Tri-nucleotide repeats and their association with genes in rice genome

Tri-nucleotide repeats (TNRs) are extremely abundant in rice genome, of which CCG/CGG repeats have an advantage over other repeats, with approximate half of all the TNRs in the genome. Our results show that rice genome has relatively abundant TNRs with high GC content, and containing only purines or pyrimidines under the same GC content. The AAT/ATT repeats that occur predominantly in intergenic and intronic regions have a considerably higher average length than that of other repeats. The highest frequency of TNRs occurs in 5′-UTR regions, followed by in coding and 5′-flanking regions. Purines-rich TNRs prefer to the coding regions, but pyrimidines-rich TNRs exhibit a stronger bias to upstream regions, suggesting that they might be considered as the regulatory elements in gene expression. As if TNRs located predominantly near the start of coding regions do not significantly influence on the protein function.     

Tri-nucleotide repeats and their association with genes in rice genome

Tri-nucleotide repeats (TNRs) are extremely abundant in rice genome, of which CCG/CGG repeats have an advantage over other repeats, with approximate half of all the TNRs in the genome. Our results show that rice genome has relatively abundant TNRs with high GC content, and containing only purines or pyrimidines under the same GC content. The AAT/ATT repeats that occur predominantly in intergenic and intronic regions have a considerably higher average length than that of other repeats. The highest frequency of TNRs occurs in 5'-UTR regions, followed by in coding and 5'-flanking regions. Purines-rich TNRs prefer to the coding regions, but pyrimidines-rich TNRs exhibit a stronger bias to upstream regions, suggesting that they might be considered as the regulatory elements in gene expression. As if TNRs located predominantly near the start of coding regions do not significantly influence on the protein function.     

Finding of novel telomeric repeats and their distribution in the human genome

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.     

Genome-wide analysis of microsatellite repeats in humans: their abundance and density in specific genomic regions

Background  

Simple sequence repeats (SSRs) are found in most organisms, and occupy about 3% of the human genome. Although it is becoming clear that such repeats are important in genomic organization and function and may be associated with disease conditions, their systematic analysis has not been reported. This is the first report examining the distribution and density of simple sequence repeats (1-6 base-pairs (bp)) in the entire human genome.     

Identification of genes containing expanded purine repeats in the human genome and their apparent protective role against cancer

Purine repeat sequences present in a gene are unique as they have high propensity to form unusual DNA-triple helix structures. Friedreich’s ataxia is the only human disease that is well known to be associated with DNA-triplexes formed by purine repeats. The purpose of this study was to recognize the expanded purine repeats (EPRs) in human genome and find their correlation with cancer pathogenesis. We developed “PuRepeatFinder.pl” algorithm to identify non-overlapping EPRs without pyrimidine interruptions in the human genome and customized for searching repeat lengths, n ≥ 200. A total of 1158 EPRs were identified in the genome which followed Wakeby distribution. Two hundred and ninety-six EPRs were found in geneic regions of 282 genes (EPR-genes). Gene clustering of EPR-genes was done based on their cellular function and a large number of EPR-genes were found to be enzymes/enzyme modulators. Meta-analysis of 282 EPR-genes identified only 63 EPR-genes in association with cancer, mostly in breast, lung, and blood cancers. Protein–protein interaction network analysis of all 282 EPR-genes identified proteins including those in cadherins and VEGF. The two observations, that EPRs can induce mutations under malignant conditions and that identification of some EPR-gene products in vital cell signaling-mediated pathways, together suggest the crucial role of EPRs in carcinogenesis. The new link between EPR-genes and their functionally interacting proteins throws a new dimension in the present understanding of cancer pathogenesis and can help in planning therapeutic strategies. Validation of present results using techniques like NGS is required to establish the role of the EPR genes in cancer pathology.     

Alu repeats and human genomic diversity

During the past 65 million years, Alu elements have propagated to more than one million copies in primate genomes, which has resulted in the generation of a series of Alu subfamilies of different ages. Alu elements affect the genome in several ways, causing insertion mutations, recombination between elements, gene conversion and alterations in gene expression. Alu-insertion polymorphisms are a boon for the study of human population genetics and primate comparative genomics because they are neutral genetic markers of identical descent with known ancestral states.     

Alu repeats in the human genome

Highly repetitive DNA sequences account for more than 50% of the human genome. The L1 and Alu families harbor the most common mammalian long (LINEs) and short (SINEs) interspersed elements. Alu elements are each a dimer of similar, but not identical, fragments of total size about 300 bp, and originate from the 7SL RNA gene. Each element contains a bipartite promoter for RNA polymerase III, a poly(A) tract located between the monomers, a 3'-terminal poly(A) tract, and numerous CpG islands, and is flanked by short direct repeats. Alu repeats comprise more than 10% of the human genome and are capable of retroposition. Possibly, these elements played an important part in genome evolution. Insertion of an Alu element into a functionally important genome region or other Alu-dependent alterations of gene functions cause various hereditary disorders and are probably associated with carcinogenesis. In total, 14 Alu families differing in diagnostic mutations are known. Some of these, which are present in the human genome, are polymorphic and relatively recently inserted into new loci. Alu copies transposed during ethnic divergence of the human population are useful markers for evolutionary genetic studies.     

TRbase: a database relating tandem repeats to disease genes for the human genome

MOTIVATION: Tandem repeats are associated with disease genes, play an important role in evolution and are important in genomic organization and function. Although much research has been done on short perfect patterns of repeats, there has been less focus on imperfect repeats. Thus, there is an acute need for a tandem repeats database that provides reliable and up to date information on both perfect and imperfect tandem repeats in the human genome and relates these to disease genes. RESULTS: This paper presents a web-accessible relational tandem repeats database that relates tandem repeats to gene locations and disease genes of the human genome. In contrast to other available databases, this database identifies both perfect and imperfect repeats of 1-2000 bp unit lengths. The utility of this database has been illustrated by analysing these repeats for their distribution and frequencies across chromosomes and genomic locations and between protein-coding and non-coding regions. The applicability of this database to identify diseases associated with previously uncharacterized tandem repeats is demonstrated.     

Evolution of Alu repeats: dynamics of distribution in genome

A mathematical model of evolutionary dynamics of Alu repeats' number in the human genome has been worked out. The model permitted us to observe the dynamics of propagation of Alu repeats within the genome and to evaluate such important parameters of the process mentioned as the rates of transposition (insertion of new copies into the genome) and excision of repeats. The peculiarities of the control of Alu repeats' number in the genome have been discussed, based on the data obtained.     

Orthologous microRNA genes are located in cancer-associated genomic regions in human and mouse

Background

MicroRNAs (miRNAs) are short non-coding RNAs that regulate differentiation and development in many organisms and play an important role in cancer.

Methodology/Principal Findings

Using a public database of mapped retroviral insertion sites from various mouse models of cancer we demonstrate that MLV-derived retroviral inserts are enriched in close proximity to mouse miRNA loci. Clustered inserts from cancer-associated regions (Common Integration Sites, CIS) have a higher association with miRNAs than non-clustered inserts. Ten CIS-associated miRNA loci containing 22 miRNAs are located within 10 kb of known CIS insertions. Only one CIS-associated miRNA locus overlaps a RefSeq protein-coding gene and six loci are located more than 10 kb from any RefSeq gene. CIS-associated miRNAs on average are more conserved in vertebrates than miRNAs associated with non-CIS inserts and their human homologs are also located in regions perturbed in cancer. In addition we show that miRNA genes are enriched around promoter and/or terminator regions of RefSeq genes in both mouse and human.

Conclusions/Significance

We provide a list of ten miRNA loci potentially involved in the development of blood cancer or brain tumors. There is independent experimental support from other studies for the involvement of miRNAs from at least three CIS-associated miRNA loci in cancer development.     

The male-derived genome after sperm-egg fusion: Spatial distribution of chromosomal DNA and paternal-maternal genomic association

After fusion with an egg, the haploid genome of a mammalian sperm expands from a volume of a few cubic microns to a volume of several thousand cubic microns in a fully developed zygote pronucleus. Using fluorescent in situ hybridization we studied two aspects of the chromatin organization of the sperm-derived genome during this process in a model system involving fusion of human sperm with hamster eggs. We found that (a) from the beginning of sperm head decondensation to early pronuclear stages, the hybridization signal of a probe targeted to the satellite III heterochromatin of chromosome 1 appeared as an irregularly shaped domain. In fully developed pronuclei, the signal became a fiber as much as 20-fold more extended compared with interphase somatic nuclei. The signal appeared as a string of non-uniformly distributed beads with interspersed gaps. A similar spatial distribution and appearance recurred after the first cleavage division. (b) Male-and female-derived genomes assembled non-randomly on the first mitotic spindle, and continued to be sequestered from each other in the nuclei of two-cell stages.by J.B. Rattner     

Distribution of Alu repeats along the human genome: formation of clusters and features of insertion regions

The contextual analysis of nucleotide sequences of 22 Alu repeats arrangement regions in the human genome has been carried out and some of their peculiarities have been revealed. In particular, the occurrence of marked and statistical non-random homology between the repeats and the regions of their integration has been shown. A mechanism of choosing the Alu repeats insertion regions in the genome has been suggested taking into account these peculiarities. Using a sample of the 80 human Alu repeats sequences peculiarities of these repeats location within the genome has been investigated. A tendency to the formation of Alu repeats clusters in various regions of the genome was revealed. A range of possible mechanisms on such Alu clusters emergence is considered. On the basis of the data obtained an "attraction" mechanism, according to which integration of Alu repeats into the definite region of the genome increases the insertion probability of other Alu repeats into the same region, are proposed.     

Direct repeats at nuclear matrix-associated DNA regions and their putative control function in the replicating eukaryotic genome

Short DNA regions, known to contain replication origins, were isolated from 2 M NaCl resistant nuclear structures of Physarum polycephalum after predigestion with DNase. Regions of 100 bp average length were cloned and sequenced. About 25% of the clones contained direct repeats of 12 to 16 bp and variable base sequences, that have been shown to possess the potential of playing a crucial role in the control of DNA replication. In one of the two alternative three-dimensional configurations such repeats expose single-stranded loops that can function as sites for the initiation of new DNA strands. As these regions are converted into full-length duplexes by their own replication, reinitiaton at the same site is excluded. Restoration of the initiable configuration is considered to be coupled to structural rearrangements involved in the transient condensation of chromosomes in mitosis. This mechanisms ensures that any part of the entire eukaryotic genome is reproduced just a single time during one cell cycle.     

Rapid evolution and complex structural organization in genomic regions harboring multiple prolamin genes in the polyploid wheat genome

Genes encoding wheat prolamins belong to complicated multi-gene families in the wheat genome. To understand the structural complexity of storage protein loci, we sequenced and analyzed orthologous regions containing both gliadin and LMW-glutenin genes from the A and B genomes of a tetraploid wheat species, Triticum turgidum ssp. durum. Despite their physical proximity to one another, the gliadin genes and LMW-glutenin genes are organized quite differently. The gliadin genes are found to be more clustered than the LMW-glutenin genes which are separated from each other by much larger distances. The separation of the LMW-glutenin genes is the result of both the insertion of large blocks of repetitive DNA owing to the rapid amplification of retrotransposons and the presence of genetic loci interspersed between them. Sequence comparisons of the orthologous regions reveal that gene movement could be one of the major factors contributing to the violation of microcolinearity between the homoeologous A and B genomes in wheat. The rapid sequence rearrangements and differential insertion of repetitive DNA has caused the gene islands to be not conserved in compared regions. In addition, we demonstrated that the i-type LMW-glutenin originated from a deletion of 33-bps in the 5′ coding region of the m-type gene. Our results show that multiple rounds of segmental duplication of prolamin genes have driven the amplification of the ω-gliadin genes in the region; such segmental duplication could greatly increase the repetitive DNA content in the genome depending on the amount of repetitive DNA present in the original duplicate region. Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users. Shuangcheng Gao and Yong Qiang Gu contributed equally to the work.     

Epimutations of imprinted genes in the human genome: Classification,causes, association with hereditary pathology

Genomic imprinting is an epigenetic phenomenon characterized by monoallelic expression of the genes depending on their parental origin. The molecular basis of this expression is covalent modifications of DNA and histones that are formed during maturation of germline cells. Abnormalities of the establishment of genomic imprinting during gametogenesis or its maintenance at various stages of development, caused by aberrant epigenetic modifications of the chromatin, predominantly disturbance of DNA methylation state, are a form of mutational variability of imprinted genomic loci. In this review, we consider the spectrum of epimutations of imprinted genes, present their classification, and discuss possible causes of their appearance and their role in etiology of hereditary human diseases.     

A genome-wide association study uncovers novel genomic regions and candidate genes of yield-related traits in upland cotton

Key message

A total of 62 SNPs associated with yield-related traits were identified by a GWAS. Based on significant SNPs, two candidate genes pleiotropically increase lint yield.

Abstract

Improved fibre yield is considered a constant goal of upland cotton (Gossypium hirsutum) breeding worldwide, but the understanding of the genetic basis controlling yield-related traits remains limited. To better decipher the molecular mechanism underlying these traits, we conducted a genome-wide association study to determine candidate loci associated with six yield-related traits in a population of 719 upland cotton germplasm accessions; to accomplish this, we used 10,511 single-nucleotide polymorphisms (SNPs) genotyped by an Illumina CottonSNP63K array. Six traits, including the boll number, boll weight, lint percentage, fruit branch number, seed index and lint index, were assessed in multiple environments; large variation in all phenotypes was detected across accessions. We identified 62 SNP loci that were significantly associated with different traits on chromosomes A07, D03, D05, D09, D10 and D12. A total of 689 candidate genes were screened, and 27 of them contained at least one significant SNP. Furthermore, two genes (Gh_D03G1064 and Gh_D12G2354) that pleiotropically increase lint yield were identified. These identified SNPs and candidate genes provide important insights into the genetic control underlying high yields in G. hirsutum, ultimately facilitating breeding programmes of high-yielding cotton.