Mengovirus and encephalomyocarditis virus poly(C) tract lengths can affect virus growth in murine cell culture

Many virulent aphthoviruses and cardioviruses have long homopolymeric poly(C) tracts in the 5' untranslated regions of their RNA genomes. A panel of genetically engineered mengo-type cardioviruses has been described which contain a variety of different poly(C) tract lengths. Studies of these viruses have shown the poly(C) tract to be dispensable for growth in HeLa cells, although the relative murine virulence of the viruses correlates directly and positively with tract length. Compared with wild-type mengovirus strain M, mutants with shortened poly(C) tracts grow poorly in mice and protectively immunize rather than kill recipient animals. In the present study, several murine cell populations were tested to determine whether, unlike HeLa cells, they allowed a differential amplification of viruses with long or short poly(C) tracts. Replication and cytopathic studies with four hematopoietically derived cell lines (CH2B, RAW 264.7, A20.J, and P815) and two murine fibroblast cell lines [L929 and L(Y)] demonstrated that several of these cell types indeed allowed differential virus replication as a function of viral poly(C) tract length. Among the most discerning of these cells, RAW 264.7 macrophages supported vigorous lytic growth of a long-tract virus, vMwt (C(44)UC(10)), but supported only substantially diminished and virtually nonlytic growth of vMC(24) (C(13)UC(10)) and vMC(0) short-tract viruses. The viral growth differences evident in all cell lines were apparent early and continuously during every cycle of virus amplification. The data suggest that poly(C) tract-dependent attenuation of mengovirus may be due in part to a viral replication defect manifest in similar hematopoietic-type cells shortly after murine infection. The characterized cultures should provide excellent tools for molecular study of poly(C) tract-mediated virulence.     

Mutational analysis of the mengovirus poly(C) tract and surrounding heteropolymeric sequences.

Previously, we described three mengovirus mutants derived from cDNA plasmids, containing shortened poly(C) tracts (C8, C12, and C13UC10), that exhibited strong attenuation for virulence in mice yet grew like wild-type virus in HeLa cells. Thirteen additional mutants hav now been constructed and characterized. Five of these differ only in poly(C) length, including one with a precise deletion of the tract. The other mutants bear deletions into the regions juxtaposing poly(C). Studies with HeLa cells confirm the essential dispensability of mengovirus's poly(C) tract but reveal a subtle, measurable correlation between poly(C) length and plaque diameter. Virulence studies with mice also revealed a strong correlation between poly(C) length and virulence. For the poly(C)-flanking mutations, the 15 bases directly 5' of the tract proved dispensable for virus viability, whereas the 20 to 30 bases 3' of poly(C) were critical for growth, thus implicating this region in the basal replication of the virus.     

Analysis of an RNA pseudoknot structure by CD spectroscopy.

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.     

Possible involvement of coaxially stacked double pseudoknots in the regulation of −1 programmed ribosomal frameshifting in RNA viruses

?1 programmed ribosomal frameshifting (PRF) in viruses is often stimulated by a pseudoknot downstream from the slippery sequence. At the PRF junction of HIV-1, transmissible gastroenteritis virus (TGEV), Barmah Forest virus (BFV), Fort Morgan virus (FMV), and Equine arteritis virus (EAV), we identified potential double pseudoknots in either a tandem mode or embedded mode. In viruses with tandem pseudoknots (5′PK & 3′PK), the slippery sequence is encompassed in the 5′PK. The ribosome needs to unwind the 5′PK to get to the slippery sequence. In HIV-1, the 3′PK and several alternative structures are mutually exclusive. Disruption of the tandem pseudoknots may enable one of the alternative structures to form as the effective frameshift stimulator. In TGEV/BFV/FMV, the 3′PK is a conventional frameshift stimulator. In all cases, the tandem pseudoknots may slow down the ribosome before it reaches the conventional PRF signals. In EAV, a compact pseudoknot is embedded within loop2 of the otherwise conventional frameshift-stimulating pseudoknot. All double pseudoknots have the potential to stack their stems coaxially. We built structural models of the HIV-1 and EAV double pseudoknots to show that both the tandem and embedded modes are feasible and reasonable. We hypothesize that the fundamental reason for the viruses to utilize coaxially stacked double pseudoknots is to increase the overall stability of the frameshift regulating structure, and avoid an ultra-stable single pseudoknot which may become a ribosomal roadblock. Our results significantly expand the repertoire of RNA structures and dynamics that may potentially involve in ?1 PRF regulation.     

Three of four pseudoknots in tmRNA are interchangeable and are substitutable with single-stranded RNAs

A novel translation, trans-translation, is facilitated by a highly structured RNA molecule, tmRNA. This molecule has two structural domains, a tRNA domain and an mRNA domain, the latter including four pseudoknot structures (PK1 to PK4). Here, we show that replacement of each of these pseudoknots, except PK1, in Escherichia coli tmRNA with a single stranded RNA did not seriously affect the functions as an alanine tRNA and as an mRNA. Furthermore, these three pseudoknots were interchangeable with only small losses of the two functions. These findings suggest that neither PK2, PK3 nor PK4 interacts in a functional manner with ribosome during the trans-translation process. Together with an earlier study showing the significance of PK1, it is concluded that among the four pseudoknots, PK1 is the most functional.     

Crystal structure of a luteoviral RNA pseudoknot and model for a minimal ribosomal frameshifting motif

To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter. Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.     

Analysis of an RNA Pseudoknot Structure by CD Spectroscopy

Abstract

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.     

Genomic RNA of mengovirus V. Recognition of common features by ribosomes and eucaryotic initiation factor 2.

Binding of ribosomes to the 32P-labeled genomic RNA of mengovirus was studied in lysates of mouse L929 and Krebs ascites cells under conditions for initiation of translation. Upon total digestion with RNase T1, the 32P-labeled RNA protected in either 40S or 80S initiation complexes yielded four unique, large oligonucleotides. Each of these oligonucleotides occurred once in the viral RNA molecule. The same four oligonucleotides were recovered from 80S initiation complexes formed in lysates in which unlabeled mengovirus RNA had been translated extensively, indicating that recognition by ribosomes was not modulated detectably by a viral translation product. The recognition of intact, 32P-labeled mengovirus RNA by eucaryotic initiation factor 2 (eIF-2) was examined by direct complex formation. Fingerprint analysis of the RNA protected by eIF-2 against RNase T1 digestion yielded three T1 oligonucleotides that were identical to three of the four oligonucleotides protected in either 40S or 80S initiation complexes. A physical map of the large T1 oligonucleotides of the mengovirus RNA molecule was constructed, and the four protected oligonucleotides were found to map internally, within the region between the polycytidylate tract and the 3' end. For either ribosomes or eIF-2, the protected oligonucleotides could not be arranged in a continuous sequence, suggesting that they constitute at least two widely separated domains. These results show that ribosomes recognize and blind to more than a single sequence in mengovirus RNA, located internally in regions that are far removed from the 5' end of the molecule. eIF-2 itself binds with high specificity to mengovirus RNA, recognizing apparently three of the four sequences recognized by ribosomes.     

Genomic RNA of mengovirus. VI. Translation of its two cistrons in lysates of interferon-treated cells.

The addition of low levels (40 ng/ml) of the synthetic double-stranded polyribonucleotide poly I:C to lysates of interferon-treated L-cells resulted in a strong inhibition (70 to 75%) of the in vitro translation of mengovirus RNA. Under these conditions, the rates of incorporation of [35S]methionine or formyl-[35S]methionine were depressed to a comparable extent. The sequences of mengovirus RNA recognized by ribosomes of interferon-treated cells at initiation of translation were compared with those present in initiation complexes formed by ribosomes of untreated controls. Fingerprint analysis revealed that the same sequences of mengovirus RNA were protected against nuclease attack by the 80S and the 40S initiation complexes formed in vitro in lysates of control or interferon-treated L-cells. Mengovirus RNA-coded proteins were labeled at their N-terminal end with formyl-[35S]methionine and digested to completion with trypsin. The resulting fragments were separated by high-voltage paper electrophoresis. Two different formyl-[35S]methionine-labeled N termini were resolved. Further analyses supported the notion that the two radioactive peaks originated in the initiation of translation at two different sites. This pattern did not change when mengovirus RNA was translated in lysates of interferon-treated cells.     

Highly conserved RNA pseudoknots at the gag-pol junction of HIV-1 suggest a novel mechanism of ?1 ribosomal frameshifting

−1 programmed ribosomal frameshifting (PRF) is utilized by many viruses to synthesize their enzymatic (Pol) and structural (Gag) proteins at a defined ratio. For efficient −1 PRF, two cis-acting elements are required: a heptanucleotide frameshift site and a downstream stimulator such as a pseudoknot. We have analyzed the gag-pol junction sequences from 4254 HIV-1 strains. Approximately ninety-five percent of the sequences can form four pseudoknots PK1–PK4 (∼97% contain PK1, PK3, and PK4), covering ∼72 nt including the frameshift site. Some pseudoknots are mutually excluded due to sequence overlap. PK1 and PK3 arrange tandemly. Their stems form a quasi-continuous helix of ∼22 bp. We propose a novel mechanism for possible roles of these pseudoknots. Multiple alternative structures may exist at the gag-pol junction. In most strains, the PK1–PK3 tandem pseudoknots may dominate the structurally heterogeneous pool of RNA due to their greater overall stability. The tandem pseudoknots may function as a breaking system to slow down the ribosome. The ribosome unwinds PK1 and stem 1 of PK3 before it can reach the frameshift site. Then, PK4 can form rapidly because the intact stem 2 of PK3 makes up a large part of the stem 1 of PK4. The newly formed PK4 jams the entrance of the mRNA tunnel. The process then proceeds as in a typical case of −1 PRF. This mechanism incorporates several exquisite new features while still being consistent with the current paradigm of pseudoknot-dependent −1 PRF.     

An investigation of the stability of messenger RNAs in cell-free,translational systems from uninfected and mengovirus-infected Ehrlich ascites tumor cells

The stabilities and translation of Ehrlich ascites tumor cell poly(A)-containing mRNA and mengovirus RNA in fractionated cell-free protein synthesizing systems from uninfected and mengovirus-infected Ehrlich ascites tumor cells were studied. During incubation of the systems about 20% of the input RNA is reduced in size and associated with ribosomes engaged in polypeptide synthesis; the remainder is rapidly degraded by RNases. At the end of active translation, both mRNA and nascent proteins are bound to polysomes which are of the same size as those formed during active protein synthesis. The kinetics of protein synthesis closely follow those of RNA hydrolysis. The stabilities of mengovirus RNA and poly(A)-containing mRNA from Ehrlich ascites tumor cells are the same in both systems.     

Structural elements in the internal ribosome entry site of Plautia stali intestine virus responsible for binding with ribosomes

Plautia stali intestine virus (PSIV) has an internal ribosome entry site (IRES) at the intergenic region of the genome. The PSIV IRES initiates translation with glutamine rather than the universal methionine. To analyze the mechanism of IRES-mediated initiation, binding of IRES RNA to salt-washed ribosomes in the absence of translation factors was studied. Among the three pseudoknots (PKs I, II and III) within the IRES, PK III was the most important for ribosome binding. Chemical footprint analyses showed that the loop parts of the two stem–loop structures in Domain 2, which are highly conserved in related viruses, are protected by 40S but not by 60S ribosomes. Because PK III is close to the two loops, these structural elements were considered to be important for binding of the 40S subunit. Competitive binding analyses showed that the IRES RNA does not bind poly(U)-programmed ribosomes preincubated with tRNA^Phe or its anticodon stem– loop (ASL) fragment. However, Domain 3-deleted IRES bound to programmed ribosomes preincubated with the ASL, suggesting that Domains 1 and 2 have roles in IRES binding to 40S subunits and that Domain 3 is located at the ribosome decoding site.     

Nucleotide sequence analysis of avian retroviruses: structural similarities with transposable elements

Integrated retroviral genomes are flanked by direct repeats of sequences derived from the termini of the viral RNA genome. These sequences are designated long terminal repeats (LTRs). We have determined and analyzed the nucleotide sequence of the LTRs from several exogenous and endogenous avian retroviruses. These LTRs possess several structural similarities with eukaryotic and prokaryotic transposable elements: 1) inverted complementary repeats at the termini, 2) deletions of sequences adjacent to the LTR, 3) small duplications of host sequences flanking the integrated provirus, and 4) sequence homologies with transposable and other genetic elements. These observations suggest that LTRs function in the integration and perhaps transposition of retrovirus genomes. Evidence exists for the presence of a strong promoter sequence within the LTR. The retroviral LTR also contains a "Hogness box" up-stream of the capping site and a poly(A) signal. These features suggest an additional role for the LTR in the regulation of gene expression.     

3' RNA elements in hepatitis C virus replication: kissing partners and long poly(U)

The hepatitis C virus (HCV) genomic RNA possesses conserved structural elements that are essential for its replication. The 3′ nontranslated region (NTR) contains several of these elements: a variable region, the poly(U/UC) tract, and a highly conserved 3′ X tail, consisting of stem-loop 1 (SL1), SL2, and SL3. Studies of drug-selected, cell culture-adapted subgenomic replicons have indicated that an RNA element within the NS5B coding region, 5BSL3.2, forms a functional kissing-loop tertiary structure with part of the 3′ NTR, 3′ SL2. Recent advances now allow the efficient propagation of unadapted HCV genomes in the context of a complete infectious life cycle (HCV cell culture [HCVcc]). Using this system, we determine that the kissing-loop interaction between 5BSL3.2 and 3′ SL2 is required for replication in the genotype 2a HCVcc context. Remarkably, the overall integrity of the 5BSL3 cruciform is not an absolute requirement for the kissing-loop interaction, suggesting a model in which trans-acting factor(s) that stabilize this interaction may interact initially with the 3′ X tail rather than 5BSL3. The length and composition of the poly(U/UC) tract were also critical determinants of HCVcc replication, with a length of 33 consecutive U residues required for maximal RNA amplification. Interrupting the U homopolymer with C residues was deleterious, implicating a trans-acting factor with a preference for U over mixed pyrimidine nucleotides. Finally, we show that both the poly(U) and kissing-loop RNA elements can function outside of their normal genome contexts. This suggests that the poly(U/UC) tract does not function simply as an unstructured spacer to position the kissing-loop elements.     

In Vivo Addition of Poly(A) Tail and AU-Rich Sequences to the 3′ Terminus of the Sindbis Virus RNA Genome: a Novel 3′-End Repair Pathway

Alphaviruses are mosquito-transmitted RNA viruses that cause important diseases in both humans and livestock. Sindbis virus (SIN), the type species of the alphavirus genus, carries a 11.7-kb positive-sense RNA genome which is capped at its 5′ end and polyadenylated at its 3′ end. The 3′ nontranslated region (3′NTR) of the SIN genome carries many AU-rich motifs, including a 19-nucleotide (nt) conserved element (3′CSE) and a poly(A) tail. This 3′CSE and the adjoining poly(A) tail are believed to regulate the synthesis of negative-sense RNA and genome replication in vivo. We have recently demonstrated that the SIN genome lacking the poly(A) tail was infectious and that de novo polyadenylation could occur in vivo (K. R. Hill, M. Hajjou, J. Hu, and R. Raju, J. Virol. 71:2693–2704, 1997). Here, we demonstrate that the 3′-terminal 29-nt region of the SIN genome carries a signal for possible cytoplasmic polyadenylation. To further investigate the polyadenylation signals within the 3′NTR, we generated a battery of mutant genomes with mutations in the 3′NTR and tested their ability to generate infectious virus and undergo 3′ polyadenylation in vivo. Engineered SIN genomes with terminal deletions within the 19-nt 3′CSE were infectious and regained their poly(A) tail. Also, a SIN genome carrying the poly(A) tail but lacking a part or the entire 19-nt 3′CSE was also infectious. Sequence analysis of viruses generated from these engineered SIN genomes demonstrated the addition of a variety of AU-rich sequence motifs just adjacent to the poly(A) tail. The addition of AU-rich motifs to the mutant SIN genomes appears to require the presence of a significant portion of the 3′NTR. These results indicate the ability of alphavirus RNAs to undergo 3′ repair and the existence of a pathway for the addition of AU-rich sequences and a poly(A) tail to their 3′ end in the infected host cell. Most importantly, these results indicate the ability of alphavirus replication machinery to use a multitude of AU-rich RNA sequences abutted by a poly(A) motif as promoters for negative-sense RNA synthesis and genome replication in vivo. The possible roles of cytoplasmic polyadenylation machinery, terminal transferase-like enzymes, and the viral polymerase in the terminal repair processes are discussed.     

Evidence for functional protein interactions required for poliovirus RNA replication

Poliovirus protein 2C contains a predicted N-terminal amphipathic helix that mediates association of the protein with the membranes of the viral RNA replication complex. A chimeric virus that contains sequences encoding the 18-residue core from the orthologous amphipathic helix from human rhinovirus type 14 (HRV14) was constructed. The chimeric virus exhibited defects in viral RNA replication and produced minute plaques on HeLa cell monolayers. Large plaque variants that contained mutations within the 2C-encoding region were generated upon subsequent passage. However, the majority of viruses that emerged with improved growth properties contained no changes in the region encoding 2C. Sequence analysis and reconstruction of genomes with individual mutations revealed changes in 3A or 2B sequences that compensated for the HRV14 amphipathic helix in the polio 2C-containing proteins, implying functional interactions among these proteins during the replication process. Direct binding between these viral proteins was confirmed by mammalian cell two-hybrid analysis.