Analysis of the DNAs from seven varicella-zoster virus isolates.

The 32P-labeled DNAs from seven different clinical isolates of human varicella-zoster virus (VZV) were independently digested with five site-specific restriction endonucleases, EcoRI, HindIII, SmaI, BamHI, and AvaI. The digestion products were analyzed by electrophoresis on 0.5% agarose gels followed by autoradiography of the dried gels. Evaluation of the restriction enzyme cleavage patterns revealed small variations among the VZV DNAs. The VZV DNAs were also compared based on their buoyant densities in CsCl. No significant buoyant density differences were detected among the VZV DNAs.     

Adenovirus types 2 and 5 functions elicit replication and late expression of adenovirus type 12 DNA in hamster cells.

A recombinant plasmid harboring both genomic termini of tupaia herpesvirus (THV) DNA was characterized by restriction enzyme analysis and by determination of the nucleotide sequence. A unique NotI cleavage site was found that is located approximately 19 base pairs upstream of the THV terminal junction. THV DNA fragments from virion DNA were analyzed by using the same restriction enzymes as for the recombinant plasmid. The comparative fine mapping of virion THV DNA revealed heterogeneous molecules of variable lengths with the NotI cleavage site conserved. A number of short direct and inverted repeats and palindromes were found surrounding the THV terminal joint. The THV repetitive sequences were compared with the repeats reported for the DNA termini of herpes simplex virus, varicella-zoster virus, and Epstein-Barr virus and are discussed in respect to signals for a site-specific endonuclease required for packaging.     

Restriction fragment length polymorphism of polymerase chain reaction products from vaccine and wild-type varicella-zoster virus isolates.

The nucleotide changes that result in two restriction endonuclease polymorphisms that differentiate wild-type varicella-zoster virus (VZV) from the vaccine strain were determined. Oligonucleotide primers that flank these sites were used to amplify the intervening sequences with the polymerase chain reaction to identify VZV DNA in clinical isolates. Restriction enzyme digestion of the amplification products distinguished vaccine and wild-type genomes from one another. This study confirms the feasibility of amplifying VZV sequences so that they may be detected in clinical specimens and provides a molecular epidemiological approach to strain identification of VZV in vesicular lesions.     

Cleavage of Epstein-Barr virus DNA by restriction endonucleases EcoRI, HindIII and BamI.

The cleavage of the DNAs of the B95-8 and P3HR-1 virus strains of Epstein-Barr virus by the restriction endonucleases EcoRI, HindIII and BamI was investigated using a new technique for quantitative evaluation of the fluorescence of ethidium stained DNA fragments separated on agarose gels. The results obtained with B95-8 DNA showed that in addition to the limited repetitions of nucleotide sequences observed in the EcoRI and HindIII cleavage patterns, the molecule contained a BamI fragment with a molecular mass of 2.0 megadaltons which was present in a total of about 11 copies and localized to a limited part of the DNA molecule. The same sequences were also present in the P3HR-1 DNA albeit in a lower molar ratio. P3HR-1 DNA yielded restriction enzyme cleavage patterns suggesting DNA sequence heterogeneity of P3HR-1 virus. No fragment was present in more than about 4 copies per molecule of P3HR-1 DNA. Comparison of the restriction enzyme cleavage patterns of P3HR-1 and B95-8 DNA revealed a high degree of structural homology emphasized by nucleic acid hybridization experiments with EBV complementary RNA synthesized in vitro.     

Anatomy of herpes simplex virus DNA. III. Characterization of defective DNA molecules and biological properties of virus populations containing them.

We have characterized the virus progeny and its DNA from plaque-purified and undiluted passages of herpes simplex virus 1 in HEp-2 cells. Secifically, (i) infectious virus yields declined progressively in passages 1 through 10 and gradually increased at passages 11 through 14. The yields correlated with PFU/particle ratios. (ii) In cells infected with virus from passages 6 through 10, there was an overproduction of an early viral polypeptide (no. 4) and a delay in the synthesis of late viral proteins. In addition, the virus in these passages interfered with the replication of a nondefective marker virus. Cells infected with passage 14 virus produced normal amounts of polypeptide 4 and, moreover, this virus showed minimal interfering capacity. (iii) In addition to DNA of density 1.726 g/cm-3, which was the sole component present in viral progeny of passage 0, passages 6 through 14 contained one additional species (p 1.732) and in some instances (passages 6 and 10) also DNA of an intermediate buoyant density. The ratio of p 1.732 to p 1.726 DNA increased to a maximum of 4 in passages 6 through 9 and gradually decreased to 1 in passages 10 through 14. (iv) p 1.732 DNA cannot be differentiated from p 1.726 DNA with respect to size; however, it has no Hin III restriction enzyme cleavage sites and yields only predominantly two kinds of fragments with molecular weights of 5.1 x 10-6 and 5.4 x 10-6 upon digestion with EcoRI enzyme. (v) Partial denaturation profiles of purified p 1.732 DNA from passage 14 revealed the presence of two types of tandemly repeated units corresponding roughly in size to the EcoRI fragments and situated in different molecules. (vi) In addition to the two kinds of p 1.732 molecules consisting of tandem repaeat units of different sizes, other evidence for the diversity of defective DNA molecules emerged from comparisons of specific infectivity and interfering capacity of the progeny from various passages. The data suggest that some of the particles with DNA of normal buoyant density (1.726) must also be defective since the capacity to interfere and to produce an excess of polypeptide 4 did not appear to be proportional to the amount of high-buoyant-density defective DNA. The data suggest that defective interfering particles are replaced by defective particles with diminished capacity to interfere and that more than one species of defective DNA molecules evolves on serial preparation of HSV.     

Restriction endonuclease mapping of linear unintegrated proviral DNA of bovine leukemia virus.

A detailed restriction map was deduced for the genome of the exogenous bovine leukemia virus. The cleavage sites for nine restriction enzymes were mapped. The unintegrated linear viral DNA intermediate that is produced by infection of permissive cells with bovine leukemia virus was isolated. The linear viral DNA had a unique restriction map, indicating that it is not a set of random circular permutations of the RNA genome. From hybridization with a 3'-enriched probe, the DNA restriction map was aligned relative to the 5'-to-3' orientation of the viral RNA. Restriction enzyme analysis of integrated bovine leukemia virus information present in animals with enzootic bovine leukosis provided evidence for the existence of genetic variants of the virus.     

In vitro synthesis of double-stranded DNA from the Kilham rat virus single-stranded DNA genome.

Double-stranded, full-length linear DNA was synthesized in vitro by using single-stranded linear DNA as a self-priming template from the parvovirus Kilham rat virus and Escherichia coli DNA polymerase "large fragment" as the polymerizing enzyme. To ascertain the order of the synthesis of the cleavage fragments and to assess the accuracy of the in vitro synthesis, restriction endonuclease cleavage sites with known recognition sequences were mapped on the DNA. Comparing the cleavage pattern of the synthesized DNA with that of double-stranded viral DNA isolated from infected cells confirms that the in vitro synthesis produces a faithful copy of the viral single-stranded genome. Electron micrographs of the in vitro product reveal it to be a double-stranded linear molecule.     

Molecular cloning and characterization of human papilloma virus DNA derived from a laryngeal papilloma

Papilloma virus DNA from a laryngeal papilloma was cloned in phage lambda L 47 and characterized after cleavage with different restriction enzymes. Hybridization with the DNAs of human papilloma virus types 1, 2, 3, 4, 5, and 8 showed no homology under stringent hybridization conditions. Human papilloma virus type 6 DNA, however, was partially identical to laryngeal papilloma virus DNA; different restriction enzyme fragments hybridizing with the other DNA were identified on each genome. The degree of homology was determined by reassociation kinetics to be 25%. According to the present nomenclature, laryngeal papilloma virus therefore represents a different type of human papilloma virus and is tentatively designated as human papilloma virus type 11. Sequences homologous to laryngeal papilloma virus DNA were also found in four of nine additional laryngeal papillomas. Attempt to detect homologous DNA in 12 carcinomas of the larynx were negative.     

Studies of simian virus 40 DNA. VII. A cleavage map of the SV40 genome

A physical map of the Simian virus 40 genome has been constructed on the basis of specific cleavage of Simian virus 40 DNA by bacterial restriction endonucleases. The 11 fragments produced by enzyme from Hemophilus influenzae have been ordered by analysis of partial digest products and by analysis of an overlapping set of fragments produced by enzyme from Hemophilus parainfluenzae. In addition, the single site in SV40 DNA cleaved by the Escherichia coli R_I restriction endonuclease has been located. With this site as a reference point, the H. influenzae cleavage sites and the H. parainfluenzae cleavage sites have been localized on the map.     

Characterization of guinea pig cytomegalovirus DNA.

The genome of guinea pig cytomegalovirus (GPCMV) was analyzed and compared with that of human cytomegalovirus (HCMV). GPCMV and HCMV DNAs were isolated from virions and further purified by CsCl centrifugation. Purified GPCMV DNA sedimented as a single peak in a neutral sucrose gradient and was infectious when transfected into guinea pig embryo fibroblast cells. The cytopathology was characteristic of that seen after infection with GPCMV. Virus DNA purified from virions isolated from infected GPEF or 104C1 cells had a CsCl buoyant density of 1.713 g/cm3, which corresponds to a guanine plus cytosine content of 54.1%. The CsCl buoyant density of GPCMV DNA was slightly less than that of HCMV DNA (1.716 g/cm3), but sufficiently different so that the two virus DNA peaks did not coincide. GPCMV DNA cosedimented with T4 DNA in a neutral sucrose gradient. Restriction endonuclease cleavage of GPCMV or HCMV DNAs with HindIII, XbaI, or EcoRI yielded fragments easily separable by agarose gel electrophoresis and ranging from 1.0 X 10(6) to 25.8 X 10(6) daltons. The number, size, and molarity of GPCMV DNA fragments generated by restriction enzymes were determined. Hybridization of restriction endonuclease-cleaved GPCMV DNA with radioactively labeled HCMV DNA and, conversely, hybridization of restriction endonuclease-cleaved HCMV DNA with radioactively labeled GPCMV DNA indicated sequence homology between the two virus DNAs.     

Cleavage map of BK virus DNA with restriction endonucleases MboI and HaeIII.

Specific cleavage of BK virus (MM) DNA with restriction endonuclease MboI gives rise to 10 fragments. Two techniques were used to determine the location of these fragments on the viral genome with respect to the three known sites for HindIII cleavage. In the first method, reciprocal digestion, individual MboI fragments were digested with HindIII and individual HindIII fragments were digested with MboI. In the second method, single-end 32P-labeled HindIII subfragments were partially digested with MboI, and then the sizes of the radioactive partial products were used to deduce the nearest neighboring fragment. Information from these two methods is more than adequate to map all the MboI enzyme sites. Cleavage of BK virus (MM) DNA with restriction enzyme HaeIII produces 21 fragments. With the aid of the same two methods, these fragments have also been ordered with respect to the known map locations of the HindIII and MboI sites.     

Restriction enzyme mapping of vaccinia virus DNA.

The cleavage sites for the restriction enzymes Bg/I, HindIII, KpnI, SalI, SmaI, and XhoI were located, from primary data, on the DNA isolated from the WR strain of vaccinia virus. Bg/I and SmaI divide the DNA into five segments which can be isolated by sucrose gradient centrifugation. These large segments provide a convenient means to group segments produced by other enzymes. The construction of physical maps was initiated by identifying the segments at each end of the DNA and then finding segments which were adjacent to these terminal sections. This was accomplished by isolating large shear fragments which contained the covalently linked termini of the DNA. Most of the data needed to derive the maps were obtained by isolating segments produce by one enzyme and then cleaving these individual segments with a second enzyme.     

DNA of noninfectious and infectious integrated spleen necrosis virus (SNV) is colinear with unintegrated SNV DNA and not grossly abnormal.

The cleavage sites of eight restriction endonucleases in linear spleen necrosis virus (SNV) DNA were mapped, and the map was oriented with respect to viral RNA. With the aid of this map, several structural features of the viral DNA were elucidated: unintegrated linear SNV DNA is terminally redundant; the majority of SNV DNA molecules integrated in chicken DNA, which were previously shown to be present in many sites in cellular DNA, are colinear with unintegrated viral DNA; no tandem integration of proviral molecules is detectable; and the majority of integrated SNV DNA molecules, including integrated SNV DNA molecules previously shown to be noninfectious, do not have an altered restriction enzyme digestion pattern.     

Site-specific DNA cleavage by Chlorella virus topoisomerase II

The DNA cleavage reaction of topoisomerase II is central to the catalytic activity of the enzyme and is the target for a number of important anticancer drugs. Unfortunately, efforts to characterize this fundamental reaction have been limited by the low levels of DNA breaks normally generated by the enzyme. Recently, however, a type II topoisomerase with an extraordinarily high intrinsic DNA cleavage activity was isolated from Chlorella virus PBCV-1. To further our understanding of this enzyme, the present study characterized the site-specific DNA cleavage reaction of PBCV-1 topoisomerase II. Results indicate that the viral enzyme cleaves DNA at a limited number of sites. The DNA cleavage site utilization of PBCV-1 topoisomerase II is remarkably similar to that of human topoisomerase IIalpha, but the viral enzyme cleaves these sites to a far greater extent. Finally, PBCV-1 topoisomerase II displays a modest sensitivity to anticancer drugs and DNA damage in a site-specific manner. These findings suggest that PBCV-1 topoisomerase II represents a unique model with which to dissect the DNA cleavage reaction of eukaryotic type II topoisomerases.     

Virion DNA of ground squirrel hepatitis virus: structural analysis and molecular cloning.

The structure of the encapsidated DNA genome of ground squirrel hepatitis virus (GSHV) has been examined by restriction endonuclease cleavage, nucleic acid hybridization, and molecular cloning. GSHV virion DNA is a relaxed circular molecule of approximately 3,200 bases in length; most molecules harbor an extensive single-stranded region which is largely confined to one-half of the genome. The full-length viral DNA strand is covalently bound to protein. The single-stranded region can be repaired in vitro by the action of the endogenous virion polymerase, exogenously added DNA polymerase from avian myeloblastosis virus, or both. Restriction enzyme cleavage of viral DNA from different isolates demonstrated that multiple variants of GSHV exist in nature. The genomes of two such strains have been cloned in Escherichia coli, and their physical maps have been determined. Nucleic acid hybridization studies revealed that the strains share sequence homology with the DNA of human hepatitis B virus. Regions homologous to the coding regions for the surface and core antigens of human hepatitis B virus have been localized on the GSHV chromosome. Molecular cloning experiments have also led to the identification of a region of the viral genome which is altered in a procaryotic host.     

Restriction endonuclease mapping of the proviral DNA of the exogenous RIII murine mammary tumor virus

Cellular DNA containing integrated murine mammary tumor virus (MuMTV) was isolated from FeI/C6 feline kidney cells and CCL64 mink lung cells infected with milkborne RIII MuMTV. By using restriction enzyme HpaI, intact RIII MuMTV provirus (length, 8.7 kilobases [kb]) was excised from the cellular DNA. Subsequent restriction endonuclease analysis of this HpaI fragment with KpnI, HindIII, EcoRI, BamHI, BglII, PstI, SstI, SalI, and XhoI enabled us to construct a map of the RIII virus genome. A comparison of this map with the maps of the GR and C3H MuMTV's revealed that there are greater sequence differences between the RIII virus and the GR and C3H MuMTV proviruses than there are between the GR and C3H proviruses. The following are features of the restriction map unique to the RIII provirus: the presence of three BamHI and two EcoRI cleavage sites, a HpaI cleavage site in the terminal 3'-5' repeat unit of the provirus, and the absence of an XhoI cleavage site. Another distinguishing feature of the RIII provirus is that the sizes of some of the restriction fragments produced by cleavage of the RIII provirus with PstI are different from the sizes of the fragments obtained by PstI cleavage of the GR and C3H proviruses. Like the GR proviral DNA, the RIII proviral DNA has three SstI (SacI) cleavage sites, whereas the C3H provirus has only two SstI sites. HpaI digestion of MuMTV-infected mink lung cell DNA revealed only one class of provirus (an 8.7-kb fragment); however, we observed several minor classes of RIII proviral DNA in addition to the major class of provirus DNA in infected cat kidney cells. PstI digestion of the HpaI 8.7-kb fragments from both feline and mink cells generated a 3.7-kb DNA fragment identical in size to a PstI-generated fragment that has been found in GR and C3H milkborne virus-infected cells. Although a fragment similar in size to the milkborne 3.7-kb PstI fragment has been found as an endogenous component in many C3H and GR mouse tissues, we did not observe such an endogenous fragment in the RIII mouse strain. Therefore, the 3.7-kb fragment may be useful as a marker for the milkborne RIII MuMTV provirus in RIII mice.     

Errant processing and structural alterations of genomes present in a varicella-zoster virus vaccine.

Five minority populations of aberrant, varicella-zoster virus (VZV)-derived genomes were identified among the encapsidated DNAs obtained from the nuclear and cytoplasmic fractions of an in vitro infection initiated with a lyophilized sample of the BIKEN VZV vaccine (strain Oka). These were (i) VZV genomes, present within nuclear but not cytoplasmic viral capsids, which had been cleaved at a specific site within the short segment and which were, therefore, 3.15 megadaltons (approximately 4% of the VZV genome length) short of full length; (ii) highly deleted, repetitive VZV genomes which contained the errant cleavage site but not the usual VZV genome terminal sequences; (iii) VZV genomes into which multiples of 1 through 5 defective genome repeat units had been inserted into a homologous site; (iv) VZV genomes with additions of 0.1 or 0.18 megadaltons of DNA at both the terminal and internal ends of the short segment; and (v) VZV DNA which had lost the HindIII restriction site at map position 0.11.     

Characterization of an immunosuppressive parvovirus related to the minute virus of mice.

We have characterized an immunosuppressive parvovirus related to the minute virus of mice (MVM). The parvovirus, MVM(i), grew efficiently on the murine lymphoma cell line EL-4 and not on the A-9 strain of L-cells which is a host for the prototype MVM. MVM(i) was immunosuppressive for allogeneic mixed leukocyte cultures, inhibiting the generation of cytolytic T lymphocytes. MVM had no effect on mixed leukocyte cultures. MVM and MVM(i) particles were similar in buoyant density, sedimentation rate, appearance in the electron microscope, and polypeptide composition. We present restriction enzyme maps of the DNAs of MVM and MVM(i) which show that they are closely related. Out of 109 restriction endonuclease cleavage sites (representing together about 10% of the nucleotide sequence), 86 sites were shared by MVM and MVM(i), whereas 22 sites were absent from one of the two viruses. MVM(i) DNA had an apparent deletion of about 60 nucleotides relative to MVM, located near the 5' terminus of viral DNA.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.     

Structure of replicating herpes simplex virus DNA.

We have investigated the molecular anatomy of the herpes simplex virus replicative intermediates by cleavage with the restriction endonuclease BglII. We find that in populations of multiply infected cells, pulse-labeled replicating herpes simplex virus DNA contains at least two and probably all four sequence isomers. Also, it contains no detectable termini. In pulse-chase experiments, we show that endless replicative intermediates are the precursors to virion DNA and that maturation is a relatively slow process. The results are discussed in terms of their significance to possible models of herpes simplex virus DNA replication.