The complete nucleotide sequence of a rice 25S.rRNA gene

The complete nucleotide (nt) sequence of a rice nuclear 25S.rRNA gene has been determined. The 25S.rRNA-coding region is 3377 bp long. The G + C content is 59.4%. The structural organization of this rRNA is very similar to that of yeast 26S rRNA.     

The complete nucleotide sequence of a rice 17S rRNA gene.

The complete nucleotide sequence of a rice nuclear 17S rRNA gene (rDNA) has been determined. The rice rDNA is 1812 bp long and its G + C content is 51.3%. This nucleotide sequence shows 79%, 80% and 80% homology to those of yeast, Xenopus laevis and rat 18S rDNAs, respectively. Divergency of nucleotide sequences is largely attributed to five blocks of highly variable regions, where eukaryotic specific sequences can be observed.     

Secondary structure of mouse 28S rRNA and general model for the folding of the large rRNA in eukaryotes.

We present a secondary structure model for the entire sequence of mouse 28S rRNA (1) which is based on an extensive comparative analysis of the available eukaryotic sequences, i.e. yeast (2, 3), Physarum polycephalum (4), Xenopus laevis (5) and rat (6). It has been derived with close reference to the models previously proposed for yeast 26S rRNA (2) and for prokaryotic 23S rRNA (7-9). Examination of the recently published eukaryotic sequences confirms that all pro- and eukaryotic large rRNAs share a largely conserved secondary structure core, as already apparent from the previous analysis of yeast 26S rRNA (2). These new comparative data confirm most features of the yeast model (2). They also provide the basis for a few modifications and for new proposals which extend the boundaries of the common structural core (now representing about 85% of E. coli 23S rRNA length) and bring new insights for tracing the structural evolution, in higher eukaryotes, of the domains which have no prokaryotic equivalent and are inserted at specific locations within the common structural core of the large subunit rRNA.     

The complete nucleotide sequence of a 23-S rRNA gene from tobacco chloroplasts

The nucleotide sequence of a tobacco chloroplast 23-S rRNA gene, including the spacer between it and the 4.5-S rRNA gene, has been determined. The 23-S rRNA coding region is 2804-base-pairs long. A comparison with the 23-S rRNA sequence of Escherichia coli reveals strong homology and further shows a similarity between the chloroplast 4.5-S rRNA and the 3'-terminal region of E. coli 23-S rRNA. However, the 101-base-pair spacer sequence between the 23-S and 4.5-S rRNA genes has little homology with E. coli 23-S rRNA.     

Complete nucleotide sequence of mouse 18 S rRNA gene: comparison with other available homologs

We present the complete sequence of mouse 18 S rRNA. As indicated by comparison with yeast, Xenopus and rat, the conservation of eukaryotic 18 S rRNA sequences is extensive. However, this conservation is far from being uniform along the molecule: most of the base changes and the size differences between species are concentrated at specific locations. Two distinct classes of divergent traces can be detected which differ markedly in their rates of nucleotide substitution during evolution, and should prove valuable in additional comparative analyses, both for eukaryotic taxonomy and for rRNA higher order organization. Mouse and rat 18 S rRNA sequences differ by only 14 point changes over the 1869 nucleotides of the molecule.     

Complete nucleotide sequence of the 16S rRNA gene of Mycobacterium bovis BCG.

The complete nucleotide sequence of the 16S rRNA gene of Mycobacterium bovis BCG was determined. Its coding region was estimated to be 1,536 base pairs long. The nucleotide sequence of the gene in M. bovis BCG has homologies of 75 and 89% with those of Escherichia coli and Streptomyces lividans, respectively.     

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.     

The nucleotide sequence of 5S rRNA from bovine liver.

We have determined the nucleotide sequence of ribosomal 5S RNA from bovine liver. The comparison of this sequence with those from other eukaryotic sources shows that a common secondary structure model for all eukaryotic 5S rRNAs may exist. Analysis of the evolutionary conserved nucleotides in metazoan 5S rRNAs suggests that the tertiary interactions, proposed earlier for plant 5S rRNA, are also possible.     

The nucleotide sequence of the gene coding for the 16S rRNA from the archaebacterium Halobacterium halobium

The complete 1473-bp sequence of the 16S rRNA gene from the archaebacterium Halobacterium halobium has been determined. Alignment with the sequences of the 16S rRNA gene from the archaebacteria Halobacterium volcanii and Halococcus morrhua reveals similar degrees of homology, about 88%. Differences in the primary structures of H. halobium and eubacterial (Escherichia coli) 16S rRNA or eukaryotic (Dictyostelium discoideum) 18S rRNA are much higher, corresponding to 63% and 56% homology, respectively. A comparison of the nucleotide sequence of the H. halobium 16S rRNA with those of its archaebacterial counterparts generally confirms a secondary structure model of the RNA contained in the small subunit of the archaebacterial ribosome.     

Cloning and complete nucleotide sequence of mouse immunoglobulin gamma 1 chain gene.

The 6.6 kb DNA fragment coding for the immunoglobulin γ1 chain was cloned from newborn mouse DNA using λgtWES·λB as the EK2 vector. The complete nucleotide sequence (1823 bases) of the γ1 chain gene was determined. The cloned gene contained the entire constant region gene sequence as well as the poly(A) addition site, but not the variable region gene. The results indicate that the variable and constant region genes of immunoglobulin heavy chain are separated in newborn mouse DNA. The constant region genes of other gamma chains (that is, γ2a, γ2b and γ3) are not present in the cloned DNA fragment. The sequence demonstrates that the γ1 chain gene is interrupted by three intervening sequences at the junction of the domains and the hinge region, as previously shown in the γ2b and α chain genes and in the γ1 chain gene cloned from myeloma. The results suggest that the intervening sequence was introduced into the heavy chain gene before divergence of the heavy chain classes, and also support the hypothesis that the splicing mechanism has facilitated the evolution of eucaryotic genes by linking duplicated domains or prototype peptides not directly adjacent to one another. Comparison of the nucleotide sequence of the γ1 chain gene around the boundaries of the coding and intervening sequences with those of other mouse genes revealed extensive divergence, although short prevalent sequences of AG-GTCAG at the 5′ border of the intervening sequence and TCTGCAG-GC at the 3′ border were deduced. A limited homology of nucleotide sequences was found among domains and between the hinge region and the 5′ portion of the CH2 domain. Comparison of 3′ untranslated sequences from the γ1 and γ2b chain genes and the mouse major β-globin gene shows significant homology and a palindrome sequence surrounding the poly(A) addition site.