Down-regulation of pyrophosphate: fructose 6-phosphate 1-phosphotransferase (PFP) activity in sugarcane enhances sucrose accumulation in immature internodes

Pyrophosphate: fructose 6-phosphate 1-phosphotransferase (PFP) activity was successfully down-regulated in sugarcane using constitutively expressed antisense and untranslatable forms of the sugarcane PFP-β gene. In young internodal tissue activity was reduced by up to 70% while no residual activity could be detected in mature tissues. The transgenic plants showed no visible phenotype or significant differences in growth and development under greenhouse and field conditions. Sucrose concentrations were significantly increased in the immature internodes of the transgenic plants but not in the mature internodes. This contributed to an increase in the purity of the immature tissues, resembling an early ripening phenotype. Both the immature and mature internodes of the transgenic plants had significantly higher fibre contents. These findings suggest that PFP influences the ability of young, biosynthetically active sugarcane culm tissue to accumulate sucrose but that the equilibrium of the glycolytic intermediates, including the stored sucrose, is restored when ATP-dependent phosphofructokinase and the residual PFP activity is sufficient to sustain the required glycolytic flux as the tissue matures. Moreover, it suggests a role for PFP in glycolytic carbon flow, which could be rate limiting under conditions of high metabolic activity.     

Transgenic potato plants with strongly decreased expression of pyrophosphate:fructose-6-phosphate phosphotransferase show no visible phenotype and only minor changes in metabolic fluxes in their tubers

Potato (Solanum tuberosum L.) plants were transformed with antisense constructs to the genes encoding the -and -subunits of pyrophosphate: fructose-6-phosphate phosphotransferase (PEP), their expression being driven by the constitutive CaMV 35S promotor. (i) In several independent transformant lines, PFP expression was decreased by 70–90% in growing tubers and by 88–99% in stored tubers. (ii) The plants did not show any visual phenotype, reduction of growth or decrease in total tuber yield. However, the tubers contained 20–40% less starch than the wild type. Sucrose levels were slightly increased in growing tubers, but not at other stages. The rates of accumulation of sucrose and free hexoses when tubers were stored at 4° C and the final amount accumulated were the same in antisense and wild-type tubers. (iii) Metabolites were investigated at four different stages in tuber life history; growing (sink) tubers, mature tubers, cold-sweetening tubers and sprouting (source) tubers. At all stages, compared to the wild type, antisense tubers contained slightly more hexose-phosphates, two- to threefold less glycerate-3-phosphate and phosphoenolpyruvate and up to four-to fivefold more fructose-2,6-bisphosphate. (iv) There was no accumulation or depletion of inorganic pyrophosphate (PPi), or of UDP-glucose relative to the hexose-phosphates. (v) The pyruvate content was unaltered or only marginally decreased, and the ATP/ADP ratio did not change. (vi) Labelling experiments on intact tubers did not reveal any significant decrease in the unidirectional rate of metabolism of [U-¹⁴C]sucrose to starch, organic acids or amino acids. Stored tubers with an extreme (90%) reduction of PFP showed a 25% decrease in the metabolism of [U¹⁴-C] sucrose. (vii) Metabolism (cycling) of [U-¹⁴C]glucose to surcrose increased 15-fold in discs from growing antisense tubers, compared with growing wild-type tubers. Resynthesis of sucrose was increased by 10–20% when discs from antisense and wild-type tubers stored at 4° C (cold sweetening) were compared. The conversion of [U-¹⁴C]glucose to starch was decreased by about 30% and 50%, respectively. (viii) The randomisation of [1-¹³C]glucose in the glucosyl and fructosyl moieties of sucrose was decreased from 13.8 and 15.7% in the wild type to 3.6 and 3.9% in an antisense transformant. Simultaneously, randomisation in glucosyl residues isolated from starch was reduced from 14.4 to 4.1%. (ix) These results provide evidence that PFP catalyses a readily reversible reaction in tubers, which is responsible for the recycling of label from triose-phosphates to hexose-phosphates, but with the net reaction in the glycolytic direction. The results do not support the notion that PFP is involved in regulating the cytosolic PPi concentration. They also demonstrate that PFP does not control the rate of glycolysis, and that tubers contain exessive capacity to phosphorylate fructose-6-phosphate. The decreased concentration of phosphoenolpyruvate and glycerate-3-phosphate compensates for the decrease of PFP protein by stimulating ATP-dependent phosphofructokinase, and by stimulating fructose-6-phosphate,2-kinase to increase the fructose-2,6-bisphosphate concentration and activate the residual PFP. The decreased starch accumulation is explained as an indirect effect, caused by the increased rate of resynthesis (cycling) of sucrose in the antisense tubers.Abbreviations Fru1,6bisP fructose-1,6-bisphosphate - Fru2,6bisP fructose-2,6-bisphosphate - Fru6P fructose-6-phosphate - Glc1P glucose-1-phosphate - Glc6P glucose-6-phosphate - NMR nuclear magnetic resonance - 3PGA glycerate-3-phosphate - PEP phosphoenolpyruvate - PEP pyrophosphate: fructose-6-phosphate phosphotransferase - PFK phosphofructokinase - UDPGlc UDP glucose - WT wild type This research was supported by the Bundesministerium for Forschung and Technology (M.S., U.S.), the Canadian Research Council (S.C., D.D.), the Agricultural and Food Research Council (R.V.) and Sandoz Agro Ltd. (M.H., M.S.).     

Identification of a 20-bp regulatory element of the <Emphasis Type="Italic">Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2</Emphasis> gene that is essential for expression

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.     

Fructose 2,6-bisphosphate activates pyrophosphate: fructose-6-phosphate 1-phosphotransferase and increases triose phosphate to hexose phosphate cycling in heterotrophic cells

The aim of this work was to establish the influence of fructose 2,6-bisphosphate (Fru-2,6-P₂) on non-photosynthetic carbohydrate metabolism in plants. Heterotrophic callus lines exhibiting elevated levels of Fru-2,6-P₂ were generated from transgenic tobacco (Nicotiana tabacum L.) plants expressing a modified rat liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase. Lines containing increased amounts of Fru-2,6-P₂ had lower levels of hexose phosphates and higher levels of 3-phosphoglycerate than the untransformed control cultures. There was also a greater redistribution of label into the C6 position of sucrose and fructose, following incubation with [1-¹³C]glucose, in the lines possessing the highest amounts of Fru-2,6-P₂, indicating a greater re-synthesis of hexose phosphates from triose phosphates in these lines. Despite these changes, there were no marked differences between lines in the metabolism of ¹⁴C-substrates, the rate of oxygen uptake, carbohydrate accumulation or nucleotide pool sizes. These data provide direct evidence that physiologically relevant changes in the level of Fru-2,6-P₂ can affect pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) activity in vivo, and are consistent with PFP operating in a net glycolytic direction in the heterotrophic culture. However, the results also show that activating PFP has little direct effect on heterotrophic carbohydrate metabolism beyond increasing the rate of cycling between hexose phosphates and triose phosphates. Received: 29 March 2000 / Accepted: 13 June 2000     

Altered expression of pyrophosphate: Fructose-6-phosphate 1-phosphotransferase affects the growth of transgenic <Emphasis Type="Italic">Arabidopsis</Emphasis> plants

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) catalyzes the reversible interconversion of fructose-6-phosphate and fructose-1,6-bisphosphate, a key step in the regulation of the metabolic flux toward glycolysis or gluconeogenesis. To examine the role of PFP in plant growth, we have generated transgenic Arabidopsis plants that either overexpress or repress Arabidopsis PFP sub-unit genes. The overexpressing lines displayed increased PFP activity and slightly faster growth relative to wild type plants, although their photosynthetic activities and the levels of metabolites appeared not to have significantly changed. In contrast, the RNAi lines showed significantly retarded growth in parallel with the reduced PFP activity. Analysis of photosynthetic activity revealed that the growth retardation phenotype of the RNAi lines was accompanied by the reduced rates of CO₂ assimilation. Microarray analysis of our transgenic plants further revealed that the altered expression of AtPFPβ affects the expression of several genes involved in diverse physiological processes. Our current data thus suggest that PFP is important in carbohydrate metabolism and other cellular processes. These authors contributed equally to this study.     

Measurement of the inorganic pyrophosphate in tissues of Pisum sativum L.

Purified pyrophosphate: fructose 6-phosphate 1-phosphotransferase (EC 2.7.1.90) was used to measure the inorganic pyrophosphate in unfractionated extracts of tissues of Pisum sativum L. The fructose 1,6-bisphosphate produced by the above enzyme was measured by coupling to NADH oxidation via aldolase (EC 4.1.2.13), triosephosphate isomerase (EC 5.3.1.1) and glycerol-3-phosphate dehydrogenase (EC 1.1.1.8). Amounts of pyrophosphate as low as 1 nmol could be measured. The contents of pyrophosphate in the developing embryo of pea, and in the apical 2 cm of the roots, were appreciable; 9.4 and 8.9 nmol g^-1 fresh weight, respectively. The possibility that pyrophosphate acts in vivo as an energy source for pyrophosphate: fructose 6-phosphate 1-phosphotransferase and for UDPglucose pyrophosphorylase (EC 2.7.7.9) is considered.     

The type-1 and type-2 ribosome-inactivating proteins from<Emphasis Type="Italic"> Iris</Emphasis> confer transgenic tobacco plants local but not systemic protection against viruses

The antiviral activity of the type-2 ribosome-inactivating protein (RIP) IRAb from Iris was analyzed by expressing IRAb in tobacco (Nicotiana tabacum L. cv. Samsun NN) plants and challenging the transgenic plants with tobacco mosaic virus (TMV). Although constitutive expression of IRAb resulted in an aberrant phenotype, the plants were fertile. Transgenic tobacco lines expressing IRAb showed a dose-dependent enhanced resistance against TMV infection but the level of protection was markedly lower than in plants expressing IRIP, the type-1 RIP from Iris that closely resembles the A-chain of IRAb. To verify whether IRIP or IRAb can also confer systemic protection against viruses, transgenic RIP-expressing scions were grafted onto control rootstocks and leaves of the rootstocks challenged with tobacco etch virus (TEV). In spite of the strong local antiviral effect of IRIP and IRAb the RIPs could not provide systemic protection against TEV. Hence our results demonstrate that expression of the type-1 and type-2 RIPs from Iris confers tobacco plants local protection against two unrelated viruses. The antiviral activity of both RIPs was not accompanied by an induction of pathogenesis-related proteins. It is suggested that the observed antiviral activity of both Iris RIPs relies on their RNA N-glycohydrolase activity towards TMV RNA and plant rRNA.Abbreviations GUS -Glucuronidase - IRAb Iris agglutinin b - IRIP Iris type-1 RIP - PAG Polynucleotide:adenosine glycosylase - PAP Phytolacca americana antiviral protein - PR Pathogenesis-related - RIP Ribosome-inactivating protein - TCS Trichosanthin - TEV Tobacco etch virus - TMV Tobacco mosaic virus     

Failure to corroborate claims that the developing endosperm of wheat (Triticum aestivum) contains significant activities of fructose-1,6-bisphosphatase

This work was done to test claims (Sangwan and Singh, Physiol. Plant. 73: 21–26) that the developing endosperm of wheat ( Triticum aestivum L.) contains a cytosolic and a plastidic fructose- 1,6-bisphosphatase (EC 3.1.3.11; FBPase). Repetition of the procedure of Sangwan and Singh with extracts of developing endosperm of Triticum aestivum cv. Mercia produced two peaks of apparent FBPase activity on elution from DEAE-cellulose. Both peaks showed high activity of pyrophosphate:fructose-6-phos-phate 1-phosphotransferase [EC 2.7.1.90; PFK(PP_i)]. The apparent FBPase activity in both peaks was stimulated by 20 μ M fructose-2,6-bisphosphate and inhibited by antibodies to PFK(PP_i). Antibody to plastidic FBPase did not react positively in an immunoblot analysis with any protein of M_r comparable to that of known FBPase in either peak. It is argued that the ability of each peak to convert fructose-1,6-bisphosphate to fructose-6-phosphate was due to PFK(PP_i). and that there remains no substantiated evidence for the presence of a plastidic FBPase in the developing endosperm of wheat.     

Functional analysis of a Douglas-fir metallothionein-like gene promoter: transient assays in zygotic and somatic embryos and stable transformation in transgenic tobacco

Douglas-fir (Pseudotsuga menziesii [Mirb] Franco) metallothionein (PmMT) cDNA encodes a novel cysteine- and serine-rich MT, indicating a new subtype or prototype MT from which other plant MTs may have evolved. A genomic library of Douglas-fir was screened using MT cDNA probes, and genomic sequences that mediate tissue-specific, temporal as well as inducible expression of the embryo-specific MT-gene were analyzed. The promoter region of the PmMT genomic clone (gPmMT) contained a hexameric G-box, two putative ethylene-responsive elements and an inverted repeat of a motif similar to the core metal regulatory element. Interestingly, comparison of the upstream region of Douglas-fir gPm2S1 and gPmMTa genes revealed a conserved motif, CATTATTGA, not found in any known angiosperm gene promoter. Chimeric gene constructs containing a series of deletions in the gPmMTa promoter fused to the uidA reporter gene were assayed in Douglas-fir and transgenic tobacco (Nicotiana tabacum L.). Transient-expression assays in Douglas-fir megagametophyte and zygotic embryos indicated that the sequence –190 to +88 of gPmMTa was sufficient to drive the expression of the reporter gene and that the 225-bp fragment (–677 to –453) contained sequences necessary for high-level expression. In transgenic tobacco seedlings the -glucuronidase activity was localized in the vacuolar tissue and proliferating tissue of the auxiliary buds and stem elongation zone. The gPmMTa promoter was not active in the seeds of transgenic tobacco or in the roots of seedlings up to 3 weeks old. Detailed studies of transient expression and stable transformation provided important information on evolutionary conservation as well as novel features found in the conifer promoter. This is the first report of an MT-like gene promoter from conifers.     

Reduction of mineral nutrient availability accelerates flowering of Arabidopsis thaliana

The time of flowering is regulated by various environmental cues, and in some plant species, it is known to be affected by abiotic stresses. We investigated the effect of nutrient stress caused by an abrupt reduction of mineral nutrition on flowering of Arabidopsis thaliana. We used a hydroponic culture system that enabled us to precisely control nutrient levels. When plants were grown in full-strength nutrient solution for several weeks and then transferred to a diluted medium, the time from sowing to bud appearance was significantly shortened. This acceleration of flowering was more pronounced in short days than in long days, and stronger in the ecotype Landsberg erecta than in Columbia and San Feliu-2. The response was also affected by the age of plants at the beginning of nutrient stress and by the concentration of the diluted medium: earlier treatment and more diluted solutions strengthened the effect. Flowering was affected by nutrient stress, not by a change in the osmotic potential of the medium: addition of mannitol to a 1000-fold diluted solution had no effect on the promotion of flowering. When 3-week-old Landsberg erecta plants were exposed to 1000-fold diluted nutrient solution in an 8-h day length, flower bud appearance was strongly and reproducibly advanced by 10.8–12.8 d compared with control plants (which developed buds 41.1–46.2 d after sowing). This treatment can serve as an optimized protocol for future studies concerning physiological, molecular and ecological aspects of flower induction by nutrient stress in A. thaliana.     

Respiration of individual honeybee larvae in relation to age and ambient temperature

The CO₂ production of individual larvae of Apis mellifera carnica, which were incubated within their cells at a natural air humidity of 60–80%, was determined by an open-flow gas analyzer in relation to larval age and ambient temperature. In larvae incubated at 34 °C the amount of CO₂ produced appeared to fall only moderately from 3.89±1.57 µl mg^–1 h^–1 in 0.5-day-old larvae to 2.98±0.57 µl mg^–1 h^–1 in 3.5-day-old larvae. The decline was steeper up to an age of 5.5 days (0.95±1.15 µl mg^–1 h^–1). Our measurements show that the respiration and energy turnover of larvae younger than about 80 h is considerably lower (up to 35%) than expected from extrapolations of data determined in older larvae. The temperature dependency of CO₂ production was determined in 3.5-day-old larvae, which were incubated at temperatures varying from 18 to 38 °C in steps of 4 °C. The larvae generated 0.48±0.03 µl mg^–1 h^–1 CO₂ at 18 °C, and 3.97±0.50 µl mg^–1 h^–1 CO₂ at 38 °C. The temperature-dependent respiration rate was fitted to a logistic curve. We found that the inflection point of this curve (32.5 °C) is below the normal brood nest temperature (33–36 °C). The average Q₁₀ was 3.13, which is higher than in freshly emerged resting honeybees but similar to adult bees. This strong temperature dependency enables the bees to speed up brood development by achieving high temperatures. On the other hand, the results suggest that the strong temperature dependency forces the bees to maintain thermal homeostasis of the brood nest to avoid delayed brood development during periods of low temperature.Abbreviations m body mass - R rate of development or respiration - T_I inflexion point of a logistic (sigmoid) curve - T_L lethal temperature - T_O temperature of optimum (maximum) developmentCommunicated by G. Heldmaier     

Changes in phenolic metabolism of tobacco plants during short-term boron deficiency

The effects of boron (B) deficiency on several phenolics and enzyme activities involved in the biosynthesis of these compounds were investigated in tobacco plants (Nicotiana tabacum L. cv. Gatersleben). The levels of phenylpropanoids (mainly the caffeic acid esters, chlorogenic acid and its isomers) as well as phenylalanine ammonia-lyase (PAL, EC 4.3.1.5) and polyphenoloxidase (PPO, EC 1.14.18.1) activities were determined in plants subjected to B starvation for 1–7 d. The results presented here show that a short-term B deficiency causes both quantitative and qualitative changes in the phenolic metabolism of tobacco plants, which are especially evident after 3 d of B starvation. Although the concentration of B decreased from the onset of B starvation, root B level was less affected than leaf B by a short-term B deficiency. The concentration of phenylpropanoids as well as PAL and PPO activities increased mainly in the leaves of tobacco plants during B starvation. Moreover, leaves starved of B for 7 d showed the accumulation of new compounds, one of which was identified as caffeoylputrescine. In addition, a positive correlation between PAL activity and phenylpropanoid concentration was observed in tobacco leaves, especially after 5–7 d of B starvation, suggesting that an increase in PAL activity during B starvation could be responsible for the enhancement in the levels of phenylpropanoids.     

Effect of temperature on the oxygen consumption in the larvae of dineutes indicus aube (gyrinidae,coleoptera)

Oxygen uptake of the larvae of Dineutes indicus Aube has been measured at different temperatures. It has been observed that the oxygen uptake increases with the rise in the temperature but falls sharply after 34°C.The data obtained corresponds to a straight line when plotted on an Arrhenius graph.Q₁₀ values decrease with the increase in weight and it has been observed that the smallest individual has the highest Q₁₀ value. Nevertheless, the calculated energies of activation reported here apply only to the limited temperature range studied.     

Effects of constitutive expression of nitrate reductase in transgenic Nicotiana plumbaginifolia L. in response to varying nitrogen supply

Transformed Nicotiana plumbaginifolia plants with constitutive expression of nitrate reductase (NR) activity were grown at different levels of nitrogen nutrition. The gradients in foliar NO ₃ ^– content and maximum extractable NR activity observed with leaf order on the shoot, from base to apex, were much decreased as a result of N-deficiency in both the transformed plants and wild type controls grown under identical conditions. Constitutive expression of NR did not influence the foliar protein and chlorophyll contents under any circumstances. A reciprocal relationship between the observed maximal extractable NR activity of the leaves and their NO ₃ ^– content was observed in plants grown in nitrogen replete conditions at low irradiance (170 mol photons·m^–2 ·s^–1). This relationship disappeared at higher irradiance (450 mol photons·m^–2·S^–1) because the maximal extractable NR activity in the leaves of the wild type plants in these conditions increased to a level that was similar to, or greater than that found in constitutive NR-expressors. Much more NO ₃ ^– accumulated in the leaves of plants grown at 450 mol photons·m^–2·s^–1 than in those grown at 170 mol photons·m^–2·s^–1 in N-replete conditions. The foliar NO ₃ ^– level and maximal NR activity decreased with the imposition of N-deficiency in all plant types such that after prolonged exposure to nitrogen depletion very little NO ₃ ^– was found in the leaves and NR activity had decreased to almost zero. The activity of NR decreased under conditions of nitrogen deficiency. This regulation is multifactoral since there is no regulation of NR gene expression by NO ₃ ^– in the constitutive NR-expressors. We conclude that the NR protein is specifically targetted for destruction under nitrogen deficiency. Consequently, constitutive expression of NR activity does not benefit the plant in terms of increased biomass production in conditions of limiting nitrogen.Abbreviations Chl chlorophyll - N nitrogen - NR NADH-nitrate reductase - WT wild type     

Production of transgenic lily plants by<Emphasis Type=Italic> Agrobacterium</Emphasis>-mediated transformation

A system for the production of transgenic plants was developed for the Oriental hybrid lily, Lilium cv. Acapulco, by Agrobacterium-mediated genetic transformation. Filament-derived calli were co-cultivated with A. tumefaciens strain EHA101/pIG121Hm, which harbored a binary vector carrying the neomycin phosphotransferase II, hygromycin phosphotransferase, and intron-containing -glucuronidase genes in the T-DNA region. Six hygromycin-resistant (Hyg^r) culture lines were obtained from 200 calli by scratching them with sandpaper prior to inoculation and using NH₄NO₃-free medium for co-cultivation and a hygromycin-containing regeneration medium for selection. Hyg^r culture lines regenerated shoots, which developed into plantlets following transfer to a plant growth regulator-free medium. All of these plantlets were verified to be transgenic by GUS histochemical assay and inverse PCR analysis.Abbreviations AS Acetosyringone (3,5-dimethoxy-4-hydroxy-acetophenone) - BA Benzyladenine - CaMV Cauliflower mosaic virus - GUS -Glucuronidase - HPT Hygromycin phosphotransferase - Hyg^r Hygromycin-resistant - NOS Nopaline synthase - NPTII Neomycin phosphotransferase II - PGR Plant growth regulator - PIC Picloram (4-amino-3,5,6-trichloropicolinic acid)Communicated by H. Ebinuma     

Effects of temperature on purification of eutrophic water by floating eco-island system

The effects of temperature on pollutant removal of two plant species (Oenanthe javanica D.C. and Nasturtium officinale) were evaluated using simulated microcosms of the floating eco-island system (FEIS). Both the planted FEIS (P-FEIS) and the non-planted FEIS (NP-FEIS) dramatically decreased NH₄–N concentration in the hypereutrophic water at low (10 °C), medium (22 °C), and high (35 °C) temperatures, and to a greater extent for the P-FEIS and at medium temperature. The NO₂–N concentration was effectively decreased from 0.23 to 0.01 mg/L after 4 d treatment with the P-FEIS at all the three temperatures, but was slightly increased in the NP-FEIS at low temperature. The P-FEIS could decrease NO₃–N concentration in the eutrophic water over 1–3 times depending on temperature, with greater decrease at high temperature. The remove of total P (TP) reached 78%, on average, with the FEIS treatment for 4 d at all temperatures, which was over three times greater than those with the NP-FEIS at low temperature. The removal rates of Chla, COD_Mn, and BOD₅ by the P-FEIS from the hypereutrophic water were, on average, 70%, 85%, 83% at 22 °C and 35 °C, respectively, while over 1–2 times smaller at 10 °C. More effective removals of Chla, COD_Mn, and BOD₅ (over 1–2 times) were noted with the P-FEIS than those with the NP-FEIS. N. officinale showed more efficiency in removing ammonium and TN at low temperature, and BOD₅ at medium and high temperatures, as compared to O. javanica. Whereas O. javanica could more effectively decrease Chla at 22 °C and 35 °C and COD_Mn at 10 °C than N. officinale after 4 d treatment. Higher dissolved oxygen concentration and pH was found in the FEIS with N. officinale than that with O. javanica D.C. The results imply that plant eco-island system had remarkable purification ability to remove pollutants from hypereutrophic water, and mixed planting of O. javanica D.C. with N. officinale on the FEIS may enhance nutrient removal and water quality improvement of eutrophic water bodies, especially at low temperature season.     

Yeast RAS2 affects cell viability,mitotic division and transient gene expression in Nicotiana species

Overexpression of the budding yeast RAS2 gene in Nicotiana plumbaginifolia cells revealed that RAS2 acted as a suicide gene in freshly isolated protoplasts from leaves and blocked cell proliferation in cell suspension-derived protoplasts. Among a series of genes tested (such as npt II, CDC35, PDE2), RAS2 was the only one to block the expression of the cat gene, as measured in a transient gene expression assay. Another ras gene, v-Ha-ras, had similar effects. Furthermore, the RAS2 effect was species-specific and depended on the modulation of hormonal metabolism in the transfected cells, while no differences were noticed between the normal and the activated val19 gene. Transfected plant cells are shown to synthesize a RAS2 protein of the same electrophoretic mobility as the yeast RAS2 product. The results are discussed in the broader context of the evolutionarily conserved ras genes involved in vital cellular functions.     

The subcellular location and characteristics of pyrophosphate-fructose-6-phosphate 1-phosphotransferase from suspension-cultured cells of soybean

The cytoplasm was identified as the probable location of pyrophosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) in suspension-cultured cells of soybean (Glycine max L.). The characteristics of the partially purified enzyme were investigated. The activity was strongly dependent on the presence of fructose 2,6-bisphosphate and this activator exerted its effects through a dramatic increase in the affinity of the enzyme for its substrates, fructose 6-phosphate and inorganic pyrophosphate. Saturation curves for all substrates were hyperbolic. The apparent molecular weight of the partially purified enzyme was 183000 by gel filtration chromatography and 128000 by sucrose-density-gradient centrifugation. The activation by fructose 2,6-bisphosphate was not accompanied by any measurable change in molecular weight. The possible role of this enzyme in the metabolism of non-photosynthetic sink tissues is discussed.Abbreviations PFP pyrophosphate-fructose-6-phosphate 1-phosphotransferase - P_i phosphate - PP_i pyrophosphate