The adsorption protein of phage IKe. Localization by deletion mutagenesis of domains involved in infectivity

We constructed a set of plasmid-encoded internal deletion mutants within the gene for the adsorption protein (g3p) of phage IKe. All mutant proteins still contain the signal and membrane anchor sequence, as those are known to be indispensable for proper localization and hence assembly of the g3p into phage. These various deletions comprise all internal parts of the protein and are properly incorporated into phage, which remarkably shows that signal and anchor sequence are sufficient for incorporation of g3p. The data furthermore reveal that two separate sections within the IKe g3p are essential for infection: one amino-terminal, preceding the glycine-rich stretch, and the other carboxy-terminal. We conclude that this latter domain is involved in penetration because mutants lacking it are not infectious, but still bind to the receptor. The amino-terminal region, essential for infection, bears the receptor-recognizing domain and a sequence homologous to the penetration domain of the evolutionary related Ff phages, which is probably also involved in penetration of phage IKe. The prominent glycine-rich stretch of the IKe g3p is not essential for infection but significantly promotes it.     

Interchangeability of the adsorption proteins of bacteriophages Ff and IKe.

The wild-type adsorption protein (g3p) of filamentous phage IKe cannot be exchanged with its analogous protein in the related Ff (M13, fd, and f1) phage particles. Deletion mutants of the protein, however, are assembled into Ff phage particles. These hybrid Ff phage particles bearing deleted IKe g3p attach to N pili, thus conserving the host attachment property of the protein but not its infection-initiating function. This means that the attachment specificity is determined by IKe g3p independently of other phage components in contact with it. Infection initiation function, the process in which phage DNA is released into the host, in contrast seems to require either more complex structural features of the protein (for example, a certain oligomeric structure) provided only in the original particle, or a concerted action of g3p with another particle component, not replaceable by its homologous counterpart in the related phage.     

Functional analysis of the adsorption protein of two filamentous phages with different host specificities

The gene 3 coding for one minor coat protein (adsorption protein) of phage IKe was cloned into an expression plasmid and overproduced. The presence of a promoter for this gene could be demonstrated as well as the incorporation of the IKe gene 3 protein (g3p) into the cytoplasmic membrane of host cells. When 110 carboxy-terminal amino acids were deleted, the truncated protein was translocated across the cytoplasmic membrane into the periplasm. Thus the deleted amino acids bear a membrane anchor domain. In contrast to the partly homologous g3p of the Ff phages, IKe g3p did not alter the membrane properties of its host. IKe g3p was not incorporated into Ff phage particles in amounts detectable by our assays although the presence of IKe g3p may affect the efficiency of Ff phage production. The existence of a structural feature necessary for the specific recognition of the respective g3p during phage assembly is deduced.     

Inhibition of bacterial conjugation by phage M13 and its protein g3p: quantitative analysis and model

Conjugation is the main mode of horizontal gene transfer that spreads antibiotic resistance among bacteria. Strategies for inhibiting conjugation may be useful for preserving the effectiveness of antibiotics and preventing the emergence of bacterial strains with multiple resistances. Filamentous bacteriophages were first observed to inhibit conjugation several decades ago. Here we investigate the mechanism of inhibition and find that the primary effect on conjugation is occlusion of the conjugative pilus by phage particles. This interaction is mediated primarily by phage coat protein g3p, and exogenous addition of the soluble fragment of g3p inhibited conjugation at low nanomolar concentrations. Our data are quantitatively consistent with a simple model in which association between the pili and phage particles or g3p prevents transmission of an F plasmid encoding tetracycline resistance. We also observe a decrease in the donor ability of infected cells, which is quantitatively consistent with a reduction in pili elaboration. Since many antibiotic-resistance factors confer susceptibility to phage infection through expression of conjugative pili (the receptor for filamentous phage), these results suggest that phage may be a source of soluble proteins that slow the spread of antibiotic resistance genes.     

Phage display of an intracellular carboxylesterase of Bacillus subtilis: comparison of Sec and Tat pathway export capabilities

Using the phage display technology, a protein can be displayed at the surface of bacteriophages as a fusion to one of the phage coat proteins. Here we describe development of this method for fusion of an intracellular carboxylesterase of Bacillus subtilis to the phage minor coat protein g3p. The carboxylesterase gene was cloned in the g3p-based phagemid pCANTAB 5E upstream of the sequence encoding phage g3p and downstream of a signal peptide-encoding sequence. The phage-bound carboxylesterase was correctly folded and fully enzymatically active, as determined from hydrolysis of the naproxen methyl ester with Km values of 0.15 mM and 0.22 mM for the soluble and phage-displayed carboxylesterases, respectively. The signal peptide directs the encoded fusion protein to the cell membrane of Escherichia coli, where phage particles are assembled. In this study, we assessed the effects of several signal peptides, both Sec dependent and Tat dependent, on the translocation of the carboxylesterase in order to optimize the phage display of this enzyme normally restricted to the cytoplasm. Functional display of Bacillus carboxylesterase NA could be achieved when Sec-dependent signal peptides were used. Although a Tat-dependent signal peptide could direct carboxylesterase translocation across the inner membrane of E. coli, proper assembly into phage particles did not seem to occur.     

Binding of phage displayed Bacillus subtilis lipase A to a phosphonate suicide inhibitor

Phage display can be used as a protein engineering tool to select proteins with desirable binding properties from a library of randomly constructed mutants. Here, we describe the development of this method for the directed evolution of Bacillus subtilis lipase A, an enzyme that has marked properties for the preparation of pharmaceutically relevant chiral compounds. The lipase gene was cloned upstream of the phage g3p encoding sequence and downstream of a modified g3p signal sequence. Consequently, the enzyme was displayed at the surface of bacteriophage fd as a fusion to its minor coat protein g3p. The phage-bound lipase was correctly folded and fully enzymatically active as determined from the hydrolysis of p-nitrophenylcaprylate with K(m)-values of 0.38 and 0.33 mM for the phage displayed and soluble lipase, respectively. Both soluble lipase and lipase expressed on bacteriophages reacted covalently with a phosphonate suicide inhibitor. The phage does not hamper lipase binding, since both soluble and phage-bound lipase have a similar half-life of inactivation of approximately 5 min. Therefore, we conclude that the Bacillus lipase can be functionally expressed on bacteriophages as a fusion to the phage coat protein g3p. The specific interaction with the suicide inhibitor offers a fast and reproducible method for the future selection of mutant enzymes with an enantioselectivity towards new substrates.     

The phage infection process: a functional role for the distal linker region of bacteriophage protein 3

The filamentous bacteriophage infects Escherichia coli by interaction with the F pilus and the TolQRA complex. The virus-encoded protein initiating this process is the gene 3 protein (g3p). The g3p molecule can be divided into three different domains separated by two glycine-rich linker regions. Though there has been extensive evaluation of the importance of the diverse domains of g3p, no proper function has so far been assigned to these linker regions. Through the design of mutated variants of g3p that were displayed on the surface of bacteriophage, we were able to elucidate a possible role for the distal glycine-rich linker region. A phage that displayed a g3p comprised of only the N1 domain, the first linker region, and the C-terminal domain was able to infect cells at almost the same frequency as the wild-type phage. This infection was proven to be dependent on the motif between amino acid residues 68 and 86 (i.e., the first glycine-rich linker region of g3p) and on F-pilus expression.     

Comparative properties of bacteriophage phi6 and phi6 nucleocapsid.

Nonionic detergent treatments released a nucleocapsid from the enveloped bacteriphage phi6. The nucleocapsid sedimented at nearly the same rate as the whole phage in sucrose density gradients, but the buoyant density in Cs2S04 changed from 1.22 g/cm3 for the whole phage to 1.33 g/cm3 for the nucleocapsid. The detergent completely removed the lipid and 5 of the 10 proteins from the phage. Surface labeling of the phage and nucleocapsid with 125I revealed that protein P3 was on the outer surface of the whole phage and P8 was on the surface of the nucleocapsid. Both the phage and the nucleocapsid were stable between pH 6.0 and 9.5. Low concentrations of EDTA (10-4 M) dissociated the nucleocapsid but had no effect on the whole phage. The nucleocapsid contained all three double-stranded RNA segments, as well as RNA polymerase activity.     

The mechanism of bacterial infection by filamentous phages involves molecular interactions between TolA and phage protein 3 domains

The early events in filamentous bacteriophage infection of gram-negative bacteria are mediated by the gene 3 protein (g3p) of the virus. This protein has a sophisticated domain organization consisting of two N-terminal domains and one C-terminal domain, separated by flexible linkers. The molecular interactions between these domains and the known bacterial coreceptor protein (TolA) were studied using a biosensor technique, and we report here on interactions of the viral coat protein with TolA, as well as on interactions between the TolA molecules. We detected an interaction between the pilus binding second domain (N2) of protein 3 and the bacterial TolA. This novel interaction was found to depend on the periplasmatic domain of TolA (TolAII). Furthermore, extensive interaction was detected between TolA molecules, demonstrating that bacterial TolA has the ability to interact functionally with itself during phage infection. The kinetics of g3p binding to TolA is also different from that of bacteriocins, since both N-terminal domains of g3p were found to interact with TolA. The multiple roles for each of the separate g3p and TolA domains imply a delicate interaction network during the phage infection process and a model for the infection mechanism is hypothesized.     

Phage Display of an Intracellular Carboxylesterase of Bacillus subtilis: Comparison of Sec and Tat Pathway Export Capabilities

Using the phage display technology, a protein can be displayed at the surface of bacteriophages as a fusion to one of the phage coat proteins. Here we describe development of this method for fusion of an intracellular carboxylesterase of Bacillus subtilis to the phage minor coat protein g3p. The carboxylesterase gene was cloned in the g3p-based phagemid pCANTAB 5E upstream of the sequence encoding phage g3p and downstream of a signal peptide-encoding sequence. The phage-bound carboxylesterase was correctly folded and fully enzymatically active, as determined from hydrolysis of the naproxen methyl ester with K_m values of 0.15 mM and 0.22 mM for the soluble and phage-displayed carboxylesterases, respectively. The signal peptide directs the encoded fusion protein to the cell membrane of Escherichia coli, where phage particles are assembled. In this study, we assessed the effects of several signal peptides, both Sec dependent and Tat dependent, on the translocation of the carboxylesterase in order to optimize the phage display of this enzyme normally restricted to the cytoplasm. Functional display of Bacillus carboxylesterase NA could be achieved when Sec-dependent signal peptides were used. Although a Tat-dependent signal peptide could direct carboxylesterase translocation across the inner membrane of E. coli, proper assembly into phage particles did not seem to occur.     

Tol-dependent macromolecule import through the Escherichia coli cell envelope requires the presence of an exposed TolA binding motif

The Tol-Pal proteins of the cell envelope of Escherichia coli are required for maintaining outer membrane integrity. This system forms protein complexes in which TolA plays a central role by providing a bridge between the inner and outer membranes via its interaction with the Pal lipoprotein. The Tol proteins are parasitized by filamentous bacteriophages and group A colicins. The N-terminal domain of the Ff phage g3p protein and the translocation domains of colicins interact directly with TolA during the processes of import through the cell envelope. Recently, a four-amino-acid sequence in Pal has been shown to be involved in Pal's interaction with TolA. A similar motif is also present in the sequence of two TolA partners, g3p and colicin A. Here, a mutational study was conducted to define the function of these motifs in the binding activity and import process of TolA. The various domains were produced and exported to the bacterial periplasm, and their cellular effects were analyzed. Cells producing the g3p domain were tolerant to colicins and filamentous phages and had destabilized outer membranes, while g3p deleted of three residues in the motif was affected in TolA binding and had no effect on cell integrity or colicin or phage import. A conserved Tyr residue in the colicin A translocation domain was involved in TolA binding and colicin A import. Furthermore, in vivo and in vitro coprecipitation analyses demonstrated that colicin A and g3p N-terminal domains compete for binding to TolA.     

Crystal structure of the two N-terminal domains of g3p from filamentous phage fd at 1.9 A: evidence for conformational lability.

Infection of Escherichia coli by filamentous bacteriophages is mediated by the minor phage coat protein g3p and involves two distinct cellular receptors, the F' pilus and the periplasmic protein TolA. Recently we have shown that the two receptors are contacted in a sequential manner, such that binding of TolA by the N-terminal domain g3p-D1 is conditional on a primary interaction of the second g3p domain D2 with the F' pilus. In order to better understand this process, we have solved the crystal structure of the g3p-D1D2 fragment (residues 2-217) from filamentous phage fd to 1.9 A resolution and compared it to the recently published structure of the same fragment from the related Ff phage M13. While the structure of individual domains D1 and D2 of the two phages are very similar (rms<0.7 A), there is comparatively poor agreement for the overall D1D2 structure (rms>1.2 A). This is due to an apparent movement of domain D2 with respect to D1, which results in a widening of the inter-domain groove compared to the structure of the homologous M13 protein. The movement of D2 can be described as a rigid-body rotation around a hinge located at the end of a short anti-parallel beta-sheet connecting domains D1 and D2. Structural flexibility of at least parts of the D1D2 structure was also suggested by studying the thermal unfolding of g3p: the TolA binding site on D1, while fully blocked by D2 at 37 degrees C, becomes accessible after incubation at temperatures as low as 45 degrees C. Our results support a model for the early steps of phage infection whereby exposure of the coreceptor binding site on D1 is facilitated by a conformational change in the D1D2 structure, which in vivo is induced by binding to the F' pilus on the host cell and which can be mimicked in vitro by thermal unfolding.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Virus removal from bioproducts using ultrafiltration membranes modified with latex particle pretreatment

Ultrafiltration is an attractive process for virusremoval from bioproducts owing to its high throughputas well as the fact that the operation is carried outunder ambient conditions (damage to proteins is highlylimited). The principal concern regarding the adoptionof conventional ultrafiltration membranes for virusremoval is the possibility of the virus passingthrough abnormally large pores or surfaceimperfections on the membrane surface. The chiefprinciple behind the present work is to pretreat themembrane by blocking the abnormally large pores usinglatex particles. Experimental work was conducted tovalidate this pretreatment using the bacteriophagex174 as a model virus.The results attained were highly encouraging.Different sizes of latex particles were tested bytreating a 100 KD molecular weight cut-off membrane,and the transmission of phage (suspended in buffer)through this membrane assessed. In the absence of anyparticle pretreatment, a virus clearance of 4.78 logreduction value was observed for this membrane. Thetransmission of phage through the membrane could bereduced by an order of magnitude using 0.11 mlatex particles, or two orders of magnitude using acombination of 0.11 and 0.50 m particles.The application of latex particles did nothinder the transport of protein through the 100 KDmembrane. Protein sieving coefficients obtained usingthis membrane were 91%, 16% and 2%, for lysozyme,HSA and IgG, respectively.     

Architecture of the outer membrane of Escherichia coli K12. IV. Relationship between outer membrane particles and aqueous pores.

The hypothesis that intramembraneous particles, observed in the outer membrane of Escherichia coli by freeze-fracture electron microscopy, are the morphological representation of aqueous pores, was tested. A mutant which is deficient in five major outer membrane proteins, b, c, d, e and the phage lambda receptor protein, contains a largely decreased number of intramembraneous particles and also shows a greatly decreased rate of uptake of several solutes. In derivatives of this strain which contain only one of these proteins in large amounts a strong decrease of the number of intramembraneous particles is observed, which is accompanied by a complete restoration of the rate of uptake of those solutes which use pores in which the protein in question is involved. The results provide strong evidence for the notion that an individual pore contains only one protein species, a property which has been found earlier for individual particles. The observed correlation between particles and equeous pores strongly supports the hypothesis that the particles are the morphological representation of pores. Implications of this hypothesis for the structure of the particles are discussed.     

Properties of the endolytic transglycosylase encoded by gene 144 of Pseudomonas aeruginosa bacteriophage phiKZ

Bacteriophage endolysins degrading bacterial cell walls are prospective enzymes for therapy of bacterial infections. The genome of the giant bacteriophage phiKZ of Pseudomonas aeruginosa encodes two endolysins, gene products (g.p.) 144 and 181, which are homologous to lytic transglycosylases. Gene 144 encoding a 260 amino acid residue protein was cloned into the plasmid expression vector. Recombinant g.p. 144 purified from Escherichia coli effectively degrades chloroform-treated P. aeruginosa cell walls. The protein has predominantly α-helical conformation and exists in solution in stoichiometric monomer: dimer: trimer equilibrium. Antibodies against the protein bind the phage particle. This demonstrates that g.p. 144 is a structural component of the phiKZ particle, presumably, a phage tail. Published in Russian in Biokhimiya, 2006, Vol. 71, No. 3, pp. 379–385.     

Escherichia coli TolA tolerates multiple amino-acid substitutions as revealed by screening randomized variants for membrane integrity and phage receptor function

Escherichia coli TolA is a cytoplasmic membrane protein required for outer membrane integrity and the translocation of F-specific filamentous (Ff) bacteriophage DNA. Both phage infection and membrane integrity depend on several TolA interactions, e.g. those of the TolA C-terminal domain (TolAIII). Membrane integrity involves interaction with two host proteins and phage translocation requires direct interaction with the N-terminal domain (N1) of Ff phage protein g3p. Although cocrystallization of TolAIII and N1g3p has identified several contact points, it is still uncertain which residues are selectively involved in the different TolA functions. Thus, four different limited substitution libraries of TolA were created, targeting contacts at positions 415-420. These libraries were introduced into the tolA strain K17DE3tolA/F(+) and several variants, containing complementing, multiple amino-acid substitutions, were identified. However, most randomized variants did not complement the tolA strain K17DE3tolA/F(+). The TolA variants that restored sensitivity to phage infection displayed a considerable sequence variation, while the few variants that restored tolerance to detergent were from the same library. A comparison of the generated residue variation and natural variation, suggests that structural dependence overrides contact residue dependence. Thus, library screening can be efficient in identifying TolA variants with different functionally associated characteristics.     

Selection of substrate recognition sequence of protein kinase with ferric chelation affinity chromatography

Protein kinase substrate phage (PKS phage) was constructed by fusing the substrate recognition consensus sequence of cAMP-dependent protein kinase (cAPK) with bacteriophage minor coat protein g3p and by dis-playing it on the surface of filamentous bacteriophage fd. Phosphorylation in vitro by cAPK showed a unique labelled band of approximately 60 ku, which was consistent with the molecular weight of the PKS-g3p fusion protein. Some weakly phosphorylated bands for both PKS phage and wild-type phage were also observed. Phage display random 15-mer peptide library phosphorylated by cAPK was selected with ferric (Fe3 ) chelalion affinity resin. After 4 rounds of screening, phage clones were picked out to determine the displayed peptide sequences by DNA sequencing. The results showed that 5 of 14 sequenced phages displayed the cAPK recognition sequence motif (R)RXS/T. Their in vitro phosphorylation analyses revealed the specific labelled bands corresponding to the positive PKS phages with and without the typ     

Architecture of the outer membrane of Escherichia coli K12 IV. Relationship between outer membrane particles and aqueous pores

The hypothesis that intramembraneous particles, observed in the outer membrane of Escherichia coli by freeze-fracture electron microscopy, are the morphological representation of aqueous pores, was tested. A mutant which is deficient in five major outer membrane proteins, b, c, d, e and the phage λ receptor protein, contains a largely decreased number of intramembraneous particles and also shows a greatly decreased rate of uptake of several solutes. In derivatives of this strain which contain only one of these proteins in large amounts a strong decrease of the number of intramembraneous particles is observed, which is accompanied by a complete restoration of the rate of uptake of those solutes which use pores in which the protein in question is involved. The results provide strong evidence for the notion that an individual pore contains only one protein species, a property which has been found earlier for individual particles. The observed correlation between particles and aqueous pores strongly supports the hypothesis that the particles are the morphological representation of pores. Implications of this hypothesis for the structure of the particles are discussed.     

Phage display of a double-headed proteinase inhibitor: Analysis of the binding domains of potato proteinase inhibitor II

Potato proteinase inhibitor II (PI2) is a serine proteinase inhibitor composed of two domains that are thought to bind independently to proteinases. To determine the activities of each domain separately, various inactive and active domain combinations were constructed by substituting amino acid residues in the active domains by alanines. These derivatives were expressed as soluble protein inEscherichia coli and exposed on M13 phage as fusions to gene 3 in a phagemid system for monovalent phage display. Inactivation of both active domains by Ala residues reduced binding of phage to trypsin and chymotrypsin by 95%. Ten times more phage were bound to proteinases by domain II compared to domain I, while a point mutation (Leu⁵ Arg) altered the binding specificity of domain I of PI2 phage from chymotrypsin to trypsin. The mutants were used to show that functional PI2 phage mixed with nonfunctional PI2 phage could be enriched 323 000-fold after three rounds of panning. Thus, these results open up the possibility to use phage display for the selection of engineered PI2 derivatives with improved binding characteristics towards digestive proteinases of plants pests.The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number L37519 (p303.51).