Colorectal Mucus Binds DC-SIGN and Inhibits HIV-1 Trans-Infection of CD4+ T-Lymphocytes

Bodily secretions, including breast milk and semen, contain factors that modulate HIV-1 infection. Since anal intercourse caries one of the highest risks for HIV-1 transmission, our aim was to determine whether colorectal mucus (CM) also contains factors interfering with HIV-1 infection and replication. CM from a number of individuals was collected and tested for the capacity to bind DC-SIGN and inhibit HIV-1 cis- or trans-infection of CD4⁺ T-lymphocytes. To this end, a DC-SIGN binding ELISA, a gp140 trimer competition ELISA and HIV-1 capture/ transfer assays were utilized. Subsequently we aimed to identify the DC-SIGN binding component through biochemical characterization and mass spectrometry analysis. CM was shown to bind DC-SIGN and competes with HIV-1 gp140 trimer for binding. Pre-incubation of Raji-DC-SIGN cells or immature dendritic cells (iDCs) with CM potently inhibits DC-SIGN mediated trans-infection of CD4⁺ T-lymphocytes with CCR5 and CXCR4 using HIV-1 strains, while no effect on direct infection is observed. Preliminary biochemical characterization demonstrates that the component seems to be large (>100kDa), heat and proteinase K resistant, binds in a α1–3 mannose independent manner and is highly variant between individuals. Immunoprecipitation using DC-SIGN-Fc coated agarose beads followed by mass spectrometry indicated lactoferrin (fragments) and its receptor (intelectin-1) as candidates. Using ELISA we showed that lactoferrin levels within CM correlate with DC-SIGN binding capacity. In conclusion, CM can bind the C-type lectin DC-SIGN and block HIV-1 trans-infection of both CCR5 and CXCR4 using HIV-1 strains. Furthermore, our data indicate that lactoferrin is a DC-SIGN binding component of CM. These results indicate that CM has the potential to interfere with pathogen transmission and modulate immune responses at the colorectal mucosa.     

Inhibition on Proteasome β1 Subunit Might Contribute to the Anti-Cancer Effects of Fangchinoline in Human Prostate Cancer Cells

Fangchinoline is a bisbenzylisoquinoline alkaloid isolated from Radix Stephaniae tetrandrae S. Moore. Fangchinoline and its structure analogue, tetrandrine, exhibited direct binding affinity with recombinant human proteasome β1 subunit and also inhibited its activity in vitro. In cultured prostate PC-3 cells and LnCap cells, fangchinoline could dose-dependently inhibit cell proliferation and caspase-like activity of cellular proteasome which was mediated by proteasome β1 subunit. The inhibitive effect of fangchinoline on caspase-like activity of proteasome was also observed in purified human erythrocyte 20S proteasome. In PC-3 cells, fangchinoline induced cell cycle arrest at G0/G1 phase and apoptosis. Treatment of PC-3 tumor-bearing nude mice with fangchinoline inhibited tumor growth, induced apoptosis and also caused decrease in proteasome activities in tumor xenografts. Dose-dependent and time-dependent accumulation of ubiquitinated proteins and important proteasome substrates such as p27, Bax and IκB-α were observed in fangchinoline-treated cells. Over-expression of proteasome β1 subunit by plasmid transfection increased sensitivity of cells to the cytotoxicity of fangchinoline while knockdown of proteasome β1 subunit ameliorated cytotoxicity of fangchinoline in PC-3 cells. Results of the present study suggested that proteasome inhibition was involved in the anti-cancer effects of fangchinoline. Fangchinoline and its structure analogues might be new natural proteasome inhibitors targeting β1 subunit.     

Fangchinoline inhibits human immunodeficiency virus type 1 replication by interfering with gp160 proteolytic processing

The introduction of highly active antiretroviral therapy has led to a significant reduction in the morbidity and mortality of acquired immunodeficiency syndrome patients. However, the emergence of drug resistance has resulted in the failure of treatments in large numbers of patients and thus necessitates the development of new classes of anti-HIV drugs. In this study, more than 200 plant-derived small-molecule compounds were evaluated in a cell-based HIV-1 antiviral screen, resulting in the identification of a novel HIV-1 inhibitor (fangchinoline). Fangchinoline, a bisbenzylisoquinoline alkaloid isolated from Radix Stephaniae tetrandrae, exhibited antiviral activity against HIV-1 laboratory strains NL4-3, LAI and BaL in MT-4 and PM1 cells with a 50% effective concentration ranging from 0.8 to 1.7 μM. Mechanism-of-action studies showed that fangchinoline did not exhibit measurable antiviral activity in TZM-b1 cells but did inhibit the production of infectious virions in HIV-1 cDNA transfected 293T cells, which suggests that the compound targets a late event in infection cycle. Furthermore, the antiviral effect of fangchinoline seems to be HIV-1 envelope-dependent, as the production of infectious HIV-1 particles packaged with a heterologous envelope, the vesicular stomatitis virus G glycoprotein, was unaffected by fangchinoline. Western blot analysis of HIV envelope proteins expressed in transfected 293T cells and in isolated virions showed that fangchinoline inhibited HIV-1 gp160 processing, resulting in reduced envelope glycoprotein incorporation into nascent virions. Collectively, our results demonstrate that fangchinoline inhibits HIV-1 replication by interfering with gp160 proteolytic processing. Fangchinoline may serve as a starting point for developing a new HIV-1 therapeutic approach.     

Helical tomotherapy for asymptomatic chemotherapy-refractory or -unfit multiple (3 or more) metastases

BackgroundDespite chemotherapy innovations, prognosis of patients with chemotherapy-refractory or -unfit multiple metastases (CRMM/CUMM) remains poor. In this prospective study, the efficacy and toxicity of helical tomotherapy for CRMM/CUMM were evaluated.Materials and methodsBetween 2014 and 2020, asymptomatic patients with CRMM/CUMM with ≥ 3 lesions and no prior radiotherapy of the targets were enrolled. Patients who had intolerable toxicities to chemotherapy and those who refused chemotherapy were included in the CRMM and CUMM groups, respectively. Prostate cancer patients and patients with metastases mainly localized in the liver, lung, or brain were excluded. By helical tomotherapy, up to 10 lesions per patient were irradiated in order of volume. The standard dose was 50–60 Gy in 25–30 fractions.ResultsForty-five patients (median age, 63 years; 35 CRMM/10 CUMM) were enrolled. Primary tumors included lung, gynecological, and gastrointestinal cancers. The most frequently treated targets were lymph node metastases, followed by peritoneal/pleural disseminations and bone tumors. The 1-year survival rate was 51% (median, 12.5 months). In the 35 patients with CRMM, the median survival time was 12.5 months, and the median pre-radiation chemotherapy period was 8.8 months (p > 0.05). The 6-month target control rate was 78%. Acute adverse events (grade ≥ 2) occurred in 33 patients: hematologic toxicities in 23, dermatitis in 6, and others in 8. Late grade ≥ 2 toxicities occurred in 6 patients: pneumonitis in 4 and gastric hemorrhage in 2.ConclusionTomotherapy for CRMM/CUMM resulted in median survival times > 1 year. This treatment should be investigated further in larger prospective studies.     

Complement-mediated antiinflammatory effect of bisbenzylisoquinoline alkaloid fangchinoline.

Complement-mediated mode of action of bisbenzylisoquinoline alkaloid fangchinoline was investigated in vivo and in vitro. The application of fangchinoline intraperitoneally (i.p.) to complement normal mice, strain ICR, inhibited the complement activity in serum and peritoneal exudate. The substance activated serum complement of C5-deficient DBA/2 mice. Fangchinoline was able to provoke local inflammatory reaction in both strains after subcutaneous (s.c.) injection. The alkaloid suppressed paw swelling induced by live Candida albicans in ICR and DBA/2 mice. Its effect depended on the dose and time of injection prior to inflammatory reaction. The in vitro experiments proved the interference of fangchinoline action with post-C5 reactions. The substance augmented C5-convertase formation and functional activity. These results are in correspondence with our previous investigations, proving the complement-mediated action of fangchinoline. The antiinflammatory effect could be a consequence of the caused complement exhaustion.     

Mesenchymal stromal cell‐derived factors promote the colonization of collagen 3D scaffolds with human skin cells

The development of stem cell technology in combination with advances in biomaterials has opened new ways of producing engineered tissue substitutes. In this study, we investigated whether the therapeutic potential of an acellular porous scaffold made of type I collagen can be improved by the addition of a powerful trophic agent in the form of mesenchymal stromal cells conditioned medium (MSC‐CM) in order to be used as an acellular scaffold for skin wound healing treatment. Our experiments showed that MSC‐CM sustained the adherence of keratinocytes and fibroblasts as well as the proliferation of keratinocytes. Moreover, MSC‐CM had chemoattractant properties for keratinocytes and endothelial cells, attributable to the content of trophic and pro‐angiogenic factors. Also, for the dermal fibroblasts cultured on collagen scaffold in the presence of MSC‐CM versus serum control, the ratio between collagen III and I mRNAs increased by 2‐fold. Furthermore, the gene expression for α‐smooth muscle actin, tissue inhibitor of metalloproteinase‐1 and 2 and matrix metalloproteinase‐14 was significantly increased by approximately 2‐fold. In conclusion, factors existing in MSC‐CM improve the colonization of collagen 3D scaffolds, by sustaining the adherence and proliferation of keratinocytes and by inducing a pro‐healing phenotype in fibroblasts.     

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.     

Tetrandrine and fangchinoline,bisbenzylisoquinoline alkaloids from Stephania tetrandra can reverse multidrug resistance by inhibiting P-glycoprotein activity in multidrug resistant human cancer cells

The overexpression of ABC transporters is a common reason for multidrug resistance (MDR) in cancer cells. In this study, we found that the isoquinoline alkaloids tetrandrine and fangchinoline from Stephania tetrandra showed a significant synergistic cytotoxic effect in MDR Caco-2 and CEM/ADR5000 cancer cells in combination with doxorubicin, a common cancer chemotherapeutic agent. Furthermore, tetrandrine and fangchinoline increased the intracellular accumulation of the fluorescent P-glycoprotein (P-gp) substrate rhodamine 123 (Rho123) and inhibited its efflux in Caco-2 and CEM/ADR5000 cells. In addition, tetrandrine and fangchinoline significantly reduced P-gp expression in a concentration-dependent manner. These results suggest that tetrandrine and fangchinoline can reverse MDR by increasing the intracellular concentration of anticancer drugs, and thus they could serve as a lead for developing new drugs to overcome P-gp mediated drug resistance in clinic cancer therapy.     

Identification of a short, hydrophilic amino acid sequence critical for origin recognition by the bovine papillomavirus E1 protein

The E1 protein of bovine papillomavirus (BPV) is a site-specific DNA binding protein that recognizes an 18-bp inverted repeat element in the viral origin of replication. Sequence-specific DNA binding function maps to the region from approximately amino acids 140 to 300, and isolated polypeptides containing this region have been shown to retain origin binding in vitro. To investigate the sequence and structural characteristics which contribute to sequence-specific binding, the primary sequence of this region was examined for conserved features. The BPV E1 DNA binding domain (E1DBD) contains three major hydrophilic domains (HR1, amino acids 179-191; HR2, amino acids 218 to 230; and HR3, amino acids 241 to 252), of which only HR1 and HR3 are conserved among papillomavirus E1 proteins. E1DBD proteins with lysine-to-alanine mutations in HR1 and HR3 were severely impaired for DNA binding function in vitro, while a lysine-to-alanine mutation in HR2 had a minimal effect on DNA binding. Mutation of adjacent threonine residues in HR1 (T187 and T188) revealed that these two amino acids made drastically different contributions to DNA binding, with the T187 mutant being severely defective for origin binding whereas the T188 mutant was only mildly affected. Helical wheel projections of HR1 predict that T187 is on the same helical face as the critical lysine residues whereas T188 is on the opposing face, which is consistent with their respective contributions to DNA binding activity. To examine E1 binding in vivo, a yeast one-hybrid system was developed. Both full-length E1 and the E1DBD polypeptide were capable of specifically interacting with the E1 binding site in the context of the yeast genome, and HR1 was also critical for this in vivo interaction. Overall, our results indicate that HR1 is essential for origin binding by E1, and the features and properties of HR1 suggest that it may be part of a recognition sequence that mediates specific E1-nucleotide contacts.     

Epitope mapping of function‐blocking monoclonal antibody CM6 suggests a “weak” integrin binding site on the laminin‐332 LG2 domain

Laminin‐332 (Ln‐332) is an extracellular matrix molecule that regulates cell adhesion, spreading, and migration by interaction with cell surface receptors such as α3β1 and α6β4. Previously, we developed a function‐blocking monoclonal antibody against rat Ln‐332, CM6, which blocks hemidesmosome assembly induced by Ln‐332‐α6β4 interactions. However, the location of its epitope on Ln‐332 has remained unclear. In this study, we show that the CM6 epitope is located on the laminin G‐like (LG)2 module of the Ln‐332 α3 chain. To specify the residues involved in this epitope, we produced a series of GST‐fused α3 LG2 mutant proteins in which rat‐specific acids were replaced with human acids by a site‐directed mutagenesis strategy. CM6 reactivity against these proteins showed that CM6 binds to the ¹⁰⁸⁹NERSVR¹⁰⁹⁴ sequence of rat Ln‐332 LG2 module. In a structural model, this sequence maps to an LG2 loop sequence that is exposed to solvent according to predictions, consistent with its accessibility to antibody. CM6 inhibits integrin‐dependent cell adhesion on Ln‐332 and inhibits cell spreading on both Ln‐332 and recombinant LG2 (rLG2; but not rLG3), suggesting the presence of an α3β1 binding site on LG2. However, we were unable to show that rLG2 supports adhesion in standard assays, suggesting that LG2 may contain a “weak” integrin binding site, only detectable in spreading assays that do not require washes. These results, together with our previous findings, indicate that binding sites for α3β1 and α6β4 are closely spaced in the Ln‐332 LG domains where they regulate alternative cell functions, namely adhesion/migration or hemidesmosome anchoring. J. Cell. Physiol. 223:541–548, 2010. © 2010 Wiley‐Liss, Inc.     

The effect of specific immunization or infection with Trichostrongylus colubriformis on production of eosinophil differentiation factors in guinea pigs.

The cultivation of bone marrow was used to quantitate the levels of eosinophil differentiation factors (EDF) produced in conditioned medium (CM) by incubation of mesenteric lymph node cells (MLNC) with mitogens or specific antigens from the intestinal nematode parasite, Trichostrongylus colubriformis. In liquid cultures with 20 units ml⁻¹ recombinant murine interleukin-5 (IL-5), bone marrow cells (BMC) from either normal or infected donors contained <5% eosinophils and differentiated to> 50% eosinophils over 2–3 weeks. Conditioned medium from 3–4 week infected donors produced between 20 and 50% eosinophils when donor MLNC were stimulated with the specific antigen preparation SP3, but macrophages predominated when using CM from MLNC incubated with Concanavalin A (ConA). CM from MLNC of challenged donors incubated with SP3 produced 30–70% eosinophils in BMC assays, with highest levels induced by CM from high responder (HR) donors. Marrow from parasitized or normal donors gave rise to comparable proportions of eosinophils. CM was also produced from LNC of donors given protein or parasite antigens in adjuvant where between 28 and 35% eosinophils were produced in culture. There were no differences between activities attributable to the antigen, but Freund's complete adjuvant induced earlier differentiation of BMC than alum-induced CM. The results confirm that high levels of EDF activity are specifically induced by parasitic infection, and can also be produced by intraperitoneal and subcutaneous inoculation of adjuvanted antigens. Consistent with the greater eosinophilia exhibited by HR guinea pigs to infection with T.colubriformis L3, their MLNC also produced the highest levels of EDF activity.     

Therapeutic angiogenesis using tumor cell‐conditioned medium

Stem cell‐conditioned medium (CM), which contains angiogenic factors that are secreted by stem cells, represents a potential therapy for ischemic diseases. Along with stem cells, tumor cells also secrete various angiogenic factors. Here, tumor cells as a cell source of CM for therapeutic angiogenesis was evaluated and the therapeutic efficacy of tumor cell CM in mouse hindlimb ischemia models was demonstrated. CM obtained from a human fibrosarcoma HT1080 cell line culture was compared with CM obtained from a human bone marrow‐derived mesenchymal stem cell (MSC) culture. HT1080 CM contained higher concentrations of angiogenic factors compared with MSC CM, which was attributable to the higher cell density that resulted from a much faster growth rate of HT1080 cells compared with MSCs. For use in in vitro and in vivo angiogenesis studies, HT1080 CM was diluted such that HT1080 CM and MSC CM would have the same cell number basis. The two types of CMs induced the same extent of human umbilical vein endothelial cell (HUVEC) proliferation in vitro. The injection of HT1080 CM into mouse ischemic limbs significantly improved capillary density and blood perfusion compared with the injection of fresh medium. Although the therapeutic outcome of HT1080 CM was similar to that of MSC CM, the preparation of CM by tumor cell line culture would be much more efficient due to the faster growth and unlimited life‐time of the tumor cell line. These data suggest the potential application of tumor cell CM as a therapeutic modality for angiogenesis and ischemic diseases. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:456–464, 2016     

Characterization of the heptad repeat regions, HR1 and HR2, and design of a fusion core structure model of the spike protein from severe acute respiratory syndrome (SARS) coronavirus

Severe acute respiratory syndrome coronavirus (SARS-CoV) is a newly emergent virus responsible for a worldwide epidemic in 2003. The coronavirus spike proteins belong to class I fusion proteins, and are characterized by the existence of two heptad repeat (HR) regions, HR1 and HR2. The HR1 region in coronaviruses is predicted to be considerably longer than that in other type I virus fusion proteins. Therefore the exact binding sequence to HR2 from the HR1 is not clear. In this study, we defined the region of HR1 that binds to HR2 by a series of biochemical and biophysical measures. Subsequently the defined HR1 (902-952) and HR2 (1145-1184) chains, which are different from previously defined binding regions, were linked together by a flexible linker to form a single-chain construct, 2-Helix. This protein was expressed in Escherichia coli and forms a typical six-helix coiled coil bundle. Highly conserved HR regions between mouse hepatitis virus (MHV) and SARS-CoV spike proteins suggest a similar three-dimensional structure for the two fusion cores. Here, we constructed a homology model for SARS coronavirus fusion core based on our biochemical analysis and determined the MHV fusion core structure. We also propose an important target site for fusion inhibitor design and several strategies, which have been successfully used in fusion inhibitor design for human immunodeficiency virus (HIV), for the treatment of SARS infection.     

Calcium-calmodulin and regulation of brush border myosin-I MgATPase and mechanochemistry

We examined the Ca(2+)-dependent regulation of brush border (BB) myosin- I by probing the possible roles of the calmodulin (CM) light chains. BB myosin-I MgATPase activity, sensitivity to chymotryptic digestion, and mechanochemical properties were assessed using 1-10 microM Ca2+ and in the presence of exogenously added CM since it has been proposed that this myosin is regulated by calcium-induced CM dissociation from the 119-kD heavy chain. Each of these BB myosin-I properties were dramatically altered by the same threshold of 2-3 microM Ca2+. Enzymatically active NH2-terminal proteolytic fragments of BB myosin-I which lack the CM binding domains (the 78-kD peptide) differ from CM- containing peptides in that the former is completely insensitive to Ca2+. Furthermore, the 78-kD peptide exhibits high levels of MgATPase activity which are comparable to that observed for BB myosin-I in the presence of Ca2+. This suggests that Ca2+ regulates BB myosin-I MgATPase by binding directly to the CM light chains, and that CM acts to repress endogenous MgATPase activity. Ca(2+)-induced CM dissociation from BB myosin-I can be prevented by the addition of exogenous CM. Under these conditions Ca2+ causes a reversible slowing of motility. In contrast, in the absence of exogenous CM, motility is stopped by Ca2+. We demonstrate this reversible slowing is not due to the presence of inactive BB myosin-I molecules exerting a "braking" effect on motile filaments. However, we did observe Ca(2+)-independent slowing of motility by acidic phospholipids, suggesting that factors other than Ca2+ and CM content can affect the mechanochemical properties of BB myosin-I.     

Biacore surface matrix effects on the binding kinetics and affinity of an antigen/antibody complex

To characterize a proprietary therapeutic monoclonal antibody (mAb) candidate, a rigorous biophysical study consisting of 53 Biacore and kinetic exclusion assay (KinExA) experiments was undertaken on the therapeutic mAb complexing with its target antigen. Unexpectedly, the observed binding kinetics depended on the chip used, suggesting that the negatively charged carboxyl groups on CM5, CM4, and C1 chips were adversely affecting the Biacore kinetic results. To study this hypothesis, Biacore solution-phase and KinExA equilibrium titrations, as well as KinExA kinetic measurements, were performed to establish accurate values for the affinity and kinetic rate constants of the binding reaction between antigen and mAb. The results revealed that as the negative charge on the biosensor surface decreased, the binding kinetics and K(D) approached the accurate binding parameters more closely when measured in solution. Two potential causes for the artifactual Biacore surface-based measurements are (i) steric hindrance of antigen binding arising from an interaction of the negatively charged carboxymethyldextran matrix with the mAb, which is a highly basic protein with a pI of 9.4, and (ii) an electrostatic repulsion between the negatively charged antigen and the carboxymethyldextran matrix. Importantly, simple diagnostic tests can be performed early in the measurement process to identify these types of matrix-mediated artifacts.     

IRES-dependent translation of egr2 is induced under inflammatory conditions

Adjusting translation is crucial for cells to rapidly adapt to changing conditions. While pro-proliferative signaling via the PI3K-mTOR-pathway is known to induce cap-dependent translation, stress conditions, such as nutrient deprivation or hypoxia often activate alternative modes of translation, e.g., via internal ribosome entry sites (IRESs). As the effects of inflammatory conditions on translation are only poorly characterized, we aimed at identifying translationally deregulated targets in inflammatory settings. For this purpose, we cocultured breast tumor cells with conditioned medium of activated monocyte-derived macrophages (CM). Polysome profiling and microarray analysis identified early growth response-2 (egr2) to be regulated at the level of translation. Using bicistronic reporter assays, we found that egr2 contains an IRES within its 5′ UTR, which facilitated enhanced translation upon CM treatment. We further provide evidence that the activity of egr2-IRES was induced by IL-1β and p38-MAPK signaling. In addition, we identified several potential IRES trans-acting factors (ITAFs) such as polypyrimidine tract binding protein (PTB) and hnRNP-A1 that directly bind to the egr2-5′UTR. In summary, our data provide evidence that egr2 expression is translationally regulated via an IRES element, which is responsive to an inflammatory environment.     

Heptad repeat 2-based peptides inhibit avian sarcoma and leukosis virus subgroup a infection and identify a fusion intermediate

Fusion proteins of enveloped viruses categorized as class I are typified by two distinct heptad repeat domains within the transmembrane subunit. These repeats are important structural elements that assemble into the six-helix bundles characteristic of the fusion-activated envelope trimer. Peptides derived from these domains can be potent and specific inhibitors of membrane fusion and virus infection. To facilitate our understanding of retroviral entry, peptides corresponding to the two heptad repeat domains of the avian sarcoma and leukosis virus subgroup A (ASLV-A) TM subunit of the envelope protein were characterized. Two peptides corresponding to the C-terminal heptad repeat (HR2), offset from one another by three residues, were effective inhibitors of infection, while two overlapping peptides derived from the N-terminal heptad repeat (HR1) were not. Analysis of envelope mutants containing substitutions within the HR1 domain revealed that a single amino acid change, L62A, significantly reduced sensitivity to peptide inhibition. Virus bound to cells at 4 degrees C became sensitive to peptide within the first 5 min of elevating the temperature to 37 degrees C and lost sensitivity to peptide after 15 to 30 min, consistent with a transient intermediate in which the peptide binding site is exposed. In cell-cell fusion experiments, peptide inhibitor sensitivity occurred prior to a fusion-enhancing low-pH pulse. Soluble receptor for ASLV-A induces a lipophilic character in the envelope which can be measured by stable liposome binding, and this activation was found to be unaffected by inhibitory HR2 peptide. Finally, receptor-triggered conformational changes in the TM subunit were also found to be unaffected by inhibitory peptide. These changes are marked by a dramatic shift in mobility on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, from a subunit of 37 kDa to a complex of about 80 kDa. Biotinylated HR2 peptide bound specifically to the 80-kDa complex, demonstrating a surprisingly stable envelope conformation in which the HR2 binding site is exposed. These experiments support a model in which receptor interaction promotes formation of an envelope conformation in which the TM subunit is stably associated with its target membrane and is able to bind a C-terminal peptide.