Characterization of flavonoid 7-O-glucosyltransferase from Arabidopsis thaliana

Most flavonoids found in plants exist as glycosides, and glycosylation status has a wide range of effects on flavonoid solubility, stability, and bioavailability. Glycosylation of flavonoids is mediated by Family 1 glycosyltransferases (UGTs), which use UDP-sugars, such as UDP-glucose, as the glycosyl donor. AtGT-2, a UGT from Arabidopsis thaliana, was cloned and expressed in Escherichia coli as a gluthatione S-transferase fusion protein. Several compounds, including flavonoids, were tested as potential substrates. HPLC analysis of the reaction products indicated that AtGT-2 transfers a glucose molecule into several different kinds of flavonoids, eriodictyol being the most effective substrate, followed by luteolin, kaempferol, and quercetin. Based on comparison of HPLC retention times with authentic flavonoid 7-O-glucosides and nuclear magnetic resonance spectroscopy, the glycosylation position in the reacted flavonoids was determined to be the C-7 hydroxyl group. These results indicate that AtGT-2 encodes a flavonoid 7-O-glucosyltransferase.     

Characterization of an acyl-CoA synthetase from Arabidopsis thaliana

One of the major goals of modern plant biotechnology is to manipulate lipid metabolism in oilseed crops to produce new and improved edible and industrial vegetable oils. Lipids constitute the structural components of cellular membranes and act as sources of energy for the germinating seed and are therefore essential to plant cell function. Both de novo synthesis and modification of existing lipids are dependent on the activity of acyl-CoA synthetases (ACSs). To date, ACSs have been recalcitrant to traditional methods of purification due to their association with membranes. In our laboratory, several isoforms of ACSs have been identified in Arabidopsis thaliana. Reverse genetics allowed us to identify a mutant containing a transfer DNA-interrupted ACS gene. Results will be presented that describe the isolation and characterization of this mutant. The elucidation of the specific roles of ACSs will lead to a greater understanding of plant lipid metabolism.     

Characterization of a sulfurtransferase from Arabidopsis thaliana.

A database search for similarities between sequenced parts of the Arabidopsis thaliana genome with known sulfurtransferase sequences from Escherichia coli and mammals was undertaken to obtain information about plant sulfurtransferase-like proteins. One gene and several homologous EST clones were identified. One of the EST clones was used for screening an Arabidopsis cDNA library. The isolated full-length clone consists of 1134 bp and encodes a 42.6 kDa protein that includes a putative transit peptide sequence of about 7.1 kDa. Sequence comparisons with known sulfurtransferases from different organisms confirmed high homology between them and the existence of several highly conserved regions. Results of a Southern blot performed with genomic Arabidopsis DNA showed the occurrence of at least two sulfurtransferase-like isozymes in Arabidopsis. Recombinant proteins with and without the putative transit peptide were expressed in E. coli with an N-terminal His6-tag, purified by affinity chromatography and tested for enzyme activity using different sulfur donors and acceptors. Both recombinant proteins catalyzed the formation of SCN- from thiosulfate and cyanide as a rhodanese per definition; however, both recombinant proteins preferred 3-mercaptopyruvate to thiosulfate. A monospecific antibody produced by using the mature recombinant protein as an antigen recognized a single protein band in total extracts of Arabidopsis plants equating to the full-length protein size. A single band equating to the size of the mature protein was detected from purified Arabidopsis mitochondria, but there was no antigenic reaction with any protein from chloroplasts. The function of the protein is still speculative. Now tools are available to elucidate the roles and substrates of this sulfurtransferase in higher plants.     

Characterization of two sulfurtransferase isozymes from Arabidopsis thaliana.

Sulfurtransferases transfer a sulfane atom from a donor substrate to a thiophilic acceptor molecule. Recently a sulfurtransferase specific for the substrate 3-mercaptopyruvate was isolated from Arabidopsis thaliana [Papenbrock, J. & Schmidt, A. (2000) Eur. J. Biochem. 267, 145-154]. In this study a second sulfurtransferase from Arabidopsis was characterized and compared to the enzyme described previously. Sequences of the mature proteins had an identity of 77.7%. The plant sulfurtransferases formed a distinct group within the known eukaryotic sulfurtransferases. When Southern blots were hybridized with labelled cDNA fragments from each of the plant sulfurtransferases the same pattern of bands was obtained indicating the existence of only these two closely related sulfurtransferases. The new sulfurtransferase was expressed in Escherichia coli fused with an N-terminal His6-tag, purified and tested for enzyme activity. Like the first enzyme, the newly isolated protein preferred 3-mercaptopyruvate to thiosulfate as substrate. The Km of both enzymes determined for 3-mercaptopyruvate and cyanide were almost identical. As a result of database searches it became obvious that sulfurtransferase proteins from higher plants showed high similarities to small senescence- and stress-induced proteins. To prove the involvement of sulfurtransferases in senescence-associated processes 3-mercaptopyruvate sulfurtransferase activity was determined in crude protein extracts from Arabidopsis plants of different ages. 3-mercaptopyruvate sulfurtransferase activity and steady-state RNA levels of sulfurtransferases increased with increasing age. However, steady-state protein levels as measured by using an antibody against the sulfurtransferase protein expressed previously decreased. Putative roles of sulfurtransferases in senescence-associated processes are discussed.     

ROS Scavenging and $${\text{NH}}_{4}^{ + }$$ Nitrogen Fertilizer Roles in Alleviation of Cd-Induced Oxidative Stress in Arabidopsis thaliana

Russian Journal of Plant Physiology - Arabidopsis thaliana (L.) Heynh. receiving ammonium, were transferred on modified Hoagland nutrient solution containing Cd (25 µM) alone or supplemented...     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Purification and characterization of {delta}-aminolevulinic acid dehydratase from Chlorella regularis

-Aminolevulinic acid dehydratase (-aminolevulinic acid hydrolyaseEC 4.2.1.24 [EC] ) which catalyzes the formation ofporphobilinogenfrom two molecules of -aminolevulinic acid (ALA) was purifiedfrom Chlorella regularis 737-fold by acetone and ammonium sulfatefractionations, DEAE-cellulose column chromatography, and SephadexG-200 gel filtration. The enzyme had an optimum pH of 8.5 inTris-HCl buffer and required either Mg²⁺ or Mn²⁺ for its maximumactivity. The Km values for Mg²⁺, Mn²⁺ and ALA were 15 µM,10µM, and 0.5 mM, respectively. The enzyme was not activatedby thiol compounds, but was inhibited by p-chloromercuribenzoate.The molecular weight estimated by gel filtration was 316,000and the isoelectric point was 5.25. (Received October 18, 1978; )     

Purification and Characterization of an Antifungal Chitinase from Arabidopsis thaliana

Plants exhibit an altered pattern of protein synthesis in response to pathogen invasion and abiotic stress. One of these `pathogenesis-related' proteins has been identified as chitinase, which is capable of inhibiting fungal growth in vitro. This observation has led to the suggestion that the in vivo role of chitinases is to protect plants against fungal invasion. Here, we report the purification and characterization of a basic chitinase from Arabidopsis thaliana (L.) Heynh. Columbia wild type. The purified enzyme has a molecular mass of approximately 32 kilodaltons as determined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate, and an apparent pl of approximately 8.7 as determined by isoelectric focusing. The purified protein is an effective inhibitor of the growth of Trichoderma reesei in vitro but does not affect the growth of several other fungi. Amino acid composition analysis of the intact protein as well as amino acid composition analysis and automatic Edman degradation of isolated tryptic fragments of the enzyme indicate that it may be identical to the product of a chitinase gene isolated from an Arabidopsis genomic library (Samac DA, Hironaka CM, Yallaly PE, Shah DM [1990] Plant Physiol 93: 907-914).     

Purification and properties of {delta}-aminolevulinic acid dehydratase from radish cotyledons

-Aminolevulinic acid dehydratase (5-aminolevulinate hydro-lyase,EC 4.2.1.24 [EC] ) was purified from greening radish cotyledons. Thefinal product was homogeneous on polyacrylamide disc gel electrophoresisand had a molecular weight, estimated by gel filtration, of282,000 daltons. The enzyme seems to require magnesium ion aswell as sulfhydryl compounds for maximum activity. EDTA anda low concentration of zinc ion markedly inhibited the activity.The optimum pH was 8.0; the Km value for -aminolevulinic acidwas 3.85?10^–4M. Levulinic acid was a competitive inhibitorof the enzyme, with a Ki of 2.14?10^–4M. These propertieswere compared with those of microorganism and animal -aminolevulinicacid dehydratases. (Received November 22, 1976; )     

Characterization of the genome of Arabidopsis thaliana

The small crucifer Arabidopsis thaliana has many useful features as an experimental organism for the study of plant molecular biology. It has a four-week life-cycle, only five chromosomes and a genome size less than half that of Drosophila. To characterize the DNA sequence organization of this plant, we have randomly selected 50 recombinant lambda clones containing inserts with an average length of 12,800 base-pairs and analyzed their content of repetitive and unique DNA by various genome blot, restriction digestion and RNA blot procedures. The following conclusions can be drawn. The DNA represented in this random sample is composed predominantly of single-copy sequences. This presumably reflects the organization of the Arabidopsis genome as a whole and supports prior conclusions reached on the basis of kinetics of DNA reassociation. The DNA that encodes the ribosomal RNAs constitutes the only major class of cloned nuclear repetitive DNA. It consists of approximately 570 tandem copies of a heterogeneous 9900-base-pair repeat unit. There is an average of approximately 660 copies of the chloroplast genome per cell. Therefore, the chloroplast genome constitutes the major component of the repetitive sequences found in A. thaliana DNA made from whole plants. The inner cytosine residue in the sequence C-C-G-G is methylated more often than the outer in the tandem ribosomal DNA units, whereas very few differences in the methylation state of these two cytosine residues are detected in unique sequences.     

{delta}15N and {delta}13C Measurements of Antarctic Peninsula Fauna: Trophic Relationships and Assimilation of Benthic Seaweeds

Measurements of ¹³C, ¹⁵N, and C/N for a variety of Antarcticpeninsula fauna and flora were used to quantify the importanceof benthic brown algae to resident organisms and determine foodweb relationships among this diverse littoral fauna. ¹³C valuesranged from–16.8 for benthic algal herbivores (limpets)to –29.8 for the krill, Euphausia superba; the averagepooled value for brown macroalgae, including their attachedfilamentous diatoms, was–20.6. There was no correlationbetween biomass ¹³C or ¹⁵N with C/N content, and consequentlyboth ¹³C and ¹⁵N values were useful in evaluating trophic relationships.¹⁵N values of the fauna ranged from 3.1 to 12.5, with lowestvalues recorded in suspension feeders (e.g., bryozoans) andhighest values in Adelie penguins (12.5) collected in 1989.The comparatively lower ¹⁵N value for a Chinstrap penguin (6.9)collected in 1997 is attributed to the different dietary foodsources consumed by these species as reflected in their respective¹³C values. Significant amounts of benthic macroalgal carbonis incorporated into the tissues of invertebrates and fishesthat occupy up to four trophic levels. For many benthic andepibenthic species, including various crustaceans and molluscs,assimilation of benthic algal carbon through detrital pathwaysranges from 30 to 100%. Consequently, the trophic importanceof benthic brown algae may well extend to many pelagic organismsthat are key prey species for birds, fishes, and marine mammals.These data support the hypothesis that benthic seaweeeds, togetherwith their associated epiphytic diatoms, provide an importantcarbon source that is readily incorporated into Antarctic peninsulafood webs.     

Characterization of two Arabidopsis thaliana glutathione S-transferases

Glutathione S-transferases (GST) are multifunctional proteins encoded by a large gene family, divided on the basis of sequence identity into phi, tau, theta, zeta and lambda classes. The phi and tau classes are present only in plants. GSTs appear to be ubiquitous in plants and are involved in herbicide detoxification and stress response, but little is known about the precise role of GSTs in normal plant physiology and during biotic and abiotic stress response. Two cDNAs representing the two plant classes tau and phi, AtGSTF9 and AtGSTU26, were expressed in vitro and the corresponding proteins were analysed. Both GSTs were able to catalyse a glutathione conjugation to 1-chloro-2,4-dinitrobenzene (CDNB), but they were inactive as transferases towards p-nitrobenzylchloride (pNBC). AtGSTF9 showed activity towards benzyl isothiocyanate (BITC) and an activity as glutathione peroxidase with cumene hydroperoxide (CumHPO). AtGSTU26 was not active as glutathione peroxidase and towards BITC. RT-PCR analysis was used to evaluate the expression of the two genes in response to treatment with herbicides and safeners, chemicals, low and high temperature. Our results reveal that AtGSTU26 is induced by the chloroacetanilide herbicides alachlor and metolachlor and the safener benoxacor, and after exposure to low temperatures. In contrast, AtGSTF9 seems not to be influenced by the treatments employed.     

Molecular Cloning and Characterization of a Calmodulin Gene from Arabidopsis thaliana

The calcium binding protein, calmodulin Is involved in regulating various cellular and biochemical processes. A gene tor calmodulin (CaM) has been Isolated from a genomic library of Arabidopsis thaliana constructed in ; EMBL-4 using a heterologous cDNA probe from electric eel. One of the positive clones was characterized and the region containing the calmodulin gene sequences was Identified, excised using appropriate restriction enzymes and subcloned Into a plasmid vector. The genomic clone contains a complete copy of the calmodulin gene. A comparison of the nucleotide sequence of the part of the clone with those of the other plant and animal systems confirms that the clone In fact contains the calmodulin gene sequences. Southern hybridization ulling the calmodulin gene sequences as a probe reveals the presence of more than one copy of the calmodulin gene. The results of this investigation taken together with those Iff the other. indicate that the calmodulin gene belongs to a small mutigene family consisting of atieast four member. In the Arabidopsis genome.