contrast, intramolecular G-quadruplexes formed in K+ exhibited biphasic unfolding and were not extended by ciliate telomerases. Na+-stabilised intramolecular G-quadruplexes were extended by telomerase owing to their rapid rate of dissociation. The Tetrahymena telomerase protein component bound to inter- but not intramolecular K+-stabilised G-quadruplexes. This study provides evidence that parallel intermolecular G-quadruplexes can serve as substrates for telomerase in vitro, their extension being mediated through direct interactions between this higher-order structure and telomerase.     

Sequence specificity of inter- and intramolecular G-quadruplex formation by human telomeric DNA

Human telomeric DNA consists of tandem repeats of the sequence 5'-d(TTAGGG)-3'. Guanine-rich DNA, such as that seen at telomeres, forms G-quadruplex secondary structures. Alternative forms of G-quadruplex structures can have differential effects on activities involved in telomere maintenance. With this in mind, we analyzed the effect of sequence and length of human telomeric DNA on G-quadruplex structures by native polyacrylamide gel electrophoresis and circular dichroism. Telomeric oligonucleotides shorter than four, 5'-d(TTAGGG)-3' repeats formed intermolecular G-quadruplexes. However, longer telomeric repeats formed intramolecular structures. Altering the 5'-d(TTAGGG)-3' to 5'-d(TTAGAG)-3' in any one of the repeats of 5'-d(TTAGGG)(4)-3' converted an intramolecular structure to intermolecular G-quadruplexes with varying degrees of parallel or anti-parallel-stranded character, depending on the length of incubation time and DNA sequence. These structures were most abundant in K(+)-containing buffers. Higher-order structures that exhibited ladders on polyacrylamide gels were observed only for oligonucleotides with the first telomeric repeat altered. Altering the sequence of 5'-d(TTAGGG)(8)-3' did not result in the substantial formation of intermolecular structures even when the oligonucleotide lacked four consecutive telomeric repeats. However, many of these intramolecular structures shared common features with intermolecular structures formed by the shorter oligonucleotides. The wide variability in structure formed by human telomeric sequence suggests that telomeric DNA structure can be easily modulated by proteins, oxidative damage, or point mutations resulting in conversion from one form of G-quadruplex to another.     

Role of loop residues and cations on the formation and stability of dimeric DNA G-quadruplexes

Formation of guanine-quadruplexes by four DNA oligonucleotides with common sequence dG4-loop-dG4 has been studied by a combination of NMR and UV spectroscopy. The loops consisted of 1',2'-dideoxyribose, propanediol, hexaethylene glycol, and thymine residues. The comparison of data on modified and parent oligonucleotides gave insight into the role of loop residues on formation and stability of dimeric G-quadruplexes. All modified oligonucleotides fold into dimeric fold-back G-quadruplexes in the presence of sodium ions. Multiple structures form in the presence of potassium and ammonium ions, which is in contrast to the parent oligonucleotide with dT4 loop. 15N-filtered 1H NMR spectra demonstrate that all studied G-quadruplexes exhibit three 15NH4(+) ion binding sites. Topology of intermolecular G-quadruplexes was evaluated by NMR measurements and diffusion experiments. The spherical, prolate-ellipsoid and symmetric cylinder models were used to interpret experimental translational diffusion constants in terms of diameters and lengths of unfolded oligonucleotides and their respective G-quadruplexes. UV melting and annealing curves show that oligonucleotides with non-nucleosidic loop residues fold faster, exhibit no hysteresis, and are less stable than dimeric d(G4T4G4)2 which can be attributed to the absence of H-bonds, stacking between loop residues and the outer G-quartets as well as cation-pi interactions. Oligonucleotide consisting of hexaethylene glycol linkage with only two phosphate groups in the loop exhibits higher melting temperature and more negative deltaH(o) and deltaG(o) values than oligonucleotides with four 1',2'-dideoxyribose or propanediol residues.     

Induction of parallel human telomeric G-quadruplex structures by Sr(2+)

Human telomeric DNA forms G-quadruplex secondary structures, which can inhibit telomerase activity and are targets for anti-cancer drugs. Here we show that Sr(2+) can induce human telomeric DNA to form both inter- and intramolecular structures having characteristics consistent with G-quadruplexes. Unlike Na(+) or K(+), Sr(2+) facilitated intermolecular structure formation for oligonucleotides with 2 to 5 5'-d(TTAGGG)-3' repeats. Longer 5'-d(TTAGGG)-3' oligonucleotides formed exclusively intramolecular structures. Altering the 5'-d(TTAGGG)-3' to 5'-d(TTAGAG)-3' in the 1st, 3rd, or 4th repeats of 5'-d(TTAGGG)(4)-3' stabilized the formation of intermolecular structures. However, a more compact, intramolecular structure was still observed when the 2nd repeat was altered. Circular dichroism spectroscopy results suggest that the structures were parallel-stranded, distinguishing them from similar DNA sequences in Na(+) and K(+). This study shows that Sr(2+), promotes parallel-stranded, inter- and intramolecular G-quadruplexes that can serve as models to study DNA substrate recognition by telomerase.     

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.     

Inhibited complete folding of consecutive human telomeric G-quadruplexes

Noncanonical DNA structures, termed G-quadruplexes, are present in human genomic DNA and are important elements in many DNA metabolic processes. Multiple sites in the human genome have G-rich DNA stretches able to support formation of several consecutive G-quadruplexes. One of those sites is the telomeric overhang region that has multiple repeats of TTAGGG and is tightly associated with both cancer and aging. We investigated the folding of consecutive G-quadruplexes in both potassium- and sodium-containing solutions using single-molecule FRET spectroscopy, circular dichroism, thermal melting and molecular dynamics simulations. Our observations show coexistence of partially and fully folded DNA, the latter consisting of consecutive G-quadruplexes. Following the folding process over hours in sodium-containing buffers revealed fast G-quadruplex folding but slow establishment of thermodynamic equilibrium. We find that full consecutive G-quadruplex formation is inhibited by the many DNA structures randomly nucleating on the DNA, some of which are off-path conformations that need to unfold to allow full folding. Our study allows describing consecutive G-quadruplex formation in both nonequilibrium and equilibrium conditions by a unified picture, where, due to the many possible DNA conformations, full folding with consecutive G-quadruplexes as beads on a string is not necessarily achieved.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Structural diversity and extreme stability of unimolecular Oxytricha nova telomeric G-quadruplex

Oxytricha nova telomeric DNA contains guanine-rich short-tandem repeat sequences (GGGGTTTT) n and terminates as a single strand at the 3'-end. This single-stranded overhang forms a novel DNA structure, namely, G-quadruplex, comprising four quartets. In this study, we investigated the structures and dynamics of unimolecular Oxytricha nova ( O. nova) telomeric G-quadruplexes by performing single molecule fluorescence resonance energy transfer (FRET) spectroscopy and bulk circular dichroism (CD) measurements. We observed that unimolecular O. nova G-quadruplexes exhibit structural polymorphism according to monovalent cations. In the presence of Na (+), only antiparallel conformation is detected, which was demonstrated in previous studies; however, in the presence of K (+), they fold into two different conformations, a parallel conformation and an antiparallel one different from that induced by Na (+). Furthermore, these G-quadruplexes show extremely high stability in their dynamics when compared with human G-quadruplexes. While human telomeric G-quadruplexes that possess three quartets display fast dynamic behavior (<100 s) at low K (+) concentrations or high temperatures, O. nova G-quadruplexes maintain their conformational state for a long time (>1000 s), even at the lowest K (+) concentration and the highest temperature investigated. This high stability is primarily due to an extra quartet that results in additional cation coordination. In addition to cation coordination, we propose that other factors such as base stacking and the size of the thymine loop may contribute to the stability of O. nova G-quadruplexes; this is based on the fact that the O. nova G-quadruplexes were observed to be more stable than the human ones in the presence of Li (+), which is known to greatly destabilize G-quadruplexes because of imprecise coordination. This extreme stability of four-quartet G-quadruplexes enables telomere protection even in the absence of protective proteins or in the case of abrupt environmental changes, although only a single G-quadruplex structure can be derived from the short single-stranded overhang.     

Emulsified BMVC derivative induced filtration for G-quadruplex DNA structural separation

A novel method based on emulsion/filtration is introduced for G-quadruplex DNA structural separation. We first synthesized a lipophilic analogue of BMVC, 3,6-Bis(1-methyl-4-vinylpyridinium)-9-(12′-bromododecyl) carbazole diiodide (BMVC-12C-Br), which can form an oil-in-water (o/w) phase emulsion. Due to the binding preferences of BMVC-12C-Br emulsion to some specific DNA structures, the large emulsion (∼2 µm) bound DNA was separated from the small free DNA in the filtrate by a 0.22 µm pore size MCE membrane. This method is able to isolate the non-parallel G-quadruplexes from the parallel G-quadruplexes and the linear duplexes from both G-quadruplexes. In addition, this method allows us not only to determine the absence of the parallel G-quadruplexes of d(T₂AG₃)₄ and the presence of the parallel G-quadruplexes of d(T₂AG₃)₂ in K⁺ solution, but also to verify structural conversion from antiparallel to parallel G-quadruplexes of d[AG₃(T₂AG₃)₃] in K⁺ solution under molecular PEG condition. Moreover, this emulsion can separate the non-parallel G-quadruplexes of d(G₃CGCG₃AGGAAG₅CG₃) monomer from the parallel G-quadruplexes of its dimer in K⁺ solution. Together with NMR spectra, one can simplify the spectra for both the free DNA and the bound DNA to establish a spectrum-structure correlation for further structural analysis.     

The repair of G-quadruplex-induced DNA damage

G4 DNA motifs, which can form stable secondary structures called G-quadruplexes, are ubiquitous in eukaryotic genomes, and have been shown to cause genomic instability. Specialized helicases that unwind G-quadruplexes in vitro have been identified, and they have been shown to prevent genetic instability in vivo. In the absence of these helicases, G-quadruplexes can persist and cause replication fork stalling and collapse. Translesion synthesis (TLS) and homologous recombination (HR) have been proposed to play a role in the repair of this damage, but recently it was found in the nematode Caenorhabditis elegans that G4-induced genome alterations are generated by an error-prone repair mechanism that is dependent on the A-family polymerase Theta (Pol θ). Current data point towards a scenario where DNA replication blocked at G-quadruplexes causes DNA double strand breaks (DSBs), and where the choice of repair pathway that can act on these breaks dictates the nature of genomic alterations that are observed in various organisms.     

The effect of the TRF2 N-terminal and TRFH regions on telomeric G-quadruplex structures

The sequence of human telomeric DNA consists of tandem repeats of 5′-d(TTAGGG)-3′. This guanine-rich DNA can form G-quadruplex secondary structures which may affect telomere maintenance. A current model for telomere protection by the telomere-binding protein, TRF2, involves the formation of a t-loop which is stabilized by a strand invasion-like reaction. This type of reaction may be affected by G-quadruplex structures. We analyzed the influence of the arginine-rich, TRF2 N-terminus (TRF2^B), as well as this region plus the TRFH domain of TRF2 (TRF2^BH), on the structure of G-quadruplexes. Circular dichroism results suggest that oligonucleotides with 4, 7 and 8 5′-d(TTAGGG)-3′ repeats form hybrid structures, a mix of parallel/antiparallel strand orientation, in K⁺. TRF2^B stimulated the formation of parallel-stranded structures and, in some cases, intermolecular structures. TRF2^BH also stimulated intermolecular but not parallel-stranded structures. Only full-length TRF2 and TRF2^BH stimulated uptake of a telomeric single-stranded oligonucleotide into a plasmid containing telomeric DNA in the presence of K⁺. The results in this study suggest that G-quadruplex formation inhibits oligonucleotide uptake into the plasmid, but the inhibition can be overcome by TRF2. This study is the first analysis of the effects of TRF2 domains on G-quadruplex structures and has implications for the role of G-quadruplexes and TRF2 in the formation of t-loops.     

d(CGGTGGT) forms an octameric parallel G-quadruplex via stacking of unusual G(:C):G(:C):G(:C):G(:C) octads

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization of G-rich oligodeoxyribonucleic acid strands. In particular, several G-rich strands can form higher order assemblies by multimerization between several G-quadruplex units. Here, we report on the identification of a novel dimerization pathway. Our Nuclear magnetic resonance, circular dichroism, UV, gel electrophoresis and mass spectrometry studies on the DNA sequence dCGGTGGT demonstrate that this sequence forms an octamer when annealed in presence of K(+) or NH(4)(+) ions, through the 5'-5' stacking of two tetramolecular G-quadruplex subunits via unusual G(:C):G(:C):G(:C):G(:C) octads.     

Stability of telomeric G-quadruplexes

In most eukaryotes, telomeric DNA consists of repeats of a short motif that includes consecutive guanines and may hence fold into G-quadruplexes. Budding yeasts have telomeres composed of longer repeats and show variation in the degree of repeat homogeneity. Although telomeric sequences from several organisms have been shown to fold into G-quadruplexes in vitro, surprisingly, no study has been dedicated to the comparison of G-quadruplex folding and stability of known telomeric sequences. Furthermore, to our knowledge, folding of yeast telomeric sequences into intramolecular G-quadruplexes has never been investigated. Using biophysical and biochemical methods, we studied sequences mimicking about four repetitions of telomeric motifs from a variety of organisms, including yeasts, with the aim of comparing the G-quadruplex folding potential of telomeric sequences among eukaryotes. G-quadruplex folding did not appear to be a conserved feature among yeast telomeric sequences. By contrast, all known telomeric sequences from eukaryotes other than yeasts folded into G-quadruplexes. Nevertheless, while G(3)T(1-4)A repeats (found in a variety of organisms) and G(4)T(2,4) repeats (found in ciliates) folded into stable G-quadruplexes, G-quadruplexes formed by repetitions of G(2)T(2)A and G(2)CT(2)A motifs (found in many insects and in nematodes, respectively) appeared to be in equilibrium with non-G-quadruplex structures (likely hairpin-duplexes).     

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes,a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase

Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase.     

Intramolecular Telomeric G-Quadruplexes Dramatically Inhibit DNA Synthesis by Replicative and Translesion Polymerases,Revealing their Potential to Lead to Genetic Change

Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.     

Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K⁺ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K⁺ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K⁺ concentrations and longstanding folded states at high K⁺ concentrations. Several factors such as base-stacking interaction and K⁺ coordination are responsible for the different dynamics according to the mutation position.     

Telomeric repeat mutagenicity in human somatic cells is modulated by repeat orientation and G-quadruplex stability

Telomeres consisting of tandem guanine-rich repeats can form secondary DNA structures called G-quadruplexes that represent potential targets for DNA repair enzymes. While G-quadruplexes interfere with DNA synthesis in vitro, the impact of G-quadruplex formation on telomeric repeat replication in human cells is not clear. We investigated the mutagenicity of telomeric repeats as a function of G-quadruplex folding opportunity and thermal stability using a shuttle vector mutagenesis assay. Since single-stranded DNA during lagging strand replication increases the opportunity for G-quadruplex folding, we tested vectors with G-rich sequences on the lagging versus the leading strand. Contrary to our prediction, vectors containing human [TTAGGG]₁₀ repeats with a G-rich lagging strand were significantly less mutagenic than vectors with a G-rich leading strand, after replication in normal human cells. We show by UV melting experiments that G-quadruplexes from ciliates [TTGGGG]₄ and [TTTTGGGG]₄ are thermally more stable compared to human [TTAGGG]₄. Consistent with this, replication of vectors with ciliate [TTGGGG]₁₀ repeats yielded a 3-fold higher mutant rate compared to the human [TTAGGG]₁₀ vectors. Furthermore, we observed significantly more mutagenic events in the ciliate repeats compared to the human repeats. Our data demonstrate that increased G-quadruplex opportunity (repeat orientation) in human telomeric repeats decreased mutagenicity, while increased thermal stability of telomeric G-quadruplexes was associated with increased mutagenicity.