CD spectra and some properties of deoxyoligonucleotide duplexes having a C:G terminus (nucleosides and nucleotides. Part 69).

In the course of an investigation of the mode of recognition of nucleotide sequences with restriction endonucleases, several deoxyoligonucleotide duplexes having G:C terminal base pairs were synthesized. The oligonucleotides having a 5'-C (3'-G) terminus showed unusual CD spectra with a negative band at the longer wavelength region, when compared to those of the same internal sequences but a 5'-G (3'-C) terminus, which showed a positive band like the B- or A-DNA type. The nature of these CD spectra was compared with those of the Z-DNAs on the effect of salt concentrations, intercalation with ethidium bromide, or 31P-NMR spectra. These unusual spectra may be attributed to the terminal effect of the 5'-C:3'-G pairs.     

Effects of A:T base pairs on the B-Z conformational transitions of DNA

Effects of A:T base pairs on the propensity of B to Z conformational transitions have been investigated by the CD salt titrations on d(CG)5' d(GC)5' terminal or central A:T replaced decamers, and terminal A:T appended dodecamers. The presence of A:T at the center greatly inhibits the B to Z transition of both G:C decamers. Moderate Z inhibitions are shown by terminal A:T replacements and additions to d(CG)5' with the former exhibiting a stronger effect. In contrast, the addition and replacement with A:T at the terminals of d(GC)5 facilitate the B to Z conversion, with the replacement exhibiting a somewhat more pronounced effect. These results may be rationalized in terms of the number of contigous CG sequences present in an oligomer and the relative inhibitory effects of other dinucleotide sequences. Our results also suggest that some short oligomers with purine at the 5'-end, such as d[A(CG)nT] with n greater than or equal to 2, may likely crystallize as Z conformations.     

An estimate of the nearest neighbor base-pair content of 5S RNA using CD and absorption spectroscopy.

We analyzed the CD and uv absorption spectra of 5S RNA from Escherichia coli using the method developed in the preceding paper. The analysis of spectra of 5S RNA at 20 degrees C in 0.1M NaClO4, 2.5 mM Na+ (phosphate), pH 7.0, and 0.5 mM MgSO4 gave 7 +/- 3.6 A.U base pairs, 25 +/- 3.6 G.C base pairs, and 7.5 +/- 3.6 G.U base pairs. Estimates of nearest neighbor base pairs were more consistent with the Pieler-Erdmann and the Gewirth-Moore secondary structure models than with the Fox-Woese or the Burns-Luoma-Marshall models. We also examined the structure of 5S RNA as a function of temperature. The melting profile exhibited two transitions--one at about 35 degrees C and one above 50 degrees C. Our spectral data showed that helices I and II were stable during the first transition, and agreed with other data that helix III was the most likely helix to have melted. The results from this in-depth study of 5S RNA indicate that our method of analysis should be useful for studying the secondary structures of other small, unmodified RNAs.     

The solution structure of a d[C(TTCG)G] DNA hairpin and comparison to the unusually stable RNA analogue.

The solution structure of the DNA analogue of the unusually stable r[C(UUCG)G] RNA hairpin, 5'-d[GGA-C(TTCG)GTCC]-3', has been determined by NMR spectroscopy, and its structure has been compared to that of the RNA molecule. The RNA molecule is compact and rigid with a highly structured loop. However, the DNA molecule is much less structured. The DNA hairpin contains a B-form stem of four base pairs. The terminal base pair frays, and the 3'-terminal nucleotides, C11 and C12, are in equilibrium between 2'-endo and 3'-endo conformations. Unlike the RNA loop, the DNA loop contains no syn nucleotides, and there is no evidence for base-base or base-phosphate hydrogen bonding in the loop. The loop is flexible, and reveals no specific internucleotide interactions.     

Fold-back structures at the distal end influence DNA slippage at the proximal end during mononucleotide repeat expansions.

Polymerase slippage during DNA synthesis by the Klenow fragment of DNA polymerase across A, C, G and T repeats (30 bases) has been studied. Within minutes, duplexes that contain only repeats (30 bp) expand dramatically to several hundred base pairs long. Rate comparisons in a repeat duplex when one strand was expanded as against that when both strands were expanded suggest a model of migrating hairpin loops which in the latter case coalesce into a duplex. Moreover, slippage (at the proximal or 3'-end) is subject to positive and negative effects from the 5'-end (distal) of the same strand. Growing T and G strands generate T.A:T and G-G:C motif fold-back structures at the distal end that hamper slippage at the proximal end. On the other hand, growing tails at the distal end upon annealing with excess complementary template accentuates proximal slippage several-fold.     

Circular dichroism spectra of DNA oligomers show that short interior stretches of C.C+ base pairs do not form in duplexes with A.T base pairs

Circular dichroism (CD) experiments were carried out on a series of DNA oligomers to determine if short internal stretches of protonated cytosine-cytosine (C.C+) base pairs could coexist with adenine-thymine (A.T) base pairs. (1) C.C+ base pairs did form in the absence of A.T base pairs in the individual oligomers d(AACC)5 and d(CCTT)5, as indicated by the appearance of a long-wavelength CD band centered at 282-284 nm, when the pH was lowered to 6 or 5 at 0.5 M Na+. A comparison of measured with calculated spectra showed that d(CCTT)5 at pH 5, 0.5 M Na+, 20 degrees C, likely adopted a structure with a central core of stacked C.C+ base pairs and looped-out thymines. Under the same conditions, it appeared that C.C+ base pairs also formed in d(AACC)5, but with the adenines remaining intrahelical. Each of these oligomers showed a cooperative transition for formation of C.C+ base pairs as the temperature was lowered, with C.C+ base pairs forming at a higher temperature in d(CCTT)5 than in d(AACC)5. A.T base formed in equimolar mixtures of d(AACC)5 plus d(CCTT)5 as monitored by an increase in the negative magnitude of the 250-nm CD band. However, a large increase did not appear at about 285 nm in CD spectra of the mixtures, showing that there were no stacked C.C+ base pairs in the d(AACC)5.d(CCTT)5 duplex even though they formed under the same conditions in the individual strands. Thus, in this duplex, A.T base pairs prevented the formation of neighboring internal C.C+ base pairs. (2) CD measurements were also made of d(A10C4T10).(ABSTRACT TRUNCATED AT 250 WORDS)     

Analysis of an RNA pseudoknot structure by CD spectroscopy.

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.     

Nuclear magnetic resonance investigation of primer--template models: formation of a pyrimidine bulge upon misincorporation

Our previous studies have shown that misaligned structures can occur upon misincorporation of a dNTP opposite thymine templates. The formation of misaligned structures during DNA replication, if not repaired properly, can be bypassed and extended by low-fidelity polymerases and ultimately lead to mutations. In this study, the base pair structures at the replicating sites of a set of primer-template models which mimic the situation upon misincorporation of a dNTP opposite cytosine templates have been determined. High-resolution NMR structural results show that misaligned structures with a C-bulge can be formed upon incorporation of dCTP, dTTP, and dATP opposite 5'-GC, 5'-AC, and 5'-TC templates, respectively. The stabilities of misaligned structures depend on the types of terminal base pairs at the replicating sites. Together with the structural findings in thymine templates, we conclude that terminal G.C and C.G base pairs always contribute a larger stabilizing effect to the misaligned structures containing a pyrimidine bulge than terminal A.T and T.A base pairs. Misalignment and thus deletion mutation are more likely to occur if misincorporation of a nucleotide opposite a pyrimidine template can cause template slippage to form a terminal G.C or C.G base pair. Although misalignment also occurs when the newly formed terminal base pair is an A.T base pair or a T.A base pair, both misaligned and mismatched conformers coexist, which can lead to deletion and substitution mutations, respectively.     

A method for estimating the nearest neighbor base-pair content of RNAs using CD and absorption spectroscopy.

CD and absorption spectra are sensitive to the secondary structure of RNAs. By fitting the spectra contained in our basis set to the CD and absorption spectra of an RNA of known sequence, we could determine the fractions of base pairs, the fractions of each of the nearest neighbor base pairs, and the fractions of the single-stranded nucleotides in that RNA. The basis set included 58 CD and 58 absorption spectra. The fitting was done with a guided selection routine. The estimated error was about 0.05 for predicting the fractions of the nearest neighbor base pairs, 0.06 for predicting the fractions of A.U, G.C, and G.U base pairs, and 0.04 for predicting the fractions of the single-stranded nucleotides.     

Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's.     

Free energy contributions of G.U and other terminal mismatches to helix stability

Thermodynamic parameters of helix formation were measured spectroscopically for seven hexaribonucleotides containing a GC tetramer core and G.U or other terminal mismatches. The free energies of helix formation are compared with those for the tetramer core alone and with those for the hexamer with six Watson-Crick base pairs. In 1 M NaCl, at 37 degrees C, the free energy of a terminal G.U mismatch is about equal to that of the corresponding A.U pair. Although other terminal mismatches studied add between -1.0 and -1.6 kcal/mol to delta G0 37 for helix formation, all are less stable than the corresponding Watson-Crick pairs. Comparisons of the stability increments for terminal G.U mismatches and G.C pairs suggest when stacking is weak the additional hydrogen bond in the G.C pair adds roughly -1 kcal/mol to the favorable free energy of duplex formation.     

Analysis of an RNA Pseudoknot Structure by CD Spectroscopy

Abstract

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.     

Base pairing in wheat germ ribosomal 5S RNA as measured by ultraviolet absorption, circular dichroism, and Fourier-transform infrared spectrometry

Ultraviolet absorption (UV) and circular dichroism (CD) spectra of wheat germ 5S RNA, when compared to tRNAPhe, indicate a largely base-paired and base-stacked helical structure, containing up to 36 base pairs. Fourier-transform infrared (FT-IR) spectra of tRNAPhe and wheat germ ribosomal 5S RNA have been acquired at 30 and 90 degrees C. From the difference of the FT-IR spectra between 90 and 30 degrees C, the number of base pairs in both RNAs was determined by modification of a previously published procedure [Burkey, K. O., Marshall, A. G., & Alben, J. O. (1983) Biochemistry 22, 4223-4229]. The base-pair composition and total base-pair number from FT-IR data are now consistent for the first time with optical (UV, CD, Raman) and NMR results for ribosomal 5S RNA. Without added Mg2+, tRNAPhe gave 18 +/- 2 base pairs [7 A-U and 11 G-C], in good agreement with the number of secondary base pairs from X-ray crystallography [8 A-U, 12 G-C, and 1 G-U]. Within the 10% precision of the FT-IR method, wheat germ 5S RNA exhibits essentially the same number of base pairs [14 A-U, 17 G-C, and 5 G-U; for a total of 36] in the absence of Mg2+ as in the presence of Mg2+ [14 A-U, 18 G-C, and 3 G-U; for a total of 35], in agreement with the UV hyperchromism estimate of G-C/(A-U + G-C) = 0.58.(ABSTRACT TRUNCATED AT 250 WORDS)     

Enhanced base-pair opening in the adenine tract of a RNA double helix

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the kinetics and energetics of base-pair opening in two nucleic acid double helices. One is the RNA duplex 5'-r(GCGAUAAAAAGGCC)-3'/5'-r(GGCCUUUUUAUCGC)-3', which contains a central tract of five AU base pairs. The other is the homologous DNA duplex with a central tract of five AT base pairs. The rates and the equilibrium constants of the opening reaction of each base pair are measured from the dependence of the exchange rates of imino protons on ammonia concentration, at 10 °C. The results reveal that the tract of AU base pairs in the RNA duplex differs from the homologous tract of AT base pairs in DNA in several ways. The rates of opening of AU base pairs in RNA are high and increase progressively along the tract, reaching their largest values at the 3'-end of the tract. In contrast, the opening rates of AT base pairs in DNA are much lower than those of AU base pairs. Within the tract, the largest opening rate is observed for the AT base pair at the 5'-end of the tract. These differences in opening kinetics are paralleled by differences in the stabilities of individual base pairs. All AU base pairs in the RNA are less stable than the AT base pairs in the DNA. The presence of the tract enhances these differences by increasing the stability of AT base pairs in DNA while decreasing the stability of AU base pairs in RNA. Due to these divergent trends, along the tracts, the AU base pairs become progressively less stable than AT base pairs. These findings demonstrate that tracts of AU base pairs in RNA have specific dynamic and energetic signatures that distinguish them from similar tracts of AT base pairs in DNA.     

Crystal and molecular structure of a DNA fragment: d(CGTGAATTCACG)

The crystal structure of the dodecanucleotide d(CGTGAATTCACG) has been determined to a resolution of 2.7 A and refined to an R factor of 17.0% for 1532 reflections. The sequence crystallizes as a B-form double helix, with Watson-Crick base pairing. This sequence contains the EcoRI restriction endonuclease recognition site, GAATTC, and is flanked by CGT on the 5'-end and ACG on the 3'-end, in contrast to the CGC on the 5'-end and GCG on the 3'-end in the parent dodecamer d(CGCGAATTCGCG). A comparison with the isomorphous parent compound shows that any changes in the structure induced by the change in the sequence in the flanking region are highly localized. The global conformation of the duplex is conserved. The overall bend in the helix is 10 degrees. The average helical twist values for the present and the parent structures are 36.5 degrees and 36.4 degrees, respectively, corresponding to 10 base pairs per turn. The buckle at the substituted sites are significantly different from those seen at the corresponding positions in the parent dodecamer. Step 2 (GpT) is underwound with respect to the parent structure (27 degrees vs 36 degrees) and step 3 (TpG) is overwound (34 degrees vs 27 degrees). There is a spine of hydration in the narrow minor groove. The N3 atom of adenine on the substituted A10 and A22 bases are involved in the formation of hydrogen bonds with other duplexes or with water; the N3 atom of guanine on G10 and G22 bases in the parent structure does not form hydrogen bonds.     

Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability

Parallel-stranded (ps) DNAs with mixed AT/GC content comprising G.C pairs in a varying sequence context have been investigated. Oligonucleotides were devised consisting of two 10-nt strands complementary either in a parallel or in an antiparallel orientation and joined via nonnucleotide linkers so as to form 10-bp ps or aps hairpins. A predominance of intramolecular hairpins over intermolecular duplexes was achieved by choice of experimental conditions and verified by fluorescence determinations yielding estimations of rotational relaxation times and fractional base pairing. A multistate mode of ps hairpin melting was revealed by temperature gradient gel electrophoresis (TGGE). The thermal stability of the ps hairpins with mixed AT/GC content depends strongly on the specific sequence in a manner peculiar to the ps double helix. The thermodynamic effects of incorporating trans G.C base pairs into an AT sequence are context-dependent: an isolated G. C base pair destabilizes the duplex whereas a block of > or =2 consecutive G.C base pairs exerts a stabilizing effect. A multistate heterogeneous zipper model for the thermal denaturation of the hairpins was derived and used in a global minimization procedure to compute the thermodynamic parameters of the ps hairpins from experimental melting data. In 0.1 M LiCl at 3 degrees C, the formation of a trans G.C pair in a GG/CC sequence context is approximately 3 kJ mol(-)(1) more favorable than the formation of a trans A.T pair in an AT/TA sequence context. However, GC/AT contacts contribute a substantial unfavorable free energy difference of approximately 2 kJ mol(-)(1). As a consequence, the base composition and fractional distribution of isolated and clustered G.C base pairs determine the overall stability of ps-DNA with mixed AT/GC sequences. Thus, the stability of ps-DNA comprising successive > or =2 G.C base pairs is greater than that of ps-DNA with an alternating AT sequence, whereas increasing the number of AT/GC contacts by isolating G.C base pairs exerts a destabilizing effect on the ps duplex. Molecular modeling of the various helices by force field techniques provides insight into the structural basis for these distinctions.     

Contributions of dangling end stacking and terminal base-pair formation to the stabilities of XGGCCp, XCCGGp, XGGCCYp, and XCCGGYp helixes

The role of stacking in terminal base-pair formation was studied by comparison of the stability increments for dangling ends to those for fully formed base pairs. Thermodynamic parameters were measured spectrophotometrically for helix formation of the hexanucleotides AGGCCUp, UGGCCAp, CGGCCGp, GCCGGCp, and UCCGGAp and for the corresponding pentanucleotides containing a 5'-dangling end on the GGCCp or CCGGp core helix. In 1 M NaCl at 1 X 10(-4) M strands, a 5'-dangling nucleotide in this series increases the duplex melting temperature (Tm) only 0-4 degrees C, about the same as adding a 5'-phosphate. In contrast, a 3'-dangling nucleotide increases the Tm at 1 X 10(-4) M strands 7-23 degrees C, depending on the sequence [Freier, S. M., Burger, B. J., Alkema, D., Neilson, T., & Turner, D. H. (1983) Biochemistry 22, 6198-6206]. These results are consistent with stacking patterns observed in A-form RNA. The stability increments from terminal A.U, C.G, or U.A base pairs on GGCC or a terminal U.A pair on CCGG are nearly equal to the sums of the stability increments from the corresponding dangling ends. This suggests stacking plays a large role in nucleic acid stability. The stability increment from the terminal base pairs in GCCGGCp, however, is about 5 times the sum of the corresponding dangling ends, suggesting hydrogen bonding can also make important contributions.     

Selective DNA Binding of (N-alkylamine)-Substituted Naphthalene Imides and Diimides to G+C-rich DNA

Abstract

Alkylamine-substituted naphthalene imides and diimides bind DNA by intercalation and have applications as anticancer agents. The unique structures of these imides in which two adjacent carbonyl groups lie coplanar to an extended aromatic ring system allow the possibility of sequence-selective interactions between the intercalated chromophore and guanine amino groups situated in the DNA minor groove. The binding affinities of N-[3- (dimethylamino)propyl amine]-1,8-naphthalenedicarboxylic imide (N-DMPrNI) and N, N′- bis[3,3′-(dimethylamino)propylamine]-naphthalene-1,4,5,8-tetracarboxylic diimide (N- BDMPrNDI) for natural DNAs of differing base composition were determined spectroscopically and by equilibrium dialysis. In agreement with the above proposition, binding studies indicated that both the naphthalene imide and diimide strongly prefer to intercalate into steps containing at least one G:C base pair. The dependencies of association constants on DNA base composition are consistent with a requirement for one G:C pair in the binding site of the monoimide, and two G:C pairs in binding sites of the diimide. These selectivities are comparable to or exceed that of actinomycin D, a classic G:C-selective drug. Protection footprinting with DNase I confirmed that the naphthalene monoimide (N-DMPrNI) prefers to bind adjacent to G:C base pairs, with a most consistent preference for “mixed” steps containing both a G:C and an A:T pair, excepting GA:TC. Several 5-CG-3′ steps were also good binding sites as indicated by nuclease protection, but few GC:GC or GG:CC steps were protected. The naphthalene diimide inhibited DNase I digestion, but did not yield a footprint. The base recognition ability and versatile chemistry make naphthalene imides and diimides attractive building blocks for design of highly sequence-specific, DNA-directed drug candidates including conjugated oligonucleotides or oligopeptides.     

NMR structures of r(GCAGGCGUGC)2 and determinants of stability for single guanosine-guanosine base pairs

Nucleotides in RNA that are not Watson-Crick-paired form unique structures for recognition or catalysis, but determinants of these structures and their stabilities are poorly understood. A single noncanonical pair of two guanosines (G) is more stable than other noncanonical pairs and can potentially form pairing structures with two hydrogen bonds in four different ways. Here, the energetics and structure of single GG pairs are investigated in several sequence contexts by optical melting and NMR. The data for r(5'GCAGGCGUGC3')(2), in which G4 and G7 are paired, are consistent with a model in which G4 and G7 alternate syn glycosidic conformations in a two-hydrogen-bond pair. The two distinct structures are derived from nuclear Overhauser effect spectroscopic distance restraints coupled with simulated annealing using the AMBER 95 force field. In each structure, the imino and amino protons of the anti G are hydrogen bonded to the O6 and N7 acceptors of the syn G, respectively. An additional hydrogen-bond connects the syn G amino group to the 5' nonbridging pro-R(p) phosphate oxygen. The GG pair fits well into a Watson-Crick helix. In r(5'GCAGGCGUGC3')(2), the G4(anti), G7(syn) structure is preferred over G4(syn), G7(anti). For single GG pairs in other contexts, exchange processes make interpretation of spectra more difficult but the pairs are also G(syn), G(anti). Thermodynamic data for a variety of duplexes containing pairs of G, inosine, and 7-deazaguanosine flanked by GC pairs are consistent with the structural and energetic interpretations for r(5'GCAGGCGUGC3')(2), suggesting similar GG conformations.