The AT spacers and the var1 genes from the mitochondrial genomes of Saccharomyces cerevisiae and Torulopsis glabrata: evolutionary origin and mechanism of formation

Intergenic sequences represent 63% of the mitochondrial 'long' (85 kb) genome of Saccharomyces cerevisiae. They comprise 170-200 AT spacers that correspond to 47% of the genome and are separated from each other by GC clusters, ORFs, ori sequences, as well as by protein-coding genes. Intergenic AT spacers have an average size of 190 bp, and a GC level of 5%; they are formed by short (20-30 nt on the average) A/T stretches separated by C/G mono- to trinucleotides. An analysis of the primary structures of all intergenic AT spacers already sequenced (32 kb; 80% of the total) has shown that they are characterized by an extremely high level of short sequence repetitiveness and by a characteristic sequence pattern; the frequencies of A/T isostichs conspicuously deviate from statistical expectations, and exponentially decrease when their (AT + TA)/(AA + TT) ratio, R, decreases. A situation basically identical was found in the AT spacers of the mitochondrial genome (19 kb) of Torulopsis glabrata. The sequence features of the AT spacers indicate that they were built in evolution by an expansion process mainly involving rounds of duplication, inversion and translocation events which affected an initial oligodeoxynucleotide (endowed with a particular R ratio) and the sequences derived from it. In turn, the initial oligodeoxynucleotide appears to have arisen from an ancestral promoter-replicator sequence which was at the origin of the nonanucleotide promoters present in the mitochondrial genomes of several yeasts. Common sequence patterns indicate that the AT spacers so formed gave rise to the var1 gene (by linking and phasing of short ORFs), to the DNA stretches corresponding to the untranslated mRNA sequences and to the central stretches of ori sequences from S. cerevisiae.     

Analysis of the regions coding for transfer RNAs in Kluyveromyces lactis mitochondrial DNA.

The major regions coding for the transfer RNA genes in the mitochondrial DNA of K. lactis were studied. Twenty one, out of a supposed twenty four tRNA genes were identified and localized with respect to other mitochondrial genes. Most of the tRNA genes were found in a cluster downstream of the large ribosomal RNA gene. The order of a few groups of genes is conserved with respect to S. cerevisiae and T. glabrata. The highly diverged intergenic sequences contained a large number of guanine-cytosine clusters which frequently formed long palindromic sequences.     

Mobility of Two Optional G + C-Rich Clusters of the Var1 Gene of Yeast Mitochondrial DNA

Yeast mtDNA contains two different kinds of mobile optional sequences, two group I introns and a short G + C-rich insertion to some var1 genes. Movement of each element in crosses has been called gene conversion though little is known about the mechanism of G + C cluster conversion. A new allele of the var1 gene found in mtDNA of Saccharomyces capensis is described that permitted a more detailed comparison between intron mobility and G + C cluster conversion. The S. capensis var1 gene lacks the cc+ element present in all S. cerevisiae var 1 genes and the previously described optional a+ element. In crosses with cc+ a- and cc+ a+ S. cerevisiae strains, both clusters were found to be mobile and, in the latter cross, appear to convert independently and only to homologous insertion sites. No evidence for flanking marker coconversion (a hallmark feature of intron conversion) was obtained despite the availability of nearby physical markers on both sides of cluster conversion sites. These data indicate that G + C cluster conversion has only a superficial resemblance to intron mobility; analogies to procaryotic transposition mechanisms are considered.     

Evolutionary relationships among pathogenic Candida species and relatives.

Small subunit rRNA sequences have been determined for 10 of the most clinically important pathogenic species of the yeast genus Candida (including Torulopsis [Candida] glabrata and Yarrowia [Candida] lipolytica) and for Hansenula polymorpha. Phylogenetic analyses of these sequences and those of Saccharomyces cerevisiae, Kluyveromyces marxianus var. lactis, and Aspergillus fumigatus indicate that Candida albicans, C. tropicalis, C. parapsilosis, and C. viswanathii form a subgroup within the genus. The remaining significant pathogen, T. glabrata, falls into a second, distinct subgroup and is specifically related to S. cerevisiae and more distantly related to C. kefyr (psuedotropicalis) and K. marxianus var. lactis. The 18S rRNA sequence of Y. lipolytica has evolved rapidly in relation to the other Candida sequences examined and appears to be only distantly related to them. As anticipated, species of several other genera appear to bear specific relationships to members of the genus Candida.     

Polymorphisms in tandemly repeated sequences ofSaccharomyces cerevisiae mitodhondrial DNA

Summary A spontaneously arising mitochondrial DNA (mtDNA) variant ofSaccharomyces cerevisiae has been formed by two exta copies of a 14-bp sequence (TTAATTAAATTATC) being added to a tandem repeat of this unit. Similar polymorphisms in tandemly repeated sequences have been found in a comparison between mtDNAs from our strain and others. In 5850 bp of intergenic mtDNA squence, polymorphisms in tandemly repeated sequences of three or more base pairs occur approximately every 400–500 bp whereas differences in 1–2 bp occur approximately every 60 bp. Some polymorphisms are associated wit optional G+C-rich sequences (GC clusters). Two such optional GC clusters and one A+T repeat polymorphism have been discovered in the tRNA synthesis locus. In addition, the variable presence of large open reading frames are documented and mechanisms for generating intergenic sequence diversity inS. cerevisiae mtDNA are discussed.     

The GC clusters of the mitochondrial genome of yeast and their evolutionary origin

We have studied the primary and secondary structures, the location and the orientation of the 196 GC clusters present in the 90% of the mitochondrial genome of Saccharomyces cerevisiae which have already been sequenced. The vast majority of GC clusters is located in intergenic sequences (including ori sequences, intergenic open reading frames and the gene varl which probably arose from an intergenic spacer) and in intronic closed reading frames (CRF's); most of them can be folded into stem-and-loop systems; both orientations are equally frequent. The primary structures of GC clusters permit to group them into eight families, seven of which are related to the family formed by clusters A, B and C of the ori sequences. On the basis of the present work, we propose that the latter derive from a primitive ori sequence (probably made of only a monomeric cluster C and its flanking sequences r* and r) through (i) a series of duplication inversions generating clusters A and B; and (ii) an expansion process producing the AT stretches of ori sequences. Most GC clusters apparently originated from primary clusters also derived from the primitive ori sequence in the course of its evolution towards the present ori sequences. Finally, we propose that the function of GC clusters is predominantly, or entirely, associated with the structure and organization of the mitochondrial genome of yeast and, indirectly, with the regulation of its expression.     

The taxonomic position of Saccharomyces boulardii as evaluated by sequence analysis of the D1/D2 domain of 26S rDNA, the ITS1-5.8S rDNA-ITS2 region and the mitochondrial cytochrome-c oxidase II gene

A taxonomic study was carried out on eight strains of Saccharomyces boulardii. Morphological and physiological characteristics were consistent with those of Saccharomyces cerevisiae. Sequences of the D1/D2 domain of the 26S rDNA were identical for all strains examined and had a similarity value of 100% compared to sequences of the type strain of S. cerevisiae (CBS 1171T) and strain S288c. For all S. boulardii isolates was found the exact same ITS1-5.8S rDNA-ITS2 sequence, which displayed a close resemblance with the sequences published for S288c (99.9%), CBS 1171(T) (99.3%) and other S. cerevisiae strains. Sequence analysis of the mitochondrial cytochrome-c oxidase II gene (COX2) also resulted in identical sequences for the S. boulardii isolates and comparisons with available nucleotide sequences revealed close relatedness to strains of S. cerevisiae including S288c (99.5%) and CBS 1171(T) (96.6%). The electrophoretic karyotypes of the S. boulardii strains appeared quite uniform and although very typical of S. cerevisiae, they formed a cluster separate from strains of this species. The results of the present study strongly indicate a close relatedness of S. boulardii to S. cerevisiae and thereby support the recognition of S. boulardii as a member of S. cerevisiae and not as a separate species.     

Hybridizable sequences between cytoplasmic ribosomal RNAs and 3 micron circular DNAs of Saccharomyces cerevisiae and Torulopsis glabrata.

We have shown that 2.8 and 3.1 micron circular DNA molecules, previously reported to be present in Saccharomyces cerevisiae and Torulopsis glabrata respectively, contain sequences hybridizing to cytoplasmic ribosomal RNAs. In S. cerevisiae the 2.8 micron circular DNA appears to be identical to the rDNA repeating unit from nuclear DNA, both in length (approximately 9000 base pairs) and in the location of the 25, 18 and 5.8S rRNA sequences on the large HindIII fragment (6500 bp) and the presence of the 5S rRNA sequence on the small HindIII fragment. The 3.1 micron molecule from T. glabrata is approximately 2000 base pairs longer than the S. cerevisiae molecule and in addition, one of the HindIII sites lies within the region hybridizing to 25, 18 and 5.8S rRNAs. In S. cerevisiae the 4-5 copies of the 2.8 micron circular DNA molecules per cell, which have an extra-nuclear location, do not appear to be essential for cell viability as in one strain they were undetectable.     

Cloning, sequence and chromosomal location of a MEL gene from Saccharomyces carlsbergensis NCYC396.

Yeast strains producing alpha-galactosidase (alpha Gal) are able to use melibiose as a carbon source during growth or fermentation. We cloned a MEL gene from Saccharomyces carlsbergensis NCYC396 through hybridization to the MEL1 gene cloned earlier from Saccharomyces cerevisiae var. uvarum. The alpha Gal encoded by the newly cloned gene was galactose-inducible as is the alpha Gal encoded by MEL1. A probable GAL4-protein recognition sequence was found in the upstream region of the NCYC396 MEL gene. The gene was transcribed to a 1.5-kb mRNA which, according to the nucleotide sequence, encodes a protein of 471 amino acids (aa) with an Mr of 52,006. The first 18 aa fulfilled the criteria for the signal sequence, but lacked positively charged aa residues, except the initiating methionine. The enzyme activity was found exclusively in the cellular fraction of the cultures. The deduced aa sequence was compared to the aa sequences of other alpha Gal enzymes. It showed 83% identity with the S. cerevisiae enzyme, but only 35% with the plant enzyme, 30% with the human enzyme and 17% with the Escherichia coli enzyme. With pulsed-field electrophoresis, the MEL gene was located on chromosome X of S. carlsbergensis, whereas the S. cerevisiae var. uvarum MEL1 gene is located on chromosome II.     

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.