Endogenous ubiquinol prevents protein modification accompanying lipid peroxidation in beef heart submitochondrial particles

This article is a study of the relationship between lipid peroxidation and protein modification in beef heart submitochondrial particles, and the protective effect of endogenous ubiquinol (reduced coenzyme Q) against these effects. ADP-Fe^3· and ascorbate were used to initiate lipid peroxidation and protein modification, which were monitored by measuring TBARS and protein carbonylation, respectively. Endogenous ubiquinone was reduced by the addition of succinate and antimycin. The parameters investigated included extraction and reincorporation of ubiquinone, and comparison of the effect of ubiquinol with those of various antioxidant compounds and enzymes, as well as the iron chelator EDTA. Under all conditions employed there was a close correlation between lipid peroxidation and protein carbonylation, and the inhibition of these effects by endogenous ubiquinol. SDS-PAGE analysis revealed a differential effect on individual protein components and its prevention by ubiquinol. Conceivable mechanisms behind the observed oxidative modifications of membrane phospholipids and proteins and of the role of ubiquinol in preventing these effects are considered.     

Comparative time-courses of copper-ion-mediated protein and lipid oxidation in low-density lipoprotein

Free radicals damage both lipids and proteins and evidence has accumulated for the presence of both oxidised lipids and proteins in aged tissue samples as well as those from a variety of pathologies including atherosclerosis, diabetes, and Parkinson's disease. Oxidation of the protein and lipid moieties of low-density lipoprotein is of particular interest due to its potential role in the unregulated uptake of lipids and cholesterol by macrophages; this may contribute to the initial stage of foam cell formation in atherosclerosis. In the study reported here, we examined the comparative time-courses of lipid and protein oxidation during copper-ion-mediated oxidation of low-density lipoprotein. We show that there is an early, lipid-mediated loss of 40-50% of the Trp residues of the apoB100 protein. There is no comparable loss over an identical period during the copper-ion-mediated oxidation of lipid-free BSA. Concomitant with Trp loss, the antioxidant alpha-tocopherol is consumed with subsequent extensive lipid peroxidation. Further changes to the protein, including the copper-ion-dependent 3.5-fold increase in 3,4-dihydroxyphenylalanine and the copper-ion-independent 3-5-fold increase in o-tyrosine, oxidation products of Tyr and Phe, respectively, only occur after maximal lipid peroxidation. Long incubation periods result in depletion of 3,4-dihydroxyphenylalanine, presumably reflecting further oxidative changes. Overall, copper-ion-mediated oxidation of LDL appears to proceed initially by lipid radical-dependent processes, even though some of the earliest detectable changes occur on the apoB100 protein. This is followed by extensive lipid peroxidation and subsequent additional oxidation of aromatic residues on apoB100, though it is not yet clear whether this late protein oxidation is lipid-dependent or occurs as a result of direct radical attack.     

Quantitative proteomic analysis of amniocytes reveals potentially dysregulated molecular networks in Down syndrome

Background

Down syndrome (DS), caused by an extra copy of chromosome 21, affects 1 in 750 live births and is characterized by cognitive impairment and a constellation of congenital defects. Currently, little is known about the molecular pathogenesis and no direct genotype-phenotype relationship has yet been confirmed. Since DS amniocytes are expected to have a distinct biological behaviour compared to normal amniocytes, we hypothesize that relative quantification of proteins produced from trisomy and euploid (chromosomally normal) amniocytes will reveal dysregulated molecular pathways.

Results

Chromosomally normal- and Trisomy 21-amniocytes were quantitatively analyzed by using Stable Isotope Labeling of Amino acids in Cell culture and tandem mass spectrometry. A total of 4919 unique proteins were identified from the supernatant and cell lysate proteome. More specifically, 4548 unique proteins were identified from the lysate, and 91% of these proteins were quantified based on MS/MS spectra ratios of peptides containing isotope-labeled amino acids. A total of 904 proteins showed significant differential expression and were involved in 25 molecular pathways, each containing a minimum of 16 proteins. Sixty of these proteins consistently showed aberrant expression from trisomy 21 affected amniocytes, indicating their potential role in DS pathogenesis. Nine proteins were analyzed with a multiplex selected reaction monitoring assay in an independent set of Trisomy 21-amniocyte samples and two of them (SOD1 and NES) showed a consistent differential expression.

Conclusions

The most extensive proteome of amniocytes and amniotic fluid has been generated and differentially expressed proteins from amniocytes with Trisomy 21 revealed molecular pathways that seem to be most significantly affected by the presence of an extra copy of chromosome 21.     

Glutathione transferase A4-4 resists adduction by 4-hydroxynonenal

4-Hydroxy-2-trans-nonenal (HNE) is a lipid peroxidation product that contributes to the pathophysiology of several diseases with components of oxidative stress. The electrophilic nature of HNE results in covalent adduct formation with proteins, fatty acids and DNA. However, it remains unclear whether enzymes that metabolize HNE avoid inactivation by it. Glutathione transferase A4-4 (GST A4-4) plays a significant role in the elimination of HNE by conjugating it with glutathione (GSH), with catalytic activity toward HNE that is dramatically higher than the homologous GST A1-1 or distantly related GSTs. To determine whether enzymes that metabolize HNE resist its covalent adduction, the rates of adduction of these GST isoforms were compared and the functional effects of adduction on catalytic properties were determined. Although GST A4-4 and GST A1-1 have striking structural similarity, GST A4-4 was insensitive to adduction by HNE under conditions that yield modest adduction of GST A1-1 and extensive adduction of GST P1-1. Furthermore, adduction of GST P1-1 by HNE eliminated its activity toward the substrates 1-chloro-2,4-dinitrobenzene (CDNB) and toward HNE itself. HNE effects on GST A4-4 and A1-1 were less significant. The results indicate that enzymes that metabolize HNE may have evolved structurally to resist covalent adduction by it.     

Trolox C, a lipid-soluble membrane protective agent, attenuates myocardial injury from ischemia and reperfusion

The lipophilic antioxidant Trolox C, a vitamin E analog, was administered to isolated, buffer-perfused rabbit hearts subjected to 25 min of global stop-flow ischemia and 30 min of reperfusion. In six hearts, Trolox C (200 microM) was infused for 15 min immediately prior to ischemia and for the first 15 min of reperfusion. Six control hearts received only vehicle. Gas chromatography analysis confirmed that effective myocardial levels of Trolox were attained. At 30 min reperfusion, the recovery of left ventricular developed pressure was 56 +/- 3% of baseline in control hearts versus 70 +/- 4% in Trolox-treated hearts (p < .01). There was also significant improvement in recovery of Trolox-treated hearts in diastolic pressure and both maximum and minimum values of the first derivative of left ventricular pressure (dP/dt). Creatine phosphokinase release into the coronary effluent at 30 min of reperfusion was 16.5 +/- 8.4 IU/min in untreated and 6.3 +/- 1.0 IU/min (p < .05) in Trolox-treated hearts. Thus Trolox C, a lipophilic antioxidant, attenuated myocardial injury during stop-flow ischemia and reperfusion.     

Characterization of 8-epiprostaglandin F2alpha as a marker of amyloid beta-peptide-induced oxidative damage

The amyloid beta-peptide (A beta) is a major component of the neuritic plaques that are a defining histological characteristic of Alzheimer's disease. A beta can be directly toxic and pro-inflammatory to cells in vitro. Numerous reports have shown that oxidative damage and reactive oxygen species play a role in A beta-mediated neurotoxicity. 8-Epiprostaglandin F2alpha (8-isoprostane) is a well characterized product of lipid peroxidation that is formed nonenzymatically in cell membranes following an oxidative insult. We report a time- and concentration-dependent increase in 8-isoprostane levels in rat hippocampal cultures treated with A beta(1-40) or hydrogen peroxide. As evidence that 8-isoprostane production is part of an A beta toxic pathway, alkaline-treated peptide, which shows minimal toxic activity, resulted in greatly attenuated 8-isoprostane production. Although the increase in 8-isoprostane levels preceded cell death, exogenously added 8-isoprostane had no cytotoxic effects. The antioxidants vitamin E and propyl gallate attenuated A beta-induced 8-isoprostane formation yet had no effect on A beta-induced lactate dehydrogenase release. Neither vitamin E nor propyl gallate had any effect on A beta's ability to adopt a beta-pleated sheet structure and deposit on cells as determined by thioflavine S fluorescence. We conclude that 8-isoprostane is an indicator of A beta-induced damage but not necessarily a mediator of A beta-induced neurotoxicity. Also, 8-isoprostane could be a useful marker for assessing oxidative damage in the CNS.     

Basal Lipid Peroxidation in Substantia Nigra Is Increased in Parkinson''s Disease

Polyunsaturated fatty acid (PUFA) levels (an index of the amount of substrate available for lipid peroxidation) were measured in several brain regions from patients who died with Parkinson's disease and age-matched control human postmortem brains. PUFA levels were reduced in parkinsonian substantia nigra compared to other brain regions and to control tissue. However, basal malondialdehyde (MDA; an intermediate in the lipid peroxidation process) levels were increased in parkinsonian nigra compared with other parkinsonian brain regions and control tissue. Expressing basal MDA levels in terms of PUFA content, the difference between parkinsonian and control substantia nigra was even more pronounced. Stimulating MDA production by incubating tissue with FeSO4 plus ascorbic acid, FeSO4 plus H2O2, or air alone produced lower MDA levels in the parkinsonian substantia nigra, probably reflecting the lower PUFA content. These results may indicate that an increased level of lipid peroxidation continues to occur in the parkinsonian nigra up to the time of death, perhaps because of continued exposure to excess free radicals derived from some endogenous or exogenous neurotoxic species.     

A possible cause of non-disjunction of additional chromosome 21 in Down syndrome

Summary A possible cause of non-disjunction of chromosome 21 in Down Syndromes has been cytogenetically evaluated by examining the parents by Ag-staining technique. In all the cases studied so far, the contributing parents have active ribosomal cistrons on both chromosomes 21 i.e. both chromosomes are stained positively by silver staining. These results show that the active NORs might play an essential role in meiotic non-disjunction. Furthermore, the preliminary results demonstrate that the acrocentric associations of homologous and non-homologous nature involving chromosome 21 are the most frequent in the contributing parent which may further indicate the role of multiple cellular factors affecting the associations in promoting the non-disjunction in addition to active NORs. The possible mechanisms regarding the non-disjunction of chromosome 21 have been described.Presented at the 34th Annual Meeting of the American Society of Human Genetics, Norfolk, VA, USA     

Does metabolic reprogramming underpin age-associated changes in T cell phenotype and function?

T cells are required for an effective adaptive immune response. The principal function of T cells is to promote efficient removal of foreign material by identifying and mounting a specific response to nonself. A decline in T cell function in aging is thought to contribute to reduced response to infection and vaccination and an increase in autoimmunity. This may in part be due to the age-related decrease in naïve CD4⁺ T cells and increase in antigen-experienced CD4⁺ T cells, loss of redox homeostasis, and impaired metabolic switching. Switching between subsets is triggered by the integration of extracellular signals sensed through surface receptors and the activation of discrete intracellular metabolic pathways. This article explores how metabolic programming and loss of redox homeostasis during aging may contribute to age-associated changes in T cell phenotype and function.     

Brain oxidative stress in a triple-transgenic mouse model of Alzheimer disease

Alzheimer disease (AD) is a neurodegenerative disease which is characterized by the presence of extracellular senile plaques mainly composed of amyloid-beta peptide (Abeta), intracellular neurofibrillary tangles, and selective synaptic and neuronal loss. AD brains revealed elevated levels of oxidative stress markers which have been implicated in Abeta-induced toxicity. In the present work we addressed the hypothesis that oxidative stress occurs early in the development of AD and evaluated the extension of the oxidative stress and the levels of antioxidants in an in vivo model of AD, the triple-transgenic mouse, which develops plaques, tangles, and cognitive impairments and thus mimics AD progression in humans. We have shown that in this model, levels of antioxidants, namely, reduced glutathione and vitamin E, are decreased and the extent of lipid peroxidation is increased. We have also observed increased activity of the antioxidant enzymes glutathione peroxidase and superoxide dismutase. These alterations are evident during the Abeta oligomerization period, before the appearance of Abeta plaques and neurofibrillary tangles, supporting the view that oxidative stress occurs early in the development of the disease.     

Comparative antioxidant activity of individual herbal components used in Ayurvedic medicine

Four aqueous extracts from different parts of medicinal plants used in Ayurveda (an ancient Indian Medicine) viz., Momardica charantia Linn (AP1), Glycyrrhiza glabra (AP2), Acacia catechu (AP3), and Terminalia chebula (AP4) were examined for their potential as antioxidants. The antioxidant activity of these extracts was tested by studying the inhibition of radiation induced lipid peroxidation in rat liver microsomes at different doses in the range of 100-600 Gy as estimated by thiobarbituric acid reactive substances (TBARS). Of all these extracts, AP4 showed maximum inhibition in the TBARS formation and hence is considered the best antioxidant among these four extracts. The extracts were found to restore antioxidant enzyme superoxide dismutase (SOD) from the radiation induced damage. The antioxidant capacities were also evaluated in terms of ascorbate equivalents by different methods such as cyclic voltammetry, decay of ABTS(.-) radical by pulse radiolysis and decrease in the absorbance of DPPH radicals. The results were found to be in agreement with the lipid peroxidation data and AP4 showed maximum value of ascorbate equivalents. Therefore AP4, with high antioxidant activity, is considered as the best among these four extracts.     

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.     

Serum and urine malondialdehyde levels in NIDDM patients with and without hyperlipidemia

Malondialdehyde (MDA), a marker of lipid peroxidation, was measured as thiobarbituric acid reactive substance (TBARS) in 78 noninsulin-dependent diabetic patients, 38 hyperlipidemic patients, and 28 healthy subjects. Diabetic patients were divided into groups and subgroups according to the existence of hyperlipidemia and other complications. Serum and urine MDA concentrations were significantly higher in diabetic and nondiabetic patient groups than in the control group. By contrast to urine MDA level, serum MDA level was significantly higher in hyperlipidemic diabetics than that of normolipidemic diabetics. Serum MDA levels in the hyperlipidemic diabetic group and urine MDA levels in both diabetic groups were significantly higher than those in hyperlipidemic nondiabetic group. In both diabetic groups, the existence of complications didn't affect serum and urine MDA levels. No correlation existed between serum and urine MDA levels in both patient groups and control subjects. This study confirmed the existence of lipid peroxidation disorders in diabetic patients.     

Inhibition of protein tyrosine phosphatases by amino acid, peptide, and protein hydroperoxides: potential modulation of cell signaling by protein oxidation products

Reaction of radicals in the presence of O2, or singlet oxygen, with some amino acids, peptides, and proteins yields hydroperoxides. These species are key intermediates in chain reactions and protein damage. They can be detected in cells and are poorly removed by enzymatic defenses. Previously we have shown that peptide and protein hydroperoxides react rapidly with thiols, with this resulting in inactivation of some thiol-dependent enzymes. In light of these data, we hypothesized that inactivation of protein tyrosine phosphatases (PTPs), by hydroperoxides present on oxidized proteins, may contribute to cellular and tissue dysfunction by modulation of phosphorylation-dependent cell signaling. We show here that PTPs in cell lysates, and purified PTP-1B, are inactivated by amino acid, peptide, and protein hydroperoxides in a concentration- and structure-dependent manner. Protein hydroperoxides are particularly effective, with inhibition occurring with greater efficacy than with H2O2. Inactivation involves reaction of the hydroperoxide with the conserved active-site Cys residue of the PTPs, as evidenced by hydroperoxide consumption measurements and a diminution of this effect on blocking the Cys residue. This inhibition of PTPs, by oxidized proteins containing hydroperoxide groups, may contribute to cellular dysfunction and altered redox signaling in systems subject to oxidative stress.     

In vitro free radical scavenging activity of hepatic metallothionein induced in an Indian freshwater fish, Channa punctata Bloch

Mammalian metallothioneins (MT) have been reported to scavenge free radicals. There is no experimental evidence to show that fish MT has a similar property. In the present study cadmium-induced MT (Cd-MT) from the liver of an Indian freshwater fish Channa punctata Bloch was investigated for its free radical scavenging activity using three different in vitro assays. Exposure to cadmium chloride (0.2 mg/kg body weight; three doses on alternate days) resulted in a marked induction of Cd-MT in liver. Only a single isoform of Cd-MT was found to be induced. Molecular weight of Cd-MT was found to be 14 kDa as deduced by SDS-PAGE analysis. The purified Cd-MT effectively scavenged the following free radicals: superoxide radical (O2*-), 2,2'-azinobis 3-ethylbenzothiazoline-6-sulfonic acid (ABTS*+) and 1,1-diphenyl-picrylhydrazyl radical (DPPH*). The radical scavenging effect was found to be concentration-dependent. Also, the purified MT exhibited an inhibitory effect on ferric nitrilotriacetate (Fe-NTA) induced oxidative DNA damage in vitro. The cysteine residues of MT are proposed to be the main candidate for its radical scavenging activity. Findings of the present study strongly suggest a free radical scavenging role for fish MT. Present study adds to the little existing knowledge about fish MT and its possible biological functions.     

Effect of Naturally Occurring Flavonoids on Lipid Peroxidation and Membrane Permeability Transition in Mitochondria

The ability of eight structurally related naturally occurring flavonoids in inhibiting lipid peroxidation and mitochondrial membrane permeability transition (MMPT), as well as respiration and protein sulfhydryl oxidation in rat liver mitochondria, was evaluated. The flavonoids tested exhibited the following order of potency to inhibit ADP/Fe(II)-induced lipid peroxidation, estimated with the thiobarbituric acid assay: 3′-O-methyl-quercetin > quercetin > 3,5,7,3′,4′-penta-O-methyl-quercetin > 3,7,3′,4′-tetra-O-methyl-quercetin > pinobanksin > 7-O-methyl-pinocembrin > pinocembrin > 3-O-acyl-pinobanksin. MMPT was estimated by the extent of mitochondrial swelling induced by 10 μM CaCl₂ plus 1.5 mM inorganic phosphate or 30 μM mefenamic acid. The most potent inhibitors of MMPT were quercetin, 7-O-methyl-pinocembrin, pinocembrin, and 3,5,7,3′,4′-penta-O-methyl-quercetin. The first two inhibited in parallel the oxidation of mitochondrial protein sulfhydryl involved in the MMPT mechanism. The most potent inhibitors of mitochondrial respiration were 7-O-methyl-pinocembrin, quercetin, and 3′-O-methyl-quercetin while the most potent uncouplers were pinocembrin and 3-O-acyl-pinobanksin. In contrast 3,7,3′,4′-tetra-O-methyl-quercetin and 3,5,7,3′,4′-penta-O-methyl-quercetin showed the lowest ability to affect mitochondrial respiration. We conclude that, in general, the flavonoids tested are able to inhibit lipid peroxidation on the mitochondrial membrane and/or MMPT. Multiple methylation of the hydroxyl substitutions, in addition to sustaining good anti-lipoperoxidant activity, reduces the effect of flavonoids on mitochondrial respiration, and therefore, increases the pharmacological potential of these compounds against pathological processes related to oxidative stress.