Analysis of a drosophila tRNA gene cluster: two tRNALeu genes contain intervening sequences

A recombinant DNA phage containing a cluster of Drosophila melanogaster tRNA genes has been isolated and analyzed. The insert of this phage has been mapped by in situ hybridization to chromosomal region 50AB, a known tRNA site. Nucleotide sequencing of the entire Drosophila tRNA coding region reveals seven tRNA genes spanning 2.5 kb of chromosomal DNA. This cluster is separated from other tRNA regions on the chromosome by at least 2.7 kb on one side, and 9.6 kb on the other. Two tRNA genes are nearly identical and contain intervening sequences of length 38 and 45 bases, respectively, in the anticodon loop. These two genes are assigned to be tRNALeu genes because of significant sequence homology with yeast tRNA3Leu, and secondary structure homology with yeast tRNA3Leu intervening sequence. In addition, an 8 base sequence (AAAAUCUU) is conserved in the same location in the intervening sequences of Drosophila tRNALeu genes and a yeast tRNA3Leu gene. Similar sequenes occur in all other tRNAs containing intervening sequences. The remaining five genes are identical tRNAIle genes, which are also identical to a tRNAIle gene from chromosomal region 42A. The 5' flanking regions are only weakly homologous, but each set of isoacceptors contains short regions of strong homology approximately 20 nucleotides preceding the tRNA coding sequences: GCNTTTTG preceding tRNAIle genes; and GANTTTGG preceding tRNALeu genes. The genes are irregularly distributed on both DNA strands; spacing regions are divergent in sequence and length.     

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.     

Structure and evolution of a mouse tRNA gene cluster encoding tRNAAsp, tRNAGly and tRNAGlu and an unlinked, solitary gene encoding tRNAAsp

We have sequenced mouse tRNA genes from two recombinant lambda phage. An 1800 bp sequence from one phage contains 3 tRNA genes, potentially encoding tRNAAsp, tRNAGly, and tRNAGlu, separated by spacer sequences of 587 bp and 436 bp, respectively. The mouse tRNA gene cluster is homologous to a rat sequence (Sekiya et al., 1981, Nucleic Acids Res. 9, 2239-2250). The mouse and rat tRNAAsp and tRNAGly coding regions are identical. The tRNAGlu coding regions differ at two positions. The flanking sequences contain 3 non-homologous areas: a c. 100 bp insertion in the first mouse spacer, short tandemly repeated sequences in the second spacers and unrelated sequences at the 3' ends of the clusters. In contrast, most of the flanking regions are homologous, consisting of strings of consecutive, identical residues (5-17 bp) separated by single base differences and short insertions/deletions. The latter are often associated with short repeats. The homology of the flanking regions is c. 75%, similar to other murine genes. The second lambda clone contains a solitary mouse tRNAAsp gene. The coding region is identical to that of the clustered tRNAAsp gene. The 5' flanking regions of the two genes contain homologous areas (10-25 bp) separated by unrelated sequences. Overall, the flanking regions of the two mouse tRNAAsp genes are less homologous than those of the mouse and rat clusters.