共查询到20条相似文献,搜索用时 15 毫秒
1.
《Biodemography and social biology》2013,59(3-4):234-243
Abstract The epidemiologic transition theory focuses on the changing patterns of morbidity and mortality and postulates that mortality by cause will evolve from a predominance of acute and infectious diseases to a predominance of chronic and degenerative diseases. The epidemiologic transition theory comprises three stages: the age of pestilence and famine (lasting until 1875), receding pandemics (from 1875 to 1930), and degenerative and man‐made diseases (from 1930 to the present). Recent information suggests that developed societies have entered a new stage in the transition. This fourth stage, which we term the hybristic stage, is increasingly influenced by individual behaviors and life‐styles. In this paper, we examine the epidemiologic transition theory, substantiate the need for a new stage, and discuss current cause‐specific trends in mortality and the social and demographic implications of such trends. 相似文献
2.
Pere Garriga Janos Sági David Garcia-Quintana Manuel Sabés Joan Manyosa 《Journal of biomolecular structure & dynamics》2013,31(5):1061-1071
Abstract Fourth derivative spectrophotometry has been applied to monitor conformational isomerizations of polynucleotides for the first time. The transitions studied have been the B-A and A-X isomerizations of poly(dA-dT) and the B-X one of poly(amino2dA-dT). Parameters obtained from the fourth derivative spectra have been used to follow these conformational changes. The A form of poly(dA-dT) has been characterized by a new fourth derivative peak at 293.0 nm which can be associated to interstrand adenine-adenine interactions. Furthermore, some of the fourth derivative peaks in the long wavelength region (270–310 nm) can be related to stacking interactions present in the polynucleotide double helices. The tentative assignment of these peaks, particularly that at 299.0 nm in the derivative spectra of poly(amino2dA-dT), to n→π* electronic transitions is discussed. 相似文献
3.
《Cancer epidemiology》2014,38(3):235-243
BackgroundThailand is undergoing an epidemiologic transition, with decreasing incidence of infectious diseases and increasing rates of chronic conditions, including cancer. Breast cancer has the highest incidence rates among females both in the southern region Thailand and throughout Thailand. However, there is a lack of research on the epidemiology of this and other cancers.MethodsHere we use cancer incidence data from the Songkhla Cancer Registry to characterize and analyze the incidence of breast cancer in Southern Thailand. We use joinpoint analysis, age-period-cohort models and nordpred analysis to investigate the incidence of breast cancer in Southern Thailand from 1990 to 2010 and project future trends from 2010 to 2029.ResultsWe found that age-adjusted breast cancer incidence rates in Southern Thailand increased by almost 300% from 1990 to 2010 going from 10.0 to 27.8 cases per 100,000 person-years. Both period and cohort effects played a role in shaping the increase in incidence. Three distinct incidence projection methods consistently suggested that incidence rates will continue to increase in the future with incidence for women age 50 and above increasing at a higher rate than for women below 50.ConclusionsTo date, this is the first study to examine Thai breast cancer incidence from a regional registry. This study provides a basis for future planning strategies in breast cancer prevention and to guide hypotheses for population-based epidemiologic research in Thailand. 相似文献
4.
BackgroundTraditional methodologies for identifying and recruiting controls in epidemiologic case-control studies, such as random digit dialing or neighborhood walk, suffer from declining response rates. Here, we revisit the feasibility and comparability of using alternative sources of controls, specifically friend and family controls.MethodsWe recruited from a recently completed case-control study of non-Hodgkin lymphoma (NHL) among women in Los Angeles County where controls from the parent study were ascertained by neighborhood walk. We calculated participation rates and compared questionnaire responses between the friend/family controls and the original matched controls from the parent study.ResultsOf the 182 NHL case patients contacted, 111 (61%) agreed to participate in our feasibility study. 70 (63%) provided contact information for potential friend and/or family member controls. We were able to successfully contact and recruit a friend/family member for 92% of the case patients. This represented 46 friend controls and 54 family controls. Family controls significantly differed from original matched controls by sex and household income. Other characteristics were similar between friend controls and the original study’s neighborhood controls.ConclusionThe apparent comparability of neighborhood controls to friend and family controls among respondents in this study suggests that these alternative methods of control identification can serve as a complementary source of eligible controls in epidemiologic case-control studies. 相似文献
5.
6.
BackgroundCorpus uteri cancer has become the fourth most common female cancer in Europe. In Estonia, the prevalence of obesity is increasing, and corpus uteri cancer survival has been relatively low. The aim of the study was to evaluate incidence, mortality and survival trends of corpus uteri cancer in Estonia by age, stage and histological subtypes with an emphasis on surgical treatment.MethodsEstonian Cancer Registry data on incident cases of corpus uteri cancer were used to examine incidence trends (1995–2016) and calculate relative survival ratios (RSR) (1996–2016). Cases were classified by morphology and FIGO stage. Causes of Death Registry data were used to analyse corrected mortality (1995–2017).ResultsA total of 4281 cases were diagnosed in 1996–2016. A significant increase was seen in age-standardized incidence from 2009, while mortality remained stable throughout the study period. Significant increases were observed for type I cancers and age groups ≥65 years. Overall age-standardized 5-year RSR improved from 70% in 1996–2002 to 78% in 2010–2016. Survival increased for type I cancers, all age groups and all stages (significantly for stage IV). The proportion of surgically treated cases increased significantly from 85% to 89%, with the largest increases seen in older age groups and later stages.DiscussionThe rising corpus uteri cancer incidence in Estonia is driven by the type I cancer trend. Survival gain for later stages and older age groups likely reflected more frequent surgical treatment. To reduce mortality, further efforts are necessary to ensure appropriate care for all patients. 相似文献
7.
Background & objectivesAn assessment of transition of cancer in India during the past 30 years, according to changes in demographic and epidemiologic risk factors was undertaken.Materials & methodsCancer registry data (http://www.ncdirindia.org), (population coverage <10%), was compared with transition in life-expectancy and prevalence on smoking, alcohol and obesity. We fitted linear regression to the natural logarithm of the estimated incidence rates of various cancer registries in India.ResultsBurden of cancer in India increased from 0.6 million in 1991 to 1.4 million in 2015. Among males, common cancers are lung (12.0%), mouth (11.4%), prostate (7.0%), and tongue (7.0%) and among females, they are breast (21.0%), cervix-uteri (12.1%), ovary (6.9%), and lung (4.9%) in 2012. Increased life-expectancy and population growth as well as increased use of alcohol and increased prevalence of overweight/obesity reflected an increase in all cancers in both genders except a reduction in infection-related cancers such as cervix-uteri and tobacco-related cancers such as pharynx (excludes nasopharynx) and oesophagus.Interpretation & conclusionTransition in demographics and epidemiologic risk factors, reflected an increase in all cancers in both genders except a reduction in a few cancers. The increasing incidence of cancer and its associated factors demands a planned approach to reduce its burden. The burden assessment needs to be strengthened by increasing the population coverage of cancer registries. Continued effort for tobacco prevention and public health efforts for reducing obesity and alcohol consumption are needed to reduce the cancer burden. 相似文献
8.
9.
BackgroundPathologist and computational assessments have been used to evaluate immunohistochemistry (IHC) in epidemiologic studies. We compared Definiens Tissue Studio® to pathologist scores for 17 markers measured in breast tumor tissue microarrays (TMAs) [AR, CD20, CD4, CD8, CD163, EPRS, ER, FASN, H3K27, IGF1R, IR, Ki67, phospho-mTOR, PR, PTEN, RXR, and VDR].Methods5 914 Nurses’ Health Study participants, diagnosed 1976–2006 (NHS) and 1989–2006 (NHS-II), were included. IHC was conducted by the Dana-Farber/Harvard Cancer Center Specialized Histopathology Laboratory. The percent of cells staining positive was assessed by breast pathologists. Definiens output was used to calculate a weighted average of percent of cells staining positive across TMA cores for each marker. Correlations between pathologist and computational scores were evaluated with Spearman correlation coefficients. Receiver-operator characteristic curves were constructed, using pathologist scores as comparison.ResultsSpearman correlations between pathologist and Definiens assessments ranged from weak (RXR, rho=-0.05; CD163, rho = 0.10) to strong (Ki67, rho = 0.79; pmTOR, rho = 0.77). The area under the curve was >0.70 for all markers except RXR.ConclusionOur data indicate that computational assessments exhibit variable correlations with interpretations made by an expert pathologist, depending on the marker evaluated. This study provides evidence supporting the use of computational platforms for IHC evaluation in large-scale epidemiologic studies, with the caveat that pilot studies are necessary to investigate agreement with expert assessments. In sum, computational platforms may provide greater efficiency and facilitate high-throughput epidemiologic analyses. 相似文献
10.
Alejandro Toro-Labbé Soledad Gutiérrez-Oliva Jane S. Murray Peter Politzer 《Journal of molecular modeling》2009,15(6):707-710
The reaction force F(R) and the position-dependent reaction force constant κF(R) are defined by F(R)=-∂V(R)/∂R and κ(R)=∂2V(R)/∂R2, where V(R) is the potential energy of a reacting system along a coordinate R. The minima and maxima of F(R) provide a natural division of the process into several regions. Those in which F(R) is increasing are where the most dramatic changes in electronic properties take place, and where the system goes from activated
reactants (at the force minimum) to activated products (at the force maximum). κ(R) is negative throughout such a region. We summarize evidence supporting the idea that a reaction should be viewed as going
through a transition region rather than through a single point transition state. A similar conclusion has come out of transition state spectroscopy. We describe this region as a chemically-active, or electronically-intensive,
stage of the reaction, while the ones that precede and follow it are structurally-intensive. Finally, we briefly address the
time dependence of the reaction force and the reaction force constant. 相似文献
11.
《Endocrine practice》2010,16(5):864-873
ObjectiveTo review the epidemiologic studies that describe the relationships among diabetes, obesity, and cancer; animal studies that have helped to decipher the mechanisms of cancer development; and some of the therapeutic targets undergoing investigation.MethodsAn electronic search was performed of Medline, Scopus, Google Scholar, and ClinicalTrials.gov to identify English-language articles and studies published from 1995 through 2010 relating to obesity, insulin, insulinlike growth factors, diabetes mellitus, and cancer.ResultsEpidemiologic studies have reported that diabetes and obesity are linked to an increased risk of certain cancers in association with higher levels of insulin, C-peptide, and insulinlike growth factor 1. Animal models have demonstrated that increased insulin, insulinlike growth factor 1, and insulinlike growth factor 2 signaling can enhance tumor growth, while inhibiting this signaling can reduce tumorigenesis. Therapies that target insulin and insulinlike growth factor 1 signaling pathways have been developed and are currently in clinical trials to treat cancer.ConclusionsInsulin, insulinlike growth factor 1, and insulinlike growth factor 2 signaling through the insulin receptor and the insulinlike growth factor 1 receptor can induce tumorigenesis, accounting to some extent for the link between diabetes, obesity, and cancer. Knowledge of these pathways has enhanced our understanding of tumor development and allowed for the discovery of novel cancer treatments. (Endocr Pract. 2010;16:864-873) 相似文献
12.
Andrew N. Lane Christopher J. Bauer Thomas A. Frenkiel 《European biophysics journal : EBJ》1993,21(6):425-431
Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.
Correspondence to: A. N. Lane 相似文献
13.
ObjectiveActive surveillance (AS) has been shown to be a safe approach that can effectively block transition from overdiagnosis to overtreatment in patients with low-risk papillary thyroid microcarcinoma (PTMC). This study aimed to determine whether the AS approach can be implemented in China and investigate the population characteristics of Chinese patients who underwent AS.MethodsThe epidemiologic and clinical characteristics as well as patient adherence were evaluated in 115 patients who underwent AS management as an alternative to immediate surgery for low-risk (or highly suspected) PTMC.ResultsThe mean patient age was 41.8 ± 10.3 years, with 41.7% and 4.4% of the patients aged <40 and ≥60 years, respectively. The median baseline diameter of index tumors was 4 (range, 3-6) mm, with 73.0% of the tumors being ≤5 mm. A total of 84.4% of the patients had a junior college, college, or graduate degree, and 83.5% were employed by the government, public institutions, companies, or technical posts. After a median 25-month follow-up, a tumor growth of ≥3 mm occurred in 3 patients (2.6%), and no new lymph node metastasis occurred. Surgery was performed in 4 patients because of patient preferences rather than because of disease progression. There was satisfactory adherence in 109 patients (94.8%) in a simulated ideal medical environment.ConclusionThe AS approach can be used as an alternative to low-risk PTMC management in China. Given the difference in epidemiologic and clinical characteristics, Chinese institutions should fully consider the features of the Chinese population while developing candidate criteria, surveillance intervals, and follow-up strategies for AS. 相似文献
14.
Irene Pellegrino Marco Cucco Johanna A. Harvey Federica Liberatore Marco Pavia Gary Voelker 《Bird Study》2017,64(3):344-352
Capsule: Common Swift Apus apus and Pallid Swift Apus Pallidus are morphologically very similar but are genetically distinct and diverged 1.9–2.1 million years ago (mya).Aims: To examine genetic differentiation and to estimate separation time between Common and Pallid Swifts.Methods: Estimation of differences in three different mitochondrial DNA markers (COI, ND2 and control region), and a fourth marker, the cytb, that did not differ between taxa. Fossils were used to calibrate the estimate of separation date between the two taxa.Results: The genetic between-species distances were 0.010, 0.006 and 0.033 for the three markers, respectively. These values were from three to ten times higher than within-species distances. Results show that the separation dates back to 1.9–2.1?mya, at the Plio-Pleistocene transition, when global climate underwent a period of significant cooling and Northern latitudes were probably more favourable to the Common than to the Pallid Swift.Conclusion: Differences in breeding biology, migration, moult and vocalizations between the two species are mirrored by a clear genetic separation. 相似文献
15.
《IRBM》2022,43(5):340-348
ObjectivesMild Cognitive Impairment (MCI) is the prodromal stage of Alzheimer's disease (AD), which is a progressive and fatal neurodegenerative disorder. Detection of MCI condition can enable early diagnosis resulting in timely intervention to delay the disease progression. Onset of MCI causes tissue alterations in Corpus Callosum (CC) of the brain. Texture analysis of brain Magnetic Resonance (MR) images aids in characterising these imperceptible changes. In this study, Kernel Density Estimation (KDE) technique is used to analyse the textural variations in CC to detect MCI condition.Materials and methodThe pre-processed brain MR images are obtained from a public access database. Reaction Diffusion level set is employed to segment CC from sagittal slices of the images. Kernel density estimation method is applied to study the local intensity variations within the segmented CC. Statistical features quantifying these variations are extracted from the KDE values. These features are used to differentiate MCI condition using linear classifiers based on discriminant analysis and support vector machine. The results are compared with conventional Grey Level Co-occurrence Matrix (GLCM) features for validation.ResultsThe KDE-based texture features extracted from CC show significant variation between normal and MCI classes. Results demonstrate that this approach can differentiate MCI condition with high accuracy and specificity of 81.3% and 82.7%, respectively. The KDE-based features perform better when compared with GLCM features for distinguishing MCI.ConclusionsThe KDE-based texture features are able to capture the subtle changes occurring in CC at the MCI stage. This technique achieves comparable performance to other state-of-the-art methods with reduced number of features. Efficiency of the KDE-based texture analysis confirms that the proposed computer assisted technique can be used for mass screening of MCI, which can aid in handling the disease severity. 相似文献
16.
BackgroundMutually increased risks for thyroid and breast cancer have been reported, but the contribution of etiologic factors versus increased medical surveillance to these associations is unknown.MethodsLeveraging large-scale US population-based cancer registry data, we used standardized incidence ratios (SIRs) to investigate the reciprocal risks of thyroid and breast cancers among adult females diagnosed with a first primary invasive, non-metastatic breast cancer (N = 652,627) or papillary thyroid cancer (PTC) (N = 92,318) during 2000–2017 who survived ≥1-year.ResultsPTC risk was increased 1.3-fold [N = 1434; SIR = 1.32; 95 % confidence interval (CI) = 1.25–1.39] after breast cancer compared to the general population. PTC risk declined significantly with time since breast cancer (Poisson regression = Ptrend <0.001) and was evident only for tumors ≤2 cm in size. The SIRs for PTC were higher after hormone-receptor (HR)+ (versus HR-) and stage II or III (versus stage 0-I) breast tumors. Breast cancer risk was increased 1.2-fold (N = 2038; SIR = 1.21; CI = 1.16–1.26) after PTC and was constant over time since PTC but was only increased for stage 0-II and HR + breast cancers.ConclusionAlthough some of the patterns by latency, stage and size are consistent with heightened surveillance contributing to the breast-thyroid association, we cannot exclude a role of shared etiology or treatment effects. 相似文献
17.
18.
《Steroids》2014
IntroductionIt has been hypothesized that racial disparities among several diseases are explained by differences in testosterone (T), 17-β estradiol (E), sex hormone binding globulin (SHBG) and albumin (A) levels, yet epidemiologic results have been mixed. Statistical advice regarding appropriate adjustment methods for carrier proteins of sex steroid hormones in the literature is scant. Therefore, we investigated different adjustment methods for carrier proteins.MethodsData for 1496 men, >17 years from the Third National Health and Nutrition Examination Survey (NHANES III) 1988–91 were used to analyze linearity between sex hormones and carrier proteins by examining correlation, plots, and regression models. The statistical importance of age, body mass index (BMI), and race/ethnicity were examined for changes in results by the adjustment method.ResultsT was weakly correlated with SHBG and A (r-squared, 0.25, 0.13, respectively) and E was weakly negatively correlated with A (p < 0.0001), but not SHBG (p < 0.1799). Based on the model residual plots and r-squared, the categorical model performed better than linear models. Regression coefficients for age, BMI, and race/ethnicity groups using quotient (e.g., T/A and E/A) models differed from continuous and categorical models.ConclusionChoosing an appropriate adjustment for carrier proteins is important to prevent bias in analyses and inconsistency in findings across studies. Linearity between variables should not be assumed when adjusting models, and should be conducted and reported. An independent categorical carrier protein variable is recommended in analysis exploring factors predicting sex hormone levels, although statistical testing should always be employed. 相似文献
19.
Summary The larval, megalopal and early juvenile stages of Pagurus granosimanus are described, illustrated and compared with other North Pacific species of the genus. Morphologically, the zoeae of P. granosimanus appear most similar to the Japanese P. brachiomastus in the majority of characters, but share the endopodal setation of the third maxilliped with a second Japanese species, P. pectinatus. The megalopae of P. granosimanus are unlike those of other North Pacific species in having 5+5 marginal setae on the telson, rather than the customary 4+4, or less frequent 3+3. Comparison of juvenile characters is limited to pleopodal changes among the regional species for which data are available. P. granosimanus is unusual in undergoing complete pleopodal loss at the second crab stage with return of left pleopods in the fourth stage. 相似文献
20.
《Biodemography and social biology》2013,59(3-4):259-275
Abstract Macroanalytic studies of the relationship of fertility and development have been applied in the past based mostly on cross‐sectional aggregate data from various countries. Because these countries belong to different models of the epidemiologic transition, variation in the dynamic relationship among these models should be allowed for. In this paper, various techniques (including linear and quadratic regression, a minimum‐maximum method of plotting the relationship, a special approach of stepwise regression) were applied to a data set from 85 countries. The crude birth rate was used as the dependent variable with several demographic, economic, social health, and family planning indicators as independent variables, measures over the period 1950–75. The results confirm the existence of submodels of countries with varying relationships between fertility and its correlates. The results disallow direct transferability of the experience of one group of countries (such as Europe) to another group belonging to another model (such as the less developed countries). The study also found the strength of the family planning effort to be a significant factor and one to be singled out as a major contributor in the fertility decline between 1965–75 in the developing countries. Its effect, however, stands to be enhanced in various degrees by concurrent social and economic development. 相似文献