3'' Terminal labelling of RNA of RNA with beta-32P-pyrophosphate group and its application to the sequence analysis of 5S RNA from Streptomyces griseus.

Nucleotide pyrophosphate transferase isolated from Streptomyces griseus is used to transfer pyrophosphate group from gamma-32P-ATP to the 3'-OH of tRNA, generating a strictly terminal label at its 3' end. Using yeast tRNAPhe as model compound, it is demonstrated that the labelled molecule is suitable for rapid gel sequencing by both enzymatic and chemical methods. RNA molecules terminated by pyrimidine nucleoside are poor pyrophosphate acceptors. To label RNAs of this kind, first guanosine 5'-phosphate 3'-(beta-32P)-pyrophosphate (pGpp) is prepared from gamma-32P-ATP and GMP by nucleotide pyrophosphate transferase. pGpp is then ligated to the 3' end of RNA by T4 RNA ligase. The complete nucleotide sequence of 5S RNA from Streptomyces griseus is established by rapid gel sequencing methods performed on 3'-(beta-32P)-pyrophosphate labelled molecule.     

Uridylate addition and RNA ligation contribute to the specificity of kinetoplastid insertion RNA editing

RNA editing in Trypanosoma brucei inserts and deletes uridylates (U's) in mitochondrial pre-mRNAs under the direction of guide RNAs (gRNAs). We report here the development of a novel in vitro precleaved editing assay and its use to study the gRNA specificity of the U addition and RNA ligation steps in insertion RNA editing. The 5' fragment of substrate RNA accumulated with the number of added U's specified by gRNA, and U addition products with more than the specified number of U's were rare. U addition up to the number specified occurred in the absence of ligation, but accumulation of U addition products was slowed. The 5' fragments with the correct number of added U's were preferentially ligated, apparently by adenylylated RNA ligase since exogenously added ATP was not required and since ligation was eliminated by treatment with pyrophosphate. gRNA-specified U addition was apparent in the absence of ligation when the pre-mRNA immediately upstream of the editing site was single stranded and more so when it was base paired with gRNA. These results suggest that both the U addition and RNA ligation steps contributed to the precision of RNA editing.     

Fluorescent labelling of tRNA and oligodeoxynucleotides using T4 RNA ligase.

3'-O-(5'-phosphoryldeoxycytidyl) phosphorothioate and fluorescent 3'-O-(5'-phosphoryldeoxycytidyl) S-bimane phosphorothioate can be ligated to tRNA by T4 RNA ligase. They are also efficient donors for the enzymatic ligation to oligodeoxynucleotides bearing a 3'-cytidine terminus. Cytidine 3',5'-bisphosphate is also a substrate for the ligation reaction with DNA restriction fragments with a 3'-terminate cytidylic acid residue. Oligo- and polynucleotides with a 3'-phosphorothioate group react readily with electrophiles as exemplified by the reaction with monobromobimane.     

Two reactions of Haloferax volcanii RNA splicing enzymes: joining of exons and circularization of introns

Archaeal RNA splicing involves at least two protein enzymes, a specific endonuclease and a specific ligase. The endonuclease recognizes and cleaves within a characteristic bulge-helix-bulge (BHB) structure formed by pairing of the regions near the two exon-intron junctions, producing 2',3'-cyclic phosphate and 5'-hydroxyl termini. The ligase joins the exons and converts the cyclic phosphate into junction phosphate. The ligated product contains a seven-base hairpin loop, in which the splice junction is in between the two 3' terminal residues of the loop. Archaeal splicing endonucleases are also involved in rRNA processing, cutting within the BHB structures formed by pairing of the 5' and 3' flanking regions of the rRNAs. Large free introns derived from pre-rRNAs have been observed as stable and abundant circular RNAs in certain Crenarchaeota, a kingdom in the domain Archaea. In the present study, we show that the cells of Haloferax volcanii, a Euryarchaeote, contain circular RNAs formed by 3',5'-phosphodiester linkage between the two termini of the introns derived from their pre-tRNAs. H. volcanii ligase, in vitro, can also circularize both endonuclease-cleaved introns, and non-endonuclease-produced substrates. Exon joining and intron circularization are mechanistically similar ligation reactions that can occur independently. The size of the ligated hairpin loop and position of the splice junction within this loop can be changed in in vitro ligation reactions. Overall, archaeal RNA splicing seems to involve two sets of two symmetric transesterification reactions each.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

A short 5' splice site RNA oligo can participate in both steps of splicing in mammalian extracts.

A short 5' splice site RNA oligonucleotide (5'SS RNA oligo) undergoes both steps of splicing when a second RNA containing the 3' splice site region (3'SS RNA) is added in trans. This trans-splicing reaction displays the same 5' and 3' splice site sequence requirements as cis-splicing of full-length pre-mRNA. The analysis of RNA-snRNP complexes formed on each of the two splice site RNAs is consistent with the formation of partial complexes, which then associate to form the complete spliceosome. Specifically, U2 snRNP bound to the 3'SS RNA associates with U4/U5/U6 snRNP bound to the 5'SS RNA oligo. Thus, as expected, trans-splicing depends on the integrity of U2, U4, and U6 snRNAs. However, unlike cis-splicing, trans-splicing is enhanced when the 5' end of U1 snRNA is blocked or removed or when the U1 snRNP is depleted. Thus, the early regulatory requirement for U1 snRNP, which is essential in cis-splicing, is bypassed in this trans-splicing system. This simplified trans-splicing reaction offers a unique model system in which to study the mechanistic details of pre-mRNA splicing.     

The sequential 2',3'-cyclic phosphodiesterase and 3'-phosphate/5'-OH ligation steps of the RtcB RNA splicing pathway are GTP-dependent

The RNA ligase RtcB splices broken RNAs with 5'-OH and either 2',3'-cyclic phosphate or 3'-phosphate ends. The 3'-phosphate ligase activity requires GTP and entails the formation of covalent RtcB-(histidinyl)-GMP and polynucleotide-(3')pp(5')G intermediates. There are currently two models for how RtcB executes the strand sealing step. Scheme 1 holds that the RNA 5'-OH end attacks the 3'-phosphorus of the N(3')pp(5')G end to form a 3',5'-phosphodiester and release GMP. Scheme 2 posits that the N(3')pp(5')G end is converted to a 2',3'-cyclic phosphodiester, which is then attacked directly by the 5'-OH RNA end to form a 3',5'-phosphodiester. Here we show that the sealing of a 2',3'-cyclic phosphate end by RtcB requires GTP, is contingent on formation of the RtcB-GMP adduct, and involves a kinetically valid RNA(3')pp(5')G intermediate. Moreover, we find that RtcB catalyzes the hydrolysis of a 2',3'-cyclic phosphate to a 3'-phosphate at a rate that is at least as fast as the rate of ligation. These results weigh in favor of scheme 1. The cyclic phosphodiesterase activity of RtcB depends on GTP and the formation of the RtcB-GMP adduct, signifying that RtcB guanylylation precedes the cyclic phosphodiesterase and 3'-phosphate ligase steps of the RNA splicing pathway.     

The enzymatic conversion of 3'-phosphate terminated RNA chains to 2',3'-cyclic phosphate derivatives

The enzyme, RNA cyclase, has been purified from cell-free extracts of HeLa cells approximately 6000-fold. The enzyme catalyzes the conversion of 3'-phosphate ends of RNA chains to the 2',3'-cyclic phosphate derivative in the presence of ATP or adenosine 5'-(gamma-thio)triphosphate (ATP gamma S) and Mg2+. The formation of 1 mol of 2',3'-cyclic phosphate ends is associated with the disappearance of 1 mol of 3'-phosphate termini and the hydrolysis of 1 mol of ATP gamma S to AMP and thiopyrophosphate. No other nucleotides could substitute for ATP or ATP gamma S in the reaction. The reaction catalyzed by RNA cyclase was not reversible and exchange reactions between [32P]pyrophosphate and ATP were not detected. However, an enzyme-AMP intermediate could be identified that was hydrolyzed by the addition of inorganic pyrophosphate or 3'-phosphate terminated RNA chains but not by 3'-OH terminated chains or inorganic phosphate. 3'-[32P](Up)10Gp* could be converted to a form that yielded, (Formula: see text) after degradation with nuclease P1, by the addition of wheat germ RNA ligase, 5'-hydroxylpolynucleotide kinase, RNA cyclase, and ATP. This indicates that the RNA cyclase had catalyzed the formation of the 2',3'-cyclic phosphate derivative, the kinase had phosphorylated the 5'-hydroxyl end of the RNA, and the wheat germ RNA ligase had catalyzed the formation of a 3',5'-phosphodiester linkage concomitant with the conversion of the 2',3'-cyclic end to a 2'-phosphate terminated residue.     

Nicks 3'' or 5'' to AP sites or to mispaired bases, and one-nucleotide gaps can be sealed by T4 DNA ligase.

Using synthetic oligodeoxynucleotides with 3'-OH ends and 32P-labelled 5'-phosphate ends and the technique of polyacrylamide gel electrophoresis, it is shown that, in the presence of the complementary polynucleotide, an AP (apurinic or apyrimidinic) site at the 3' or the 5' end of the labelled oligodeoxynucleotides does not prevent their ligation by T4 DNA ligase, although the reaction rate is decreased. This decrease is more severe when the AP site is at the 3' end; the activated intermediates accumulate showing that it is the efficiency of the adenyl-5'-phosphate attack by the 3'-OH of the base-free deoxyribose which is mostly perturbed. Using the same technique, it is shown that a mispaired base at the 3' or 5' end of oligodeoxynucleotides does not prevent their ligation. A one-nucleotide gap, limited by 3'-OH and 5'-phosphate, can also be closed by T4 DNA ligase although with difficulty; here again the activation of the 5'-phosphate end does not seem to be slowed down, but rather the 3'-OH attack of the adenyl-5'-phosphate. All these anomalous ligations take place with the nick or the gap in front of a continuous complementary strand. Blunt ends ligation of correct duplexes occurs readily; however an AP site or a mispaired base at the 3' or 5' end of one strand of the duplexes prevents ligation between these strands. But a missing nucleotide (responsible for one unpaired nucleotide protruding at the 3' or 5' end of the complementary strand) does not stop ligation of the shorter oligodeoxynucleotides between independent duplexes.     

Use of a 2-5A analogue probe for detecting RNA ligase and RNA ligase substrates in mammalian cell extracts

The compound ppp(A2'p)3A3'[32P]pCp is a commercially available radioactive analogue of the 2',5' oligoadenylate series ppp(A2'p)nA, n greater than or equal to 2, commonly referred to as 2-5A. It is used as a probe for measuring concentrations in competition radiobinding and radioimmune assays. We have found that incubation of the probe with extracts from HeLa, CV1, or neuroblastoma cells results in its covalent attachment to two size classes of RNA: the first includes a major species with a molecular weight of approximately 350,000, the second is much smaller (40 +/- 5 nucleotides in length) and could represent tRNA half-molecules. Ligation is to the 3' end of the probe molecule with formation of a 3',5'-phosphodiester bond. Thus, probe ligation provides a sensitive and convenient assay for the detection not only of RNA ligase(s) but also of ligatable RNAs (such as the putative tRNA half-molecules) in mammalian cell extracts.     

Equimolar addition of oligoribonucleotides with T4 RNA ligase.

T4 induced RNA ligase will join equimolar concentrations of two oligoribonucleotides, (Ap)3C and p(Up) 5, to form a single product, (Ap)3Cp(Up) 5, in high yield. The presence of the 3' phosphate on p(Up)5 prevents the oligomer from adding to itself. The pH optimum of the reaction is about 7.5, but less of the undesirable adenylated intermediate, App(Up) 5, forms at pH 8.2. The reaction rate is a linear function of oligomer concentration from 3 micronM to 0.6 mM. The data suggest that T4 RNA ligase will be a useful enzyme for the synthesis of oligomers of defined sequence.     

Anomalous RNA substrates for mammalian tRNA 3' processing endoribonuclease

Mammalian tRNA 3' processing endoribonuclease (3' tRNase) is an enzyme responsible for the removal of a 3' trailer from pre-tRNA. The enzyme can also recognize and cleave any target RNA that forms a pre-tRNA-like complex with another RNA. To investigate the interaction between 3' tRNase and substrates, we tested various anomalous pre-tRNA-like complexes for cleavage by pig 3' tRNase. We examined how base mismatches in the acceptor stem affect 3' tRNase cleavage of RNA complexes, and found that even one base mismatch in the acceptor stem drastically reduces the cleavage efficiency. Mammalian 3' tRNase was able to recognize complexes between target RNAs and 5'-half tDNAs, and cleave the target RNAs, although inefficiently, whereas the enzyme had no activity to cleave phosphodiester bonds of DNA. A relatively long RNA target, the Escherichia coli chloramphenicol acetyltransferase (CAT) mRNA, was cleaved by 3' tRNase in the presence of appropriate 5'-half tRNAs. We also demonstrated that an RNA complex of lin-4 and lin-14 from Caenorhabditis elegans can be recognized and cleaved by pig 3' tRNase.     

Synthesis of RNA having cap structure.

RNA consisting 43 nucleotides bearing cap structure was synthesized (Figure). In the first place, 9 mer of a leader sequence with the cap structure (F-1) was synthesized by the phosphotriester method and followed by the capping reaction. Next, 32 mer of a cistron was divided into two fragments and each was synthesized by the phosphoramidite method. The 3'-end nucleotide of the RNA, a modified guanosine 5'-phosphate, was introduced to F-3 by use of P1-2',3'-O-methoxymethylene guanosine-5'-yl P2-adenosine-5'-yl diphosphate (A5' ppGmM) with T4 RNA ligase. The chemically synthesized RNA fragments were ligated with T4 RNA ligase to afford the desired RNA.     

Activity of chimeric RNAs of U6 snRNA and (-)sTRSV in the cleavage of a substrate RNA.

U6 small nuclear RNA is one of the spliceosomal RNAs essential for pre-mRNA splicing. Discovery of mRNA-type introns in the highly conserved region of the U6 snRNA genes led to the hypothesis that U6 snRNA functions as a catalytic element during pre-mRNA splicing. The highly conserved region of U6 snRNA has a structural similarity with the catalytic domain of the negative strand of the satellite RNA of tobacco ring spot virus [(-)sTRSV], suggesting that the highly conserved region of U6 snRNA forms the catalytic center. We examined whether synthetic RNAs consisting of the sequence of the highly conserved region of U6 snRNA or various chimeric RNAs between the U6 region and the catalytic RNA of (-)sTRSV could cleave a substrate RNA that can partially base-pair with them and have a GU sequence. Chimeric RNAs with 70 to 83% sequence identity with the conserved region of S. pombe U6 snRNA cleaved the substrate RNA at the 5' side of the GU sequence, which is shared by the 5' end of an intron in a pre-mRNA. We found that the highly conserved region of U6 snRNA and the catalytic domain of (-)sTRSV are strikingly similar in structure to the catalytic core region of the group I self-splicing intron in cyanobacteria. These results suggest that U6 snRNA, (-)sTRSV and the group I self-splicing intron originated from a common ancestral RNA, and support the hypothesis that U6 snRNA catalyzes pre-mRNA splicing reaction.     

Optimization and generality of a small deoxyribozyme that ligates RNA

In vitro evolution was previously used to identify a small deoxyribozyme, 7Q10, that ligates RNA with formation of a 2'-5' phosphodiester linkage from a 2',3'-cyclic phosphate and a 5'-hydroxyl group. Ligation occurs in a convenient "binding arms" format analogous to that of the well-known 10-23 and 8-17 RNA-cleaving deoxyribozymes. Here, we report the optimization and generality of 7Q10 as a 2'-5' RNA ligase. By comprehensive mutagenesis of its 16-nucleotide enzyme region, the parent 7Q10 sequence is shown to be optimal for RNA ligation yield, although several mutations are capable of increasing the ligation rate approximately fivefold at the expense of yield. The 7Q10 deoxyribozyme ligates any RNA substrates that form the sequence motif UA GR (arrowhead=ligation site and R=purine), providing at least 30% yield of ligated RNA in approximately 1-2 hours at 37 degrees C and pH 9.0. Comparable yields are obtained in approximately 12-24 hours at pH 7.5, which may be more suitable for larger RNAs that are more sensitive to non-specific degradation. For RNA substrates that form the related ligation junction UA GY (Y=pyrimidine), somewhat lower yields are obtained, but significant ligation activity is still observed. These data establish that 7Q10 is a generally applicable RNA ligase. A plot of log(k(obs)) versus pH from pH 6.9 to 9.0 has a slope of just under 1, suggesting that a single deprotonation occurs during the rate-determining reaction step. The compact 7Q10 deoxyribozyme has both practical utility and the potential for increasing our structural and mechanistic understanding of how nucleic acids can mediate chemical reactions.     

Cloning full-length, cap-trapper-selected cDNAs by using the single-strand linker ligation method.

We have developed the single-strand linker ligation method (SSLLM), which uses DNA ligase to add a dsDNA linker to single-stranded (ss) full-length cDNA. The linkers have random 6-bp (dN6 or dGN5) 3' overhangs that can ligate to any cDNA sequence, thereby facilitating the production of cDNA libraries with titers exceeding 1 x 10(6) independent clones. We confirmed that the 5' ends of cDNA inserts cloned by using SSLLM are full-length and include the 5' untranslated regions. The great advantage of our method is that the elimination of the GC tail simplifies the sequencing and protein translation of the full-length clones. Further, our method tags ss cDNAs more efficiently than does the traditional RNA ligase reaction.     

Scarce adenylation in bacteriophage T4 mRNAs

The degradation of mRNA is crucial for the rapid shift of bacteriophage T4 gene expression from early to late. The present study was conducted to investigate whether T4 mRNA is polyadenylated or not, because polyadenylation is known to facilitate the degradation of mRNA in Escherichia coli cells. Total RNA extracted from T4-infected cells was subjected to self-circularization or intermolecular ligation by T4 RNA ligase, and a region containing the 3'-5' junction was amplified by RT-PCR. Cloning and sequencing as well as the length distribution of amplified DNA fragments revealed no adenines at the 3'-ends of uvsY and soc RNAs. The present result suggests that T4 mRNA is not significantly adenylated.