Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Resolution of undistorted symmetric immobile DNA junctions by vaccinia topoisomerase I

Holliday junctions are intermediates in genetic recombination. They consist of four strands of DNA that flank a branch point. In natural systems, their sequences have 2-fold (homologous) sequence symmetry. This symmetry enables the molecules to undergo an isomerization, known as branch migration, that relocates the site of the branch point. Branch migration leads to polydispersity, which makes it difficult to characterize the physical properties of the junction and the effects of the sequence context flanking the branch point. Previous studies have reported two symmetric junctions that do not branch migrate: one that is immobilized by coupling to an asymmetric junction in a double crossover context, and a second that is based on molecules containing 5',5' and 3',3' linkages. Both are flawed by distorting the structure of the symmetric junction from its natural conformation. Here, we report an undistorted symmetric immobile junction based on the use of DNA parallelogram structures. We have used a series of these junctions to characterize the junction resolution reaction catalyzed by vaccinia virus DNA topoisomerase. The resolution reaction entails cleavage and rejoining at CCCTT/N recognition sites arrayed on opposing sides of the four-arm junction. We find that resolution is optimal when the scissile phosphodiester (Tp/N) is located two nucleotides 5' to the branch point on the helical strand. Covalent topoisomerase-DNA adducts are precursors to recombinant strands in all reactions, as expected. Kinetic analysis suggests a rate limiting step after the first-strand cleavage.     

Molecular cloning and sequence of the concatemer junction from vaccinia virus replicative DNA. Viral nuclease cleavage sites in cruciform structures

The concatemer junction from replicative forms of vaccinia virus DNA was cloned into plasmid vectors and shown to be a precise duplex copy of the viral terminal hairpin structure, with each strand corresponding to one of the alternative sequence isomers. The plasmids were relaxed circles with extruded cruciforms representing two copies of the vaccinia telomere hairpin structure. Head-to-head dimers containing two copies of the vaccinia virus concatemer junction were observed to contain only one set of stem-loop structures per molecule, suggesting that the initial formation of a small cruciform, and not branch migration, was the rate-limiting step in cruciform formation. The plasmids containing the concatemer junction were converted into nicked circular, linear and cross-linked linear molecules by a nuclease isolated from vaccinia virions. The region-specific cleavage near the border of the hairpin loop and the formation of DNA cross-links in some of the molecules is consistent with the nuclease acting as a nicking-closing enzyme that participates in the resolution of mature termini from replicative concatemer intermediates.     

Restriction enzyme mapping of vaccinia virus DNA.

The cleavage sites for the restriction enzymes Bg/I, HindIII, KpnI, SalI, SmaI, and XhoI were located, from primary data, on the DNA isolated from the WR strain of vaccinia virus. Bg/I and SmaI divide the DNA into five segments which can be isolated by sucrose gradient centrifugation. These large segments provide a convenient means to group segments produced by other enzymes. The construction of physical maps was initiated by identifying the segments at each end of the DNA and then finding segments which were adjacent to these terminal sections. This was accomplished by isolating large shear fragments which contained the covalently linked termini of the DNA. Most of the data needed to derive the maps were obtained by isolating segments produce by one enzyme and then cleaving these individual segments with a second enzyme.     

Molecular-biological study of vaccinia virus genome. I. Cloning of vaccinia virus DNA fragments in bacterial vectors

The HindIII DNA fragments of vaccinia virus strain L-IVP were cloned in pBR322 bacterial plasmid. A hybrid plasmids collection of pVHn series contains all fragments of virus genome except terminal HindIII-B and HindIII-G, and also a large HindIII-A. The latter was cloned in cosmid pHC79. The obtained collection of hybrid DNA molecules allows to carry out a wide range of molecular biological experiments on the vaccinia virus genome.     

Conditional growth of Escherichia coli caused by expression of vaccinia virus DNA topoisomerase I.

Active vaccinia virus topoisomerase I is expressed in Escherichia coli containing plasmid p1940 (S. Shuman, M. Golder, and B. Moss, J. Biol. Chem. 263:16401-16407, 1988). Growth curves showed a decline of 2 to 3 logs in the number of viable cells at 42 degrees C after shift from 30 degrees C because of increased vaccinia virus topoisomerase I level. Mutations in the gyrA and gyrB genes allowed cells to grow equally well at 42 and 30 degrees C. The presence of gyrase inhibitor also improved growth at 42 degrees C.     

Evidence of a repetitive sequence in vaccinia virus DNA.

Analysis of vaccinia DNA by reassociation kinetics revealed that 7% of the genome contains a sequence repeated 10 times. This sequence does not contain any host cell DNA, is viral specific, and is found in virions passed at either high or low multiplicities of infection.     

Procedure for purification of intact DNA from vaccinia virus.

A procedure for the isolation of intact vaccinia DNA molecules by chromatography on hydroxyapatite in the presence of 6 M urea is described. When lysates of virions containing 0.5 to 10 microgram of DNA were employed, over 95% of the viral DNA could be recovered free of poteins. Vaccinia DNA molecules isolated in this manner sedimented at 68S in neutral sucrose gradients and had an average contour length of 62.3 micrometer when examined in an electron microscope, and the DNA could be cleaved with the restriction endonuclease EcoRI and BamHI. The results of these analyses showed that intact vaccinia DNA molecules of 120 X 10(6) to 130 X 10(6) molecular weight could be obtained by the procedures described.     

High expression of functional adenovirus DNA polymerase and precursor terminal protein using recombinant vaccinia virus.

Initiation of Adenovirus (Ad) DNA replication occurs by a protein-priming mechanism in which the viral precursor terminal protein (pTP) and DNA polymerase (pol) as well as two nuclear DNA-binding proteins from uninfected HeLa cells are required. Biochemical studies on the pTP and DNA polymerase proteins separately have been hampered due to their low abundance and their presence as a pTP-pol complex in Ad infected cells. We have constructed a genomic sequence containing the large open reading frame from the Ad5 pol gene to which 9 basepairs from a putative exon were ligated. When inserted behind a modified late promoter of vaccinia virus the resulting recombinant virus produced enzymatically active 140 kDa Ad DNA polymerase. The same strategy was applied to express the 80 kDa pTP gene in a functional form. Both proteins were overexpressed at least 30-fold compared to extracts from Adenovirus infected cells and, when combined, were fully active for initiation in an in vitro Adenovirus DNA replication system.     

Resolution of a Holliday junction by vaccinia topoisomerase requires a spacer DNA segment 3' of the CCCTT/ cleavage sites

Vaccinia virus DNA topoisomerase catalyzes reso­lution of synthetic Holliday junctions in vitro. The mechanism entails concerted transesterifications at two recognition sites, 5′-CCCTT↓, that are opposed within a partially mobile four-way junction. Efficient resolution occurs on a junction with a 10 bp segment of branch mobility (5′-GCCCTTATCG) that extends 4 bp 3′ of the scissile phosphate. Here we report that resolution is decreased when branch mobility is limited to an 8 bp segment extending 2 bp 3′ of the cleavage site and then eliminated when branch mobility is confined to the 6 bp GCCCTT sequence 5′ of the scissile phosphate. We surmise that a spacer region 3′ of CCCTT is needed for simultaneous cleavage at two opposing sites at the junction. Branch mobility is not required for reaction chem­i­stry at a junction, because topoisomerase cleaves a single CCCTT site in a non-mobile four-way junction where the scissile phosphate is at the crossover point. The junction resolvase activity of topo­isomerase may be involved in forming the hairpin telomeres of the vaccinia genome.     

A vaccinia virus DNase preparation which cross-links superhelical DNA.

Multiple DNA-dependent enzyme activities have been detected in highly purified preparations of a single-strand-specific nuclease from vaccinia virus. These enzyme preparations were extensively purified and characterized by using superhelical DNAs as substrates. In particular, the nuclease activity was monitored by the extent of conversion of supercoiled closed duplex DNA (DNA I) to nicked circular DNA (DNA II), which could subsequently be converted to duplex linear DNA (DNA III) by prolonged incubation with the enzyme. DNA species which were not substrates for the enzyme included relaxed closed duplex DNA, DNA II which had been prepared by nuclease S1 treatment or by photochemical nicking of DNA I, and DNA III. With plasmid pSM1 DNA as substrate, the extent of cleavage of DNA I to DNA II was found to increase with superhelix density above a threshold value of about -0.06. The linear reaction products were examined by gel electrophoresis after restriction enzyme digestion of the DNAs from plasmids pSM1 and pBR322 and of the viral DNAs from bacteriophage phi X174 (replicative form) and simian virus 40, and the map coordinate locations of the scissions were determined. These products were further examined by electron microscopy and by gel electrophoresis under denaturing conditions. Electron micrographs taken under partially denaturing conditions revealed molecules with terminal loops or hairpins such as would result from the introduction of cross-links at the cutting sites. These species exhibited snapback renaturation. The denaturing gel electrophoresis experiments revealed the appearance of new bands at locations consistent with terminal cross-linking. With pSM1 and pBR322 DNAs, this band was shown to contain DNA that was approximately twice the length of a linear single strand. The terminal regions of the cross-linked linear duplex reaction products were sensitive to nuclease S1 but insensitive to proteinase K, suggesting that the structure is a hairpin loop not maintained by a protein linker. A similar structure is found in mature vaccinia virus DNA.     

Isolation of cis-acting vaccinia virus DNA fragments promoting the expression of herpes simplex virus thymidine kinase by recombinant viruses.

Recombinant TK- vaccinia viruses containing the pBR322 sequence inserted in either orientation within the coding sequence of the viral thymidine kinase gene were constructed. They were characterized by genomic analysis, hybridization studies, reversion to wild-type virus by in vivo recombination, and rescue from their genomes of plasmids which contained all or parts of the pBR322 sequence. TK- cells were infected with one of these recombinant viruses and then transfected with pools of chimeric plasmids composed of a cloned herpes simplex virus thymidine kinase gene which contained upstream inserts of different vaccinia DNA fragments prepared by restriction or sonication. Recombination between homologous pBR322 sequences within infected cells generated selectable recombinant viruses in which expression of the herpes simplex virus thymidine kinase gene was promoted by the upstream vaccinia insert. These viruses were characterized by genomic analysis, hybridization, and in vivo or in vitro phosphorylation of (5-[125I]deoxycytidine as a specific assay for the expressed herpes simplex virus thymidine kinase. Vaccinia DNA inserts were isolated conveniently for transfer to bacteria by rescuing appropriate plasmids from the genome of recombinant viruses. The sequence of 100 nucleotides adjacent to the upstream region of the herpes simplex virus gene was determined in nine different inserts measuring 0.17 to 1.07 kilobase pairs.     

Human cytomegalovirus DNA replicates after early circularization by concatemer formation, and inversion occurs within the concatemer.

To determine the replicative mechanism for human cytomegalovirus (HCMV) DNA, field inversion gel electrophoresis was used to separate HCMV replicative DNAs during lytic infection. Unit-length circular HCMV genomes lacking terminal restriction fragments were detected starting 4 h after infection even when cells were treated with aphidicolin, phosphonoacetic acid, or cycloheximide. Viral DNA synthesis began 24 h after infection and produced large amounts of high-molecular-weight replicative DNA that was a precursor of progeny genomes. Replicative DNA contained rare terminal restriction fragments, and long-arm termini were much less frequent than short-arm termini. Replicative DNA was not composed of unit-length circles because low-dose gamma irradiation of replicative DNA generated numerous random high-molecular-weight fragments rather than unit-length molecules. PacI digestion of replicative DNA from a recombinant HCMV with two closely spaced PacI sites revealed that replicative DNA is concatemeric and genome segment inversion occurs after concatemer synthesis. These results show that after circularization of the parental genome, DNA synthesis produces concatemers and genomic inversion occurs within concatemeric DNA. The results further suggest that concatemers acquire genomic termini during the cleavage/packaging process which preferentially inserts short-arm termini into empty capsids, causing a predominance of short-arm termini on the concatemer.     

Control of expression of the vaccinia virus thymidine kinase gene.

mRNA extracted from vaccinia virus-infected cells early after infection directs cell-free synthesis of enzymatically active viral thymidine kinase (Hruby and Ball, Virology, in press). We used this assay for a specific vaccinia virus mRNA to study the induction and repression of the viral thymidine kinase gene during infection of thymidine kinase-deficient L-cells. As observed previously by other workers, the synthesis of thymidine kinase occurred immediately after infection but was switched off after 4 h later. We observed similar kinetics of accumulation and shutoff under conditions where viral DNA synthesis and late gene expression were inhibited. Cell-free translation of mRNA from infected cells showed that the concentration of functional message for viral thymidine kinase reached a peak 3 to 4 h after infection and then decreased with a half-life of about 1 h. These kinetics indicated that significant levels of thymidine kinase mRNA persisted in cells which had stopped synthesizing the enzyme. Under conditions where late gene expression was inhibited, high concentrations of functional mRNA could be isolated from cells at late times after infection. On the basis of these results, we conclude that the repression of thymidine kinase expression is mediated at the translational level by one or more early or delayed early viral genes. Repression is accompanied by, but does not depend on, the inactivation or degradation of thymidine kinase mRNA, which is a late gene function.     

Restriction enzyme digests of rapidly renaturing fragments of vaccinia virus DNA.

Vaccinia virus DNA fragments that have been denatured by alkali and then neutralized contain a fraction that rapidly reforms duplex structures. The fraction is enriched by fractionating on hydroxyapatite columns and serves as as substrate for digestion by two restriction endonucleases isolated from Hemophilus parainfluenzae, Hpa I and HPa II. The patterns obtained by gel electrophoresis of the digested fragments show the presence of three major bands after Hpa I digestion and four major bands after Hpa II digestion. The DNA that is isolated from some of these bands quickly reforms duplex regions after alkaline denaturation. The size of the DNA segments in the major bands has been estimated to be in the range of 0.44 X 10(6) to 3.2 X 10(6) daltons. The fragments which rapidly reform duplex chains after denaturation are sensitive to single-strand-specific nucleases. These results are consistent with a model of vaccinia virus DNA which has a covalent link connecting complementary chains.     

Inverted terminal repeats in rabbit poxvirus and vaccinia virus DNA.

In both rabbit poxvirus and vaccinia virus DNA have demonstrated an identical distribution of eight HinfI. The length of the terminal repeats was found to be 3.4 to 3.6 megadaltons (Mdaltons) for rabbit poxvirus DNA and 7.4 to 8.0 Mdaltons for vaccinia virus DNA. Maps of the HinfI restriction sites within isolated EcoRI end fragments of rabbit poxvirus and vaccinia virus DNA PHAVE DEMONSTRATED AN IDENTICAL DISTRIBUTION OF EIGHT HinfI sites in an internal part (approximately 2 Mdaltons) of the EcoRI end fragments of the two genomes.     

Site-specific DNA cleavage by vaccinia virus DNA topoisomerase I. Role of nucleotide sequence and DNA secondary structure.

Cleavage of linear duplex DNA by purified vaccinia virus DNA topoisomerase I occurs at a conserved sequence element (5'-C/T)CCTT decreases) in the incised DNA strand. Oligonucleotides spanning the high affinity cleavage site CCCTT at nucleotide 2457 in pUC19 DNA are cleaved efficiently in vitro, but only when hybridized to a complementary DNA molecule. As few as 6 nucleotides proximal to the cleavage site and 6 nucleotides downstream of the site are sufficient to support exclusive cleavage at the high affinity site (position +1). Single nucleotide substitutions within the consensus pentamer have deleterious effects on the equilibria of the topoisomerase binding and DNA cleavage reactions. The effects of base mismatch within the pentamer are more dramatic than are the effects of mutations that preserve base complementarity. Competition experiments indicate that topoisomerase binds preferentially to DNA sites containing the wild-type pentamer element. Single-stranded DNA containing the sequence CCCTT in the cleaved stand is a more effective competitor than is single-stranded DNA containing the complementary sequence in the noncleaved strand.