Transformation of Bacillus subtilis in α-Amylase Productivity by Deoxyribonucleic Acid from B. subtilis var. amylosacchariticus

Deoxyribonucleic acid (DNA) of Bacillus subtilis var. amylosacchariticus showed almost the same ability as B. subtilis Marburg to induce transfer of several genetic markers in DNA-mediated transformation. DNA-DNA hybridization data also showed an intimate relationship between the two strains. Genetic elements involved in the production of extracellular alpha-amylase (EC 3.2.1.1.) in B. subtilis var. amylosacchariticus were studied by using DNA-mediated transformation. Two Marburg derivatives, NA20(amyR2) and NA20-22(amyR1), produced about 50 and 10 U of alpha-amylase per mg of cells, respectively, whereas B. subtilis var. amylosacchariticus produced as much as 150 U of the enzyme per mg of cells. When B. subtilis var. amylosacchariticus was crossed with strain NA20-22 as recipient, transformants that acquired high alpha-amylase productivity (about 50 U/mg of cells) were obtained. Genetic analysis revealed that a regulator gene (amyR) for alpha-amylase synthesis was found in B. subtilis var. amylosacchariticus, as in the case of B. natto 1212 (amyR2) and B. subtilis Marburg (amyR1). The allele was designated amyR3; it is phenotypically indistinguishable from amyR2, but is readily distinguishable from amyR1. The presence of amyR3 was not sufficient for an organism to render production of an exceptional amount of alpha-amylase. Extra-high alpha-amylase producers could be obtained by crossing B. subtilis var. amylosacchariticus as donor with strain NA20 as recipient. The transformants produced the same or even greater amounts of the enzyme than the donor strain. Results suggest the presence of another gene that is involved in the production of the exceptional amount of alpha-amylase.     

Molecular cloning, nucleotide sequencing, and expression of the Bacillus subtilis (natto) IAM1212 alpha-amylase gene, which encodes an alpha-amylase structurally similar to but enzymatically distinct from that of B. subtilis 2633.

An alpha-amylase gene of Bacillus subtilis (natto) IAM1212 was cloned in a lambda EMBL3 bacteriophage vector, and the nucleotide sequence was determined. An open reading frame encoding the alpha-amylase (AMY1212) consists of 1,431 base pairs and contains 477 amino acid residues, which is the same in size as the alpha-amylase (AMY2633) of B. subtilis 2633, an alpha-amylase-hyperproducing strain, and smaller than that of B. subtilis 168, Marburg strain. The amino acid sequence of AMY1212 is different from that of AMY2633 at five residues. Enzymatic properties of these two alpha-amylases were examined by introducing the cloned genes into an alpha-amylase-deficient strain, B. subtilis M15. It was revealed that products of soluble starch hydrolyzed by AMY1212 are maltose and maltotriose, while those of AMY2633 are glucose and maltose. From the detailed analyses with oligosaccharides as substrates, it was concluded that the difference in hydrolysis products of the two similar alpha-amylases should be ascribed to the different activity hydrolyzing low-molecular-weight substrates, especially maltotriose; AMY1212 slowly hydrolyzes maltotetraose and cannot hydrolyze maltotriose, while AMY2633 efficiently hydrolyzes maltotetraose and maltotriose. Further analyses with chimeric alpha-amylase molecules constructed from the cloned genes revealed that only one amino acid substitution is responsible for the differences in hydrolysis products.     

Regulation of Neutral Protease Productivity in Bacillus subtilis: Transformation of High Protease Productivity

A transformable strain of Bacillus subtilis 6160, a derivative of B. subtilis 168, produces three kinds of casein hydrolytic enzymes (alkaline protease, neutral protease, and esterase) in a culture medium. B. natto IAM 1212 produces 15 to 20 times as much total proteolytic activity as does B. subtilis. Extracellular proteases produced by the two strains were separated into each enzyme fraction by diethylaminoethyl-Sephadex A-50 column chromatography. The difference in the total protease activities of extracellular proteases between the two strains was due to the amount of neutral protease. The ratios of neutral protease activity to alkaline protease activity (N/A) were 1.1 in B. subtilis 6160 and 13.0 in B. natto IAM 1212. Enzymological and immunological properties of alkaline protease and neutral protease obtained from the two strains were quite similar or identical, respectively. Specific activities measured by an immunological analysis of the two neutral proteases against casein were also equal. A genetic character of high protease productivity in B. natto IAM 1212 was transferred to B. subtilis 6160 by the deoxyribonucleic acid-mediated transformation. Among 73 transformants that acquired high protease productivity, 69 produced a higher amount of neutral protease and the ratios of N/A were changed to 15 to 60. Three other strains were transformed in the productivity of neutral protease and alpha-amylase simultaneously, and one showed considerable change in the production of alkaline protease and neutral protease. The specific activities (casein hydrolytic activities/enzyme molecules) of neutral proteases from the representative four transformants were equal to those of the two parental strains. These results suggested the presence of a specific gene(s) that participated in the productivity of neutral protease in B. subtilis.     

Isolation and characterization of a cis-acting mutation conferring catabolite repression resistance to alpha-amylase synthesis in Bacillus subtilis.

Bacillus subtilis 168GR10 was shown to contain a mutation, gra-10, which allowed normal temporal activation of alpha-amylase synthesis in the presence of a concentration of glucose that is inhibitory to activation of amylase synthesis in the parent strain, 168. The gra-10 mutation was mapped by phage PBS-1-mediated transduction and by transformation to a site between lin-2 and aroI906, very tightly linked to amyE, the alpha-amylase structural gene. The gra-10 mutation did not pleiotropically affect catabolite repression of sporulation or of the synthesis of extracellular proteases or RNase and was unable to confer glucose-resistance to the synthesis of chloramphenicol acetyltransferase encoded by the cat-86 gene driven by the amyE promoter region (amyR1) inserted into the promoter-probe plasmid pPL603B. It therefore appears that gra-10 defines a cis-regulatory site for catabolite repression, but not for temporal activation, of amyE expression. The evidence shows that temporal activation and glucose-mediated repression of alpha-amylase synthesis in B. subtilis 168 are distinct phenomena that can be separated by mutation.     

Molecular cloning of cis-acting regulatory alleles of the Bacillus subtilis amyR region by using gene conversion transformation.

Three cis-acting alleles (gra-10, gra-5, and amyR2) of the Bacillus subtilis amyR promoter locus each cause catabolite repression-resistance of amyE-encoded alpha-amylase synthesis. The gra-10, gra-5, and amyR2 alleles were transferred from the chromosomes of their respective hosts to a plasmid carrying the amyR1-amyE+ gene by the process of gene conversion which is carried out during transformation of competent B. subtilis by plasmid clones carrying homologous DNA. The cloned amyR promoter regions containing the gra-10 and gra-5 mutations were shown to confer catabolite repression-resistance in cis to the synthesis of chloramphenicol acetyltransferase encoded by the cat-86 indicator gene when subcloned into the promoter-probe plasmid pPL603B. Implications concerning both the regulation of amyR utilization and the process of gene conversion in B. subtilis are discussed.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

Isolation of Mutants Defective in α-Amylase from Bacillus subtilis: Genetic Analyses

The rate of alpha-amylase (EC 3.2.1.1) synthesis in Bacillus subtilis is regulated by a gene, amyR, located near a structural gene, amyE, for the enzyme. To construct a fine map of the amyR-amyE region, we isolated 28 mutants defective in alpha-amylase activity. Eleven mutants out of 28 showed no alpha-amylase activity, whereas the other 17 showed less alpha-amylase activity than the parent. Out of 17 partially positive alpha-amylase mutants, 10 produced temperature-sensitive enzymes, and 4 produced immunologically altered enzymes, two of which are concurrently temperature-sensitive, and 5 produced smaller amounts of alpha-amylases which are indistinguishable from normal enzyme in their temperature sensitivity and immunological properties. Two out of 11 alpha-amylase-negative mutants produced material that cross-reacted with anti-amylase serum, and 3 mutants carried suppressible mutations by the suppressor described by Okubo. Mapping data indicate that all 28 mutation sites are located in the amyE region, and none of the groups of the mutants mentioned above contains lesions that are clustered in a single region of amyE. The amyR gene seems most likely to adjoin the terminal region of amyE.     

Maltose adaptive mutant of heterotrophic marine bacterium, Alteromonas espejiana Bal-31: changes in the growth and the induction of extracellular alpha-amylase

Growth of the heterotrophic marine bacterium, Alteromonas espejiana Bal-31 was inhibited in the presence of sucrose, maltose and even glucose, but not with starch. Extracellular alpha-amylase was induced with a lag phase of 2 h in the presence of starch. In contrast, cell growth of the S2a mutant was not affected by the addition of maltose, and starch was ineffective in the induction of extracellular alpha-amylase in this mutant. Activity of extracellular alpha-amylase was induced from the S2a mutant with a 4-h lag phase in the presence of maltose, and the high level of enzyme activity was maintained for at least 24 h. Activity of alpha-amylase induced by both wild type starch and S2a mutant maltose cultures were mainly observed in extracellular locations. This activity could be stopped by tetracycline treatment, indicating that enzyme induction was dependant on gene expression and not on enzyme protein secretory mechanisms. Our results showed that the mutation in S2a changed the growth and the modulation of the specific alpha-amylase in response to carbon nutrients.     

Production of alpha-amylase in fed-batch cultures of vgb+ and vgb- recombinant Escherichia coli: some observations.

Synthesis and excretion of Bacillus stearothermophilus alpha-amylase is analyzed in fed-batch cultivations of Escherichia coli JM103[pMK79] and E. coli JM103[pMK57], the former strain containing the plasmid-encoded Vitreoscilla hemoglobin (VHb) gene (vgb) and the latter strain being devoid of this gene. Fed-batch operation is observed to be substantially superior to batch operation as concerns the alpha-amylase production rate and the extent of excretion of the enzyme. Faster feeding of a nutrient medium (LB or M9) discourages synthesis of alpha-amylase. While synthesis of alpha-amylase in the vgb(-) strain is discouraged when oxygen availability is reduced, the reverse is the case with the vgb(+) strain, the promotion of alpha-amylase synthesis in the latter strain being linked to the synthesis of VHb. Increased availability of the principal carbon source (glucose) in a defined medium leads to overproduction of both alpha-amylase and VHb under oxygen limitation, which may be responsible for the segregational instability observed with the vgb(+) strain. The very high extents of excretion of alpha-amylase attained in fed-batch cultures are encouraging for downstream processing of the recombinant protein.     

Mutation of Bacillus subtilis causing hyperproduction of alpha-amylase and protease, and its synergistic effect.

Mutants that had a genetic lesion increasing the production of alpha-amylase and protease simultaneously were isolated from a transformable strain of Bacillus subtilis Marburg by N-methyl-N'-nitro-N-nitrosoguanidine treatment. These mutants produced two to three times more alpha-amylase and five to 16 times more protease than their parent and were tentatively referred to as AP mutants. As this mutation seems to have occurred at a single gene of the bacterial chromosome and was not located near the alpha-amylase structural gene, the gene was designated as "pap." When pap- and amyR2 (an alpha amylase regulator gene) or pap- and ProH coexisted in the same cell, synergistic effects of the two genetic characters were observed on the alpha-amylase and protease production, respectively. Upon introduction of the pap mutation, the following phenotypic changes were observed in addition to changes in alpha-amylase and protease productivity. (i) Mutants lost the character of competence for the transformation. (ii) When cells were cultured at 30 C for 30 h, mutant cells became filament owing to the formation of chains of cells. (iii) Autolysis of cells was decreased in the mutants. When pap- was transferred to the wild strain by deoxyribonucleic acid-mediated transformation, the transformants showed all these phenotypic alterations simultaneously.     

Genetic and Biochemical Studies on Cell-Bound α-Amylase in Bacillus subtilis Marburg

A small but significant amount of alpha-amylase activity was detected in the cells of Bacillus subtilis Marburg. The cell-associated activity was almost constant regardless of the level of extracellular alpha-amylase activity. The cell-bound amylase activity could be separated into three components, upon Sephadex G-75 chromatography, referred to as components A, B, and C. Component C showed the same properties as the extracellular alpha-amylases so far examined. Component A had a molecular weight greater than 70,000, as judged from the elution position on Sephadex G-75, and became smaller upon treatment with trypsin but was still larger than that of component C. An alpha-amylase mutant that lacked extracellular alpha-amylase completely because of a mutation within the structural gene of the enzyme was found to lose all three cell-bound amylase components simultaneously. These data suggest strongly that the cell-bound amylase components are precursors of the extracellular alpha-amylase and that the alpha-amylase of this organism is produced under the direction of the same gene whether the enzyme is within or outside the cell.     

Increased production of extracellular enzymes by the synergistic effect of genes introduced into Bacillus subtilis by stepwise transformation.

The amyR3, amyS, papS1, tmr, and papM118 mutations each stimulate alpha-amylase production two- to sevenfold above the level in a wild-type strain of Bacillus subtilis. A strain which presumably has all five of these mutations produced 250-fold more alpha-amylase.     

Increased production of extracellular enzymes by the synergistic effect of genes introduced into Bacillus subtilis by stepwise transformation

The amyR3, amyS, papS1, tmr, and papM118 mutations each stimulate alpha-amylase production two- to sevenfold above the level in a wild-type strain of Bacillus subtilis. A strain which presumably has all five of these mutations produced 250-fold more alpha-amylase.     

Characterization of a salt-tolerant extracellular a-amylase from Bacillus dipsosauri

AIMS: The aims of this study were to purify and characterize an extracellular alpha-amylase from the salt-tolerant bacterium Bacillus dipsosauri. METHODS AND RESULTS: An extracellular alpha-amylase from B. dipsosauri strain DD1 was studied using the synthetic substrate 2-chloro-4-nitrophenyl-alpha-D-maltotrioside. Formation of the enzyme was induced by starch, repressed by D-glucose and highest after growth in medium containing 1.0 mol l-1 KCl. The alpha-amylase activity increased with KCl concentration, showed a pH optimum of 6.5, was stable up to 60 degrees C and was stimulated by 1.0 mol l-1 Na2SO4. The enzyme was purified from spent culture medium to apparent homogeneity by precipitation with ethanol, ion-exchange chromatography on DEAE-cellulose, centrifugal membrane filtration and gel-filtration chromatography on BioGel P-100. The purified enzyme had a denatured molecular mass of about 80 kDa but behaved on non-denaturing polyacrylamide gels as if it had a mass of about 30 kDa. The enzyme was partially inhibited by glucose-containing oligosaccharides of increasing length and strongly inhibited by the divalent cations Cd2+ and Zn2+. CONCLUSIONS: The extracellular alpha-amylase from B. dipsosauri strain DD1 was purified to homogeneity and found to exhibit an unusually high degree of salt tolerance. SIGNIFICANCE AND IMPACT OF THE STUDY: The alpha-amylase from B. dipsosauri differs from previously described enzymes and may be useful for the processing of starches under high-salt conditions.     

Induction and regulation of alpha-amylase synthesis in a cellulolytic thermophilic fungus Myceliophthora thermophila D14 (ATCC 48104).

The alpha-amylase enzyme synthesis was higher when M. thermophila D-14 (ATCC 48104) was grown in culture medium incorporated with starch or other carbohydrates containing maltose units. Maximum enzyme production was attained with 1% starch followed by a gradual decrease with increasing concentration. Marked decrease in alpha-amylase synthesis occurred with the addition of glucose to the culture medium and this decreasing activity was proportional to the concentration of glucose. The enzyme synthesis was resumed as soon as the glucose concentration fell below a critical level. The addition of cAMP did not eliminate the repressive activity of glucose. The findings suggest that extracellular alpha-amylase synthesis in M. thermophila D-14 was inducible and subject to catabolite repression.     

Pleiotropic phenomena in autolytic enzyme(s) content, flagellation, and simultaneous hyperproduction of extracellular alpha-amylase and protease in a Bacillus subtilis mutant.

A mutant of Bacillus subtilis 6160 that had been isolated by its hyperproduction of alpha-amylase and protease lacked flagella and motility, and its content of autolytic enzyme(s) was reduced to one-third to one-fourth that of the parent. These phenotypic differences were completely co-transferred by the deoxyribonucleic acid (DNA) of the mutant when five DNA recipient strains of B. subtilis were transformed. The revertants, isolated by motility with a frequency of approximately 10(-7), recovered a normal level of autolytic activity and showed reduced productivity of alpha-amylase and protease. This point mutation allowed normal flagellin synthesis, spore formation, and rate of growth. The comparison of cell envelope of the mutant with that of the parent indicated that there was no significant difference except loss of flagella. Therefore the association at the cell surface of a group of extracellular proteins consisting of alpha-amylase, proteases, flagellin, and autolytic enzymes(s) seem to be coordinately regulated by the gene or seem to be affected coordinately by certain undetected alterations of the cell envelope.     

Effect of decoyinine on the regulation of alpha-amylase synthesis in Bacillus subtilis.

Decoyinine, an inhibitor of GMP synthetase, allows sporulation in Bacillus subtilis to initiate and proceed under otherwise catabolite-repressing conditions. The effect of decoyinine on alpha-amylase synthesis in B. subtilis, an event which exhibits regulatory features resembling sporulation initiation, was examined. Decoyinine did not overcome catabolite repression of alpha-amylase synthesis in a wild-type strain of B. subtilis but did cause premature and enhanced synthesis in a mutant strain specifically blocked in catabolite repression of alpha-amylase synthesis. Decoyinine had no effect on alpha-amylase enzymatic activity. Thus, it appears that the catabolite control mechanisms governing alpha-amylase synthesis and sporulation in B. subtilis differ in their responses to decoyinine and hence must consist at least partially of separate components.