Chloroplast DNA base substitutions: an experimental assessment

An experimental assessment was carried out to determine directly the frequency and types of spontaneous base substitutions that occur in chloroplast DNA. A target site within the chloroplast 16S rRNA gene of the green alga Chlamydomonas reinhardtii was chosen for the assay. Mutations at this site were known to confer spectinomycin resistance and simultaneously result in the loss of an AatII cleavage site. In the experiments reported here, base substitutions at any individual base occurred at a frequency in the range of 0.9–11 per 10⁹ viable cells plated. Four new mutations that confer resistance to spectinomycin were identified at the target site in the Chlamydomonas chloroplast 16S rRNA gene. When the relative rates of transition and transversion mutations were quantified, a bias toward transversions was observed. The prominence of A/T C/G transversions in the observed mutation spectrum suggests that oxidative damage may be the major cause of base substitution mutations within the chloroplast.     

Evidence for a composite phylogenetic origin of the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm

The nucleotide sequence and the 5 flanking region of the rbcL gene coding for the large subunit of ribulose bisphosphate-1,5-carboxylase/oxygenase of Pylaiella littoralis, a brown alga, has been determined and the deduced amino-acid sequence has been compared to those of various photosynthetic and chemoautotrophic Eubacteria, of a red alga and of green plastids (Euglena gracilis, green algae and higher plants). Unlike the rbcL genes of green plastids which are more closely related to those of cyanobacteria the P. littoralis rbcL gene is more closely related to that of a -purple bacterium, as was found for the rbcS gene of another chromophytic alga [Boczar et al., Proc Natl Acad Sci USA 86: 4996–4999, 1989]. Matrix data of homology between the rbcL gene of P. littoralis and the same gene of other organisms are presented. Based on our previous report, the gene coding for the 16S rRNA from P. littoralis is closely related to that of E. gracilis (Markowicz et al., Curr Genet 14: 599–608, 1988). We suggest that the large plastid DNA molecule of P. littoralis is a phylogenetically composite genome which probably resulted from mixed endosymbiosis events, or from a horizontal transfer of DNA.     

An analysis of replication errors made by a defective T4 DNA polymerase

Summary An amber mutant in the head protein of bacteriophage T4D, amH36 has been induced to revert by a mutator, tsL56 in gene 43 (the structural gene for DNA polymerase, de Waard, Paul and Lehman, 1965) which is known to cause errors in replication. As a consequence the known am base triplet is converted to other triplets which assign certain amino acids. The nature of the replication errors has been analyzed by looking at the insertion of amino acids in a peptide from the head protein of 60 independent am ⁺ revertants. Of these, 38 had incorporated tyrosine (like spontaneous revertants also do) while in 21 cases glutamine was inserted and in one case glutamic acid. With the help of the codon catalogue it could be shown that the L56 polymerase promotes an A:TG:C transition as well as more than one type of transversion. The single revertant which had incorporated glutamic acid clearly represents an A:TC:G transversion. The other transversions leading to the insertion of tyrosine indicate that a C:G pair has been converted. In this case the degeneracy of the code does not allow to differentiate between the transversion C:GG:C and C:GA:T. These findings and the absence of certain amino acids as permissible substituents are discussed with regard to the specificity of the errors in replication made by L56 polymerase.     

Analysis of spontaneous base substitutions generated in mutator strains of Bacillus subtilis

In the current studies, we investigated base substitutions in the Bacillus subtilis mutT, mutM, and mutY DNA error-prevention system. In the wild type strain, spontaneous mutations were mainly transitions, either G:C --> A:T or A:T --> G:C. Although both transitions and transversions were observed in mutY and mutM mutants, mutM/mutY double mutants contain strictly G:C --> T:A transversions. In the mutT strain, A:T --> C:G transversion was not observed, and over-expression of the B. subtilis mutT gene had no effect on the mutation rate in the Escherichia coli mutT strain. Using 8-oxo-dGTP-induced mutagenesis, transitions especially A:T --> G:C were predominant in the wild type and mutY strains. In contrary, transversion was high on mutY and double mutant (mutM mutY). Finally, the opuBC and yitG genes were identified from the B. subtilis chromosome as mutator genes that prevented the transition base substitutions.     

Sister chromatid exchanges in garlic (Allium sativum L.) callus cells

A technique is described for differential staining of sister chromatids and the study of sister chromatid exchanges (SCEs) in garlic (Allium sativum L.) callus cells. BrdU incorporation into newly synthesized DNA was ensured by culturing calli on medium containing 100 M BrdU+0.01 M FudR+1 M Urd. SCEs were visualized by FPG staining technique and their frequency was analysed. Mean frequency of SCEs in callus cells was higher than that in meristem root-tip cells. Using the same staining method, cell cycle time of callus cells was analysed. It was found that it ranges from 48 to 132 hrs. The method described represents a new approach in the study of genetic instability of plant cells cultured in vitro.Abbreviations BrdU 5-bromo-2-deoxyuridine - 2,4-D 2,4-dichlorophenoxyacetic acid - FPG fluorescent-plus-Giemsa - FudR 5-fluoro-2-deoxyuridine - SCE sister chromatid exchange - SSC 0.15 M NaCl + 0.015 M Na-citrate - T thymidine-containing strand of the DNA duplex - B 5-bromo-2-deoxyuridine-containing strand of the DNA duplex - Urd uridine     

Transient gene expression in electroporated Picea glauca protoplasts

The reporter gene for chloramphenicol acetyltransferase (CAT) was introduced into white spruce (Picea glauca (Moench) Voss.) protoplasts by electroporation. CAT transient gene expression was increased by increasing the concentration of pCaMVCN plasmid and was affected by the level of the applied voltage. Highest CAT activities were obtained after electroporation with a pulse of 350V.cm^–1 having an exponential decay constant of approximately 105ms. Linearized plasmid constructs gave much higher levels of CAT activity than circular plasmid. Attempts to use the Escherichia coli -glucuronidase gene (-GUS) as a marker gene revealed very high levels of -GUS-like activity in electroporated protoplasts. This activity was mainly due to a small molecule and may mask successful transformation since -GUS-like activity increased when plasmid DNA was present during electroporation.Abbreviations CAT chloramphenicol acetyltransferase - -GUS -glucuronidase - MUG 4-methyl umbelliferyl glucuronide - F microfarads NRCC No. 29150     

Mutational specificity of ethyl methanesulfonate in excision-repair-proficient and -deficient strains of Drosophila melanogaster

Summary The vermilion gene was used as a target to determine the mutational specificity of ethyl methanesulfonate (EMS) in germ cells of Drosophila melanogaster. To study the impact of DNA repair on the type of mutations induced, both excision-repair-proficient (exr ⁺) and excision-repair-deficient (exr ^–) strains were used for the isolation of mutant flies. In all, 28 mutants from the exr ⁺ strain and 24 from the exr ^– strain, were characterized by sequence analysis. In two mutants obtained from the exr ⁺ strain, small deletions were observed. All other mutations were caused by single base-pair changes. In two mutants double base-pair substitutions had occurred. Of the mutations induced in the exr ⁺ strain, 22 (76%) were GCAT transitions, 3 (10%) ATTA transversions, 2 (6%) GCTA transversions and 2 (6%) were deletions. As in other systems, the mutation spectrum of EMS in Drosophila is dominated by GCAT transitions. Of the mutations in an exr ^– background, 12 (48%) were GCAT transitions, 7 (28%) ATTA transversions, 5 (20%) GCTA transversions and 1 (4%) was a ATGC transition. The significant increase in the contribution of transversion mutations obtained in the absence of an active maternal excision-repair mechanism, clearly indicates efficient repair of N-alkyl adducts (7-ethyl guanine and 3-ethyl adenine) by the excision-repair system in Drosophila germ cells.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Mutational specificity of a conditional Escherichia coli mutator, mutD5

Summary MutD5, a conditional mutator in Escherichia coli, causes the stimulation of mutation frequencies 50 to 100 fold in minimal medium. In rich medium mutation frequencies are further increased 50 to 100 fold. We show here that all possible base-pair mutations are increased in a mutD5 strain grown in rich medium. A:TG:C transitions as well as A:TC:G, A:TT:A aud G:CC:G transversions are stimulated. Transitions occur more frequently than transversions. MutD5 also increases the reversion frequencies of three trpA frameshift mutations by causing base-pair additions, and, possibly, base-pair deletions.     

Mouse T-cell receptor variable gene segment families

All mouse T-cell receptor /, , and variable (Tcra/d, b-, and g-V) gene segments were aligned to compare the sequences with one another, to group them into subfamilies, and to derive a name which complies with the standard nomenclature. It was necessary to change the names of some V gene segments because they conflicted with those of other segments. The traditional classification into subfamilies was re-evaluated using a much larger pool of sequences. In the mouse, most V gene segments can be grouped into subfamilies of closely related genes with significantly less similarity between different subfamilies.The alignment data reported in this paper have been submitted to the EMBL nucleotide sequence database and have been assigned the alignment number DS23485. The data are available by the EBI FTP server and file serverCorrespondence with corrections or new information concerning the TCRV sequences is strongly encouraged.     

Mutation spectra of N-ethyl-N''-nitro-N-nitrosoguanidine and 1-(2-hydroxyethyl)-1-nitrosourea in Escherichia coli

Summary DNA sequencing was used to determine the specific types of DNA base changes induced following in vivo exposure of Escherichia coli to the ethylating agent N-ethyl-N-nitro-N-nitrosoguanidine (ENNG) and the hydroxyethylating agent 1-(2-hydroxyethyl)-1-nitrosourea (HENU) using the xanthine guanine phosphoribosyltransferase (gpt) gene as the genetic target. We observed that 22/30 of the ENNG-induced mutations were GCAT transitions, 4/30 were ATGC transitions, 3/30 were ATTA transversions, and 1/30 was an ATCG transversion. We observed that 37/40 HENU-induced mutations were GCAT transitions and that the remaining 3/40 were ATGC transitions. A majority of the GCAT transitions induced by ENNG and HENU (68% and 73%, respectively) occurred at the second guanine of the sequence 5-GG(A or T)-3; this sequence specificity was similar to that previously seen with the alkylating agents N-methyl- and N-ethyl-N-nitrosourea (MNU and ENU) and N-methyl-N-nitro-N-nitrosoguanidine (MNNG). A DNA strand preference for the GA changes (antisense strand), previously noted for MNU, ENU, and MNNG, was observed following exposure to HENU and ENNG. The ATGC transitions induced by ENNG, HENU, and ENU also exhibit a sequence specificity with 13/13 mutations occurring at the T of the sequence 5-NTC-3. A strand preference was not apparent for these mutations.     

Specificity of recA441-mediated (tif-1) mutational events.

Summary To investigate the impact of SOS induction on the distribution of spontaneous mutation, 111 recA441-mediated mutations were characterized at the DNA sequence level in the lacI gene of Escherichia coli. A 2.6-fold enhancement in lacI ^– mutation frequency was observed after induction of the SOS system in the absence of mutagenic treatment, and specific classes of mutational events were induced. G : C C : G, G : C T : A and A : T T : A transversion events were specifically enhanced after SOS induction. A preferential 5-Y-Purine-3 neighbouring base specificity for these transversion events is reported here (normalised for mutation of the purine residue). In addition, a preference for transversion events at 5-C/GTGG-3 sequences is also observed. Fifty events were recovered at the lacI frameshift hotspot site and were equally represented by 4 bp addition and deletion events. This 1:1 ratio deviates significantly from the 4:1 distribution characteristic of spontaneous frameshift mutation in the RecA⁺ background and is a consequence of the fourfold induction of the (–)4 event. This abberrant distribution was confirmed by oligomeric probing of 474 independent recA441-mediated spontaneous lacI ^– mutations.     

Intralineage variation in the pattern ofrbcL nucleotide substitution

Variation in chloroplastrbcL sequences was studied in representative species of four different lineages: the tribeRubieae (Rubiaceae), and the generaDrosera (Droseraceae),Nothofagus (Nothofagaceae) andIlex (Aquifoliaceae). Each lineage has its particular non-overlapping set ofrbcL polymorphic sites, indicating that common unconstrainedrbcL sites are not shared. Large differences in the rate and pattern of nucleotide substitution are observed among the four lineages. The genusIlex has the lowest rate of substitution, the lowest transition/transversion ratio, the lowest synonymous/replacement ratio and the lowest number of substitutions at the third codon position. An apparent relationship of these measures to the age of the lineages is observed. The A + T content and codon use among the four lineages are very similar and, apparently, cannot account for the observed differences in patterns of nucleotide substitution. However, the A + T content of the two bases immediately flanking the polymorphic sites is higher inIlex than in the other lineages. This could be correlated with the transversion/transition bias observed inIlex. The particularly low synonymous/replacement ratio found inIlex could also be explained by the small population sizes of species in this genus.     

Sorting of precursor proteins between isolated spinach leaf mitochondria and chloroplasts

The precursors of the F₁-ATPase -subunits fromNicotiana plumbaginifolia andNeurospora crassa were imported into isolated spinach (Spinacia oleracea L.) leaf mitochondria. Both F₁ precursors were imported and processed to mature size products. No import of the mitochondrial precursor proteins into isolated intact spinach chloroplasts was seen. Moreover, the precursor of the 33 kDa protein of photosynthetic water-splitting enzyme was not imported into the leaf mitochondria. This study provides the first experimental report ofin vitro import of precursor proteins into plant mitochondria isolated from photosynthetic tissue and enables studies of protein sorting between mitochondria and chloroplasts in a system which is homologous with respect to organelles. The results suggest a high organellar specificity in the plant cell for the cytoplasmically synthesized precursor proteins.     

Construction of a Synechocystic PCC6803 mutant suitable for the study of variant hexadecameric ribulose bisphosphate carboxylase/oxygenase enzymes

The cyanobacterium Synechocystis PCC6803 was chosen as a target organism for construction of a suitable photosynthetic host to enable selection of variant plant-like ribulose bisphosphate carboxylase/oxygenase (Rubisco) enzymes. The DNA region containing the operon encoding Rubisco (rbc) was cloned, sequenced and used for the construction of a transformation vector bearing flanking sequences to the rbc genes. This vector was utilized for the construction of a cyanobacterial rbc null mutant in which the entire sequence comprising both rbc genes, was replaced by the Rhodospirillum rubrum rbcL gene linked to a chloramphenicol resistance gene. Chloramphenicol-resistant colonies, Syn6803rbc, were detected within 8 days when grown under 5% CO₂ in air. These transformants were unable to grow in air (0.03% CO₂). Analysis of their genome and Rubisco protein confirmed the site of the mutation at the rbc locus, and indicated that the mutation had segregated throughout all of the chromosome copies, consequently producing only the bacterial type of the enzyme. In addition, no carboxysome structures could be detected in the new mutant. Successful restoration of the wild-type rbc locus, using vectors bearing the rbc operon flanked by additional sequences at both termini, could only be achieved upon incubating the transformed cells under 5% CO₂ in air prior to their transferring to air. The yield of restored transformants was proportionally related to the length of those sequences flanking the rbc operon which participate in the homologous recombination. The Syn6803rbc mutant is amenable for the introduction of in vitro mutagenized rbc genes into the rbc locus, aiming at the genetic modification of the hexadecameric type Rubisco.Abbreviations Cm^r chloramphenicol resistance - Km^r kanamycin resistance - HCR high CO₂ requirer - Rubisco ribulose 1,5-bisphosphate carboxylase/oxygenase - SSC sodium chloride and sodium citrate - wt wild-type     

DNA sequence analysis of spontaneous and γ-radiation (anoxic)-induced lacI mutations in Escherichia coliumuC122::Tn5: differential requirement for umuC at G · C vs. A · T sites and for the production of transversions vs. transitions

Escherihica coliumC122::Tn5 cells were γ-radiated (¹³⁷Cs, 750 Gy, under N₂), and lac-constitutive mutants were produced at 36% of the wild-type level (the umC strain was not deficient in spontaneous mutagenesis, and the mutational spectrum determined by sequencing 263 spontaneous lacI^d mutations was very similar to that for the wild-type strain). The specific nature of the umC strain's partial radiation was determined by sequencing 325 radiation-induced lacI^d mutations. The yields of radiation-induced mutation classes in the umC strain (as a percentage of the wild-type yield) were: 80% for A · T → G · C transitions, 70% for multi-base additions, 60% for single-base deletions, 53% for A · T → C · G transversions, 36% for G · C → A · T transitions, 25% for multi-base deletions, 21% for A · T → T · A transversions, 11% for G · C → C · G transversions, 9% for G · C → T · A transversions and 0% for multiple mutations. Based on these deficiencies and other factors, it is concluded that the umC strain is near-normal for A · T → G · C transitions, single-base deletions and possibly A · T → C · G transversions; is generally deficient for mutagenesis at G · C sites fro transversions, and is grossly deficient in multiple mutations. Damage at G · C sites seems more difficult for translesion DNA synthesis to bypass than damage at A · T sites, and especially when trying to produced a transversion. The yield of G · C → A · T transitions in the umC strain *36% of the wild-type level) argues that a basic sites are involved in no more than 64% of γ-radiation-induced base substitutions in the wild-type strain. Altogether, these data suggest that the UmuC and UmuD′ proteins facilitate, rather than being absolutely required for, translesion DNA synthesis; with the degree of facilitation being dependent both on the nature of the noncoding DNA damage, i.e., at G · C vs A · T sites, and on the nature of the misincorporated base, i.e., whether it induces transversions or transitions.     

Intragenic localization of chain-terminating triplets arising by transitions and transversions

Mutational changes involving transitions can convert only one sense codon to ochre, two codons to amber, and two codons to UGA. One codon, UGG for tryptophan, can be converted by transitions to either amber or UGA. By transversion changes 15 other codons can be converted to ochre and/or amber and/or UGA. Ten amino acids can never be replaced by chain termination as a result of transition and transversion mutagenesis of single base-pairs. For two systems (bacteriophage T4 lysozyme and Escherichia coli K12 tryptophan synthetase A protein) in which the poly-peptide gene product has been completely sequenced one can construct predictive intra-genic distribution maps for the location of all possible chain-terminating mutations arising as a result of transitions and transversions.     

Mutational specificity of the base analogue, 2-aminopurine,in Escheichica coli

2-Aminopurine (2-AP) is a base analogue of adenine which mispairs with cytosine and causes base-pair substitutions of the transition type. By analyzing the reversion patterns of defined trpA alleles in Escheriachia coli we confirm that 2-AP cuases both A:T → G:C and G:C → A:T transitions whith the former induced more frequently than the latter. We also find that 2-AP enhances transversion at 3 sites and frameshift mutations at 1 other site. It is unlikely that 2-AP can cause transversions and frameshifts solely by a mispairing mechanism. However, 2-AP-induced transversion and frameshift mutagenesis was not abolished by the presence of an inactive recA allele, indicating this mutagenic activity is not dependent upon recA-directed misrepair.     

Oligonucleotide directed mutagenesis: Selection of mutants by hemimethylation of GATC-sequences

Summary We have developed a selection procedure for mutants obtained by oligonucleotide directed mutagenesis based on asymmetrical A-methylation of GATC-sequences in the duplex DNA. The method involves the construction of gapped duplexes of circular single-stranded phage DNA. An oligonucleotide, complementary to part of the gap except for a single mismatch, is hybridized to the gapped duplex DNA and the remaining single stranded regions are filled-in enzymatically. When the template is undermethylated, the yield of mutants is almost, solely dependent on the priming efficiency of the oligonucleotide. The approach was used to introduce an ATCG transversion in the nut L region of phage . Under optimal conditions, about 50–60% of the transformants were of the mutant genotype. Although situated adjacent to a known nut L mutation, the present mutation was phenotypically silent. The possibility of screening for mutants by means of a coupled, easily detectable marker was also investigated.Abbreviations bp base pairs - RF replicative form - ssDNA single stranded DNA - Ap gene carbenicillin resistance gene - EtBr ethidium bromide - O.D. optical density - Kb kilobases - P_L major leftward promoter of phage