Morphology,Physiology, and Virulence of <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis> Isolates

Bipolaris sorokiniana is a phytopathogenic fungus that causes diseases in cereal crops. The high morphological, physiological, and genetic variability makes the control of this fungus a difficult task. The aim of this work was to study the virulence, morphological, and physiological variability of B. sorokiniana isolates. For this, 35 B. sorokiniana isolates from different geographic regions in Brazil and other countries were used. The isolates were evaluated for their morphological variability, considering mycelium color, sector formation, and growth rate. Based on these morphological characteristics, the isolates were grouped in five different morphological groups. Extracellular enzymes activity in solid medium, virulence in wheat seeds and seedlings, and analysis of total proteins by SDS-PAGE were evaluated for all isolates. Variations among the isolates were found for enzymatic activity, and esterase was the enzyme that showed the highest activity indices. The results obtained from infection of seeds and seedlings showed that isolates from the same geographical region and morphological group had different degrees of virulence. The total protein profile shown by the isolates varied in the number of bands and intensity, where some of them may be used to characterize the specie.     

Restriction analysis of the amplified ribosomal DNA spacers ITS1 and ITS2 of <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis> isolates

The purpose of this study was to examine the genotypic variability of Bipolaris sorokiniana by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis using rDNA. Fifty B. sorokiniana isolates from Brazil and other countries, one Bipolaris oryzae and six Drechslera teres isolates were used. The intragenic spacer regions (ITS1 and ITS2) were the regions used for characterization of isolates. The amplification products for both ITS regions, showed two DNA fragments for all isolates. Two B. sorokiniana isolates presented an intraspecific variability showing a third fragment for the ITS1 region. The dendrograms generated with PCR-RFLP data showed intra- and inter-specific groups. The dendrograms showed that most of Brazilian isolates clustered together forming groups between them, and this behavior was repeated with most isolates from other countries. The dendrograms did not enable the separation of B. sorokiniana isolates by their geographic origin or host type. These results suggest the occurrence of gene flow between different populations of the fungus isolated in geographically distant regions and lends cogency to the occurrence of gene flow between species.     

Association between vegetative compatibility and aflatoxin production by <Emphasis Type="Italic">Aspergillus</Emphasis> species during intraspecific competition

Intraspecific competition is the basis for biological control of aflatoxins, but there is little understanding of the mechanism(s) by which competing strains inhibit toxin production. Evidence is presented that demonstrates a relationship between strength of the vegetative compatibility reaction and aflatoxin production in Aspergillus flavus and A. parasiticus using the suspended disk culture method. Combining wild-type aflatoxin-producing isolates belonging to different vegetative compatibility groups (VCGs) resulted in a substantial reduction in aflatoxin yield. Pairs of aflatoxin-producing isolates within the same VCG, but showing weak compatibility reactions using complementary nitrate-nonutilizing mutants, also were associated with reduced levels of aflatoxin B₁. In contrast, pairings of isolates displaying a strong compatibility reaction typically produced high levels of aflatoxins. These results suggest that interactions between vegetatively compatible wild-type isolates of A. flavus and A. parasiticus are cooperative and result in more aflatoxin B₁ than pairings between isolates that are incompatible. Successful hyphal fusions among spore germlings produce a common mycelial network with a larger resource base to support aflatoxin biosynthesis. By comparison, vegetative incompatibility reactions might result in the death of those heterokaryotic cells composed of incompatible nuclei and thereby disrupt the formation of mycelial networks at the expense of aflatoxin biosynthesis. The content of this paper was presented at the 50th Anniversary Meeting of the Mycological Society of Japan, June 3–4, 2006, Chiba, Japan     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Parasexuality in Race 65 Colletotrichum lindemuthianum Isolates

ABSTRACT. Heterokaryosis is the initial step of the parasexual cycle, a process that provides genetic variability in filamentous fungi through the production of heterozygous diploid nuclei. To characterize the parasexual cycle in Colletotrichum lindemuthianum, we evaluated the presence of heterokaryosis, vegetative compatibility reactions, and diploid formation among isolates of Race 65 collected from different Brazilian states. Vegetative compatibility groups were identified among the isolates according to their ability to form heterokaryons. Two heterozygous diploids were selected from compatible heterokaryons, which were characterized by the segregation of the parental auxotrophic markers and by RAPD profiles.     

Trichothecene production and the relationship to vegetative compatibility groups in shape Fusarium poae

Twenty-two Norwegian and two Polish isolates of Fusarium poae were cultured on rice and in two liquid media, MOSS and MYRO. All samples were analysed for trichothecenes by gas chromatography mass-spectrometer. Association of trichothecene production with vegetative compatibility groups was studied in the F. poae isolates. Twenty of the isolates produced the type A trichothecenes diacetoxyscirpenol or monoacetoxyscirpenol in at least one of the media, in the concentration range of 0.01 to 65 μg ml^-1 in the liquid culture and 0.1 to 67 μg g^-1 on rice. The other group of trichothecenes detected were of type B; nivalenol and its two acetyl-derivatives 4-acetylnivalenol and diacetylnivalenol. Twelve of the strains produced at least one of these metabolites in the concentration range of 0.01 to 7 μg ml^-1 in the liquid culture and 0.1 to 18 μg g^-1 on rice (sum of nivalenol and its acetylated derivatives). A significant correlation was observed between the two groups of toxins (logarithm). None of the isolates produced T-2 or HT-2 toxin. In a previous study these isolates were divided into 13 vegetative compatibility groups. Significant variation in the trichothecene production was observed between different vegetative compatibility groups, but also to some extent within the same group. This revised version was published online in August 2006 with corrections to the Cover Date.     

Ultraviolet Light-Induced Heterokaryon Formation and Parasexuality in Cryphonectria parasitica

Rizwana, R., and Powell, W. A. 1995. Ultraviolet light-induced heterokaryon formation and parasexuality in Cryphonectria parasitica. Experimental Mycology 19, 48-60. The effect of ultraviolet-light on heterokaryon formation, vegetative compatibility, and parasexuality in Cryphonectria parasitica was examined. Heterokaryons of complementary auxotrophic strains could not be made by hyphal anastomosis if the strains belonged to different vegetative compatibility groups. Protoplast fusions overcame incompatibility of strains differing in the alleles of a single but not multiple vegetative incompatibility loci. Fusion of protoplasts from ultraviolet light-treated complementary auxotrophs increased heterokaryon formation by 10⁴ to 10⁵ using the strains differing in alleles of a single vegetative incompatibility gene but had no detectable effect on strains differing in multiple vegetative incompatibility genes. Vegetative compatibility tests of single conidial isolates resolved from these heterokaryons suggest that diploids had formed followed by the loss of one of the VIC alleles. Presence of both auxotrophic markers in some of these single conidial isolates confirms the occurrence of a parasexual cycle. These experiments demonstrate that ultraviolet-light can enhance heterokaryon formation and parasexuality in C. parasitica .     

Genetic Diversity Among Monoconidial and Polyconidial Isolates of Bipolaris sorokiniana

Spot blotch caused by Bipolaris sorokiniana is a destructive disease of wheat in warm and humid wheat-growing regions of the world. This fungus shows a high genetic diversity and morphological and physiologic variability. In this study, 19 polysporic and 57 monosporic isolates of B. sorokiniana were characterized using universal rice primers—URP-PCR. The results obtained when the dendrogram was constructed with all the data produced with the amplification products showed very distinct clusters. However, the similarity among the isolates was low where 37 and 26.3 % of the monosporic and polysporic isolates, respectively, showed similarity above 70 %. All primers amplified multiple DNA fragments of polysporic as well as the monosporic isolates. Isolates fingerprints were constructed based on binary characters revealed by the three primers. An amplified fragment of approximately 750 bp was observed among 40 % of the isolates, when primer URP-1F was used. When primers URP-4R and URP-2R were used, a fragment of 450 and 400 bp was present in 31.5 and 29 % of the isolates, respectively. It was expected a higher similarity among the isolates since the monosporic cultures were originated from the polysporic. The dendrogram did not enable the separation of B. sorokiniana isolates by their geographic origin. This low correlation suggests that gene transfer may have occurred by parasexual combination in this fungus population. However, in spite of the research efforts for that end, it has not been possible to establish patterns that characterize the profile of B. sorokiniana.     

Genetic Diversity of Isolates of Glomus mosseae from Different Geographic Areas Detected by Vegetative Compatibility Testing and Biochemical and Molecular Analysis

We detected, for the first time, the occurrence of vegetative incompatibility between different isolates of the arbuscular mycorrhizal fungal species Glomus mosseae. Vegetative compatibility tests performed on germlings belonging to the same isolate showed that six geographically different isolates were capable of self-anastomosing, and that the percentage of hyphal contacts leading to fusions ranged from 60 to 85%. Successful anastomoses were characterized by complete fusion of hyphal walls, protoplasm continuity and occurrence of nuclei in the middle of hyphal bridges. No anastomoses could be detected between hyphae belonging to different isolates, which intersected without any reaction in 49 to 68% of contacts. Microscopic examinations detected hyphal incompatibility responses in diverse pairings, consisting of protoplasm retraction from the tips and septum formation in the approaching hyphae, even before physical contact with neighboring hyphae. Interestingly, many hyphal tips showed precontact tropism, suggesting that specific recognition signals may be involved during this stage. The intraspecific genetic diversity of G. mosseae revealed by vegetative compatibility tests was confirmed by total protein profiles and internal transcribed spacer-restriction fragment length polymorphism profiles, which evidenced a higher level of molecular diversity between the two European isolates IMA1 and BEG25 than between IMA1 and the two American isolates. Since arbuscular mycorrhizal fungi lack a tractable genetic system, vegetative compatibility tests may represent an easy assay for the detection of genetically different mycelia and an additional powerful tool for investigating the population structure and genetics of these obligate symbionts.     

High diversity of vegetative compatibility types in Cryphonectria parasitica in Japan and China

We found high diversity of vegetative compatibility (vc) types in native populations of the chestnut blight fungus, Cryphonectria parasitica, in Japan and China; almost every isolate was in a unique vc type. In Japan we found 71 vc types in a sample of 79 isolates pooled from six populations. Within two populations in China, all isolates (n=28 and 11) had unique vc types; we found 15 vc types among 25 isolates in a third Chinese population where multiple isolates were collected from some trees. None of the isolates from China and only three isolates in the 71 vc types from Japan were compatible with any of 64 vc type testers from Europe, which have known vegetative incompatibility genotypes. To our knowledge this is the first report of vc type diversity for C. parasitica in Japan or of any comparisons of vc types between Asia and Europe. The most significant result of this survey is the identification fungal isolates for expanding knowledge of the genetics of vegetative incompatibility.     

Molecular genetic determinants of intraspecific polymorphism of the phytopathogenic fungus <Emphasis Type="Italic">Cryphonectria parasitica</Emphasis>

The review summarizes the current evidence on the phytopathogenic fungus Cryphonectria parasitica, which is a classic object for studying hypovirulence. Phenotypic manifestations of hypovirulence and the molecular mechanisms of action of the mycovirus Cryphonectria hypovirus (CHV) infecting the fungus are described in detail. Genetic determinants of vegetative incompatibility in C. parasitica (a phenomenon increasing polymorphism of the fungus and preventing CHV expansion) are considered. The data on C. parasitica polymorphism are correlated with the data on the distribution of different CHV species in the European, American, and Asian populations of the fungus.     

Spread and population structure of <Emphasis Type="Italic">Cryphonectria parasitica</Emphasis> in a young chestnut orchard in Slovakia

The chestnut blight pathogen Cryphonectria parasitica was studied in a chestnut collection composed of both seedlings and grafts derived from selected Castanea sativa and C. sativa × C. crenata trees located in south-east Slovakia, near village Príbelce on an area of approximately 3.5 ha. The study was conducted during eight years (2003–2010). During this period 133 trees were infected, which represents 59.82% of chestnut trees of all chestnut accessions. Based on the phenotype of the fungus culture and the type of cankers in the field, all isolates were determined to be virulent. No hypovirulent strains were found. No vegetative compatibility (vc) type diversity was observed. More than 130 isolates were analyzed for vc and all were in single vc type, which was identical with EU 12. All isolates assayed for mating type were MAT-1. No perithecia were observed. No significant differences were found between the proportion of cankered and dead cankered trees in seedlings and grafts of hybrid origin (C. sativa × C. crenata) and of C. sativa origin. However, particular seedlings and grafts of hybrid origin seemed to exhibit certain resistance to chestnut blight.     

Comparisons of Isolates of Fusarium avenaceum from White Lupin and Other Crops by Pathogenicity Tests,DNA Analyses and Vegetative Compatibility Tests

Isolates of Fusarium avenaceum, mostly from crops of white lupin or wheat, were tested for pathogenicity on white lupin and wheat plants and compared by DNA tests and, in a limited study, vegetative compatibility. Most of the 80 isolates were pathogenic on both plant species after inoculation on shoot bases. Disease severity was greater at higher incubation temperatures that ranged from 15/10°C to 25/20°C (day/night temperatures). Isolates from lupin crops tended to be more pathogenic, on average, on lupins than on cereals. Polymerase chain reaction (PCR)‐restriction fragment length polymorphism (RFLP) analysis of the internal transcribed spacer region of the rDNA distinguished two groups of isolates that occurred in different proportions among isolates from lupins and cereal crops. Random amplified polymorphic DNA (RAPD)‐PCR analyses indicated considerable genetic variation among isolates, but there was some similarity among groups of isolates from populations in the same field. Genetic diversity was confirmed by a high degree of vegetative incompatibility among 20 isolates using nitrate nonutilizing mutants. There were no relationships among pathogenicity, RFLP group, RAPD group and vegetative compatibility group.     

Pathogenic characterization and study of the mycelial groups of compatibility in Sclerotium cepivorum Berk

We have studied the pathogenicity and the formation of mycelial compatibility groups of (MCG) in 12 isolates of the fungus Sclerotium cepivorum Berk from the states of Táchira, Mérida, Trujillo in Venezuela and Pamplona in Colombia. The pathogenicity was evaluated according to severity and virulence. In vitro confrontation tests were used to check the presence of compatible and incompatible interactions expressed by MCG when different isolates of the fungus were put together in a petri dish. When pathogenicity was evaluated, we found high levels of disease with isolates T-9, C-1 and TR-10. The isolate T-9 was the most virulent and agressive, as the symptoms began at day 12 and at day 19 and 100% of the nine inoculated plants died. Three responses were observed when confronting S. cepivorum isolates: a reaction of compatibility or anastomosis and two reactions of incompatibility. Two MCG were found, represented by isolates T-8 (Táchira) and TR-3 (Trujillo), which showed incompatibility when faced with other isolates. These results provide a basis upon which the genetic characterization of S. cepivorum can be established.     

Genetic diversity of isolates of Glomus mosseae from different geographic areas detected by vegetative compatibility testing and biochemical and molecular analysis

We detected, for the first time, the occurrence of vegetative incompatibility between different isolates of the arbuscular mycorrhizal fungal species Glomus mosseae. Vegetative compatibility tests performed on germlings belonging to the same isolate showed that six geographically different isolates were capable of self-anastomosing, and that the percentage of hyphal contacts leading to fusions ranged from 60 to 85%. Successful anastomoses were characterized by complete fusion of hyphal walls, protoplasm continuity and occurrence of nuclei in the middle of hyphal bridges. No anastomoses could be detected between hyphae belonging to different isolates, which intersected without any reaction in 49 to 68% of contacts. Microscopic examinations detected hyphal incompatibility responses in diverse pairings, consisting of protoplasm retraction from the tips and septum formation in the approaching hyphae, even before physical contact with neighboring hyphae. Interestingly, many hyphal tips showed precontact tropism, suggesting that specific recognition signals may be involved during this stage. The intraspecific genetic diversity of G. mosseae revealed by vegetative compatibility tests was confirmed by total protein profiles and internal transcribed spacer-restriction fragment length polymorphism profiles, which evidenced a higher level of molecular diversity between the two European isolates IMA1 and BEG25 than between IMA1 and the two American isolates. Since arbuscular mycorrhizal fungi lack a tractable genetic system, vegetative compatibility tests may represent an easy assay for the detection of genetically different mycelia and an additional powerful tool for investigating the population structure and genetics of these obligate symbionts.     

Vegetative Compatibility Grouping of the Fusarium Wilt Pathogen of Paris Daisy (Argyranthemum frutescens L.)

Fusarium oxysporum isolates, pathogenic on Paris daisy (Argyranthemum frutescens), were classified by vegetative compatibility grouping analysis. They were compared with isolates of the formae speciales chrysanthemi and tracheiphilum, and with f. sp. dianthi as a genetically distant control. The results show the uniformity of the pathogenic isolates from Paris daisy, except for one which was of a different geographic origin. They were classified as a new VC group (0052). We report also the efficacy of different media in obtaining nit mutants.     

Cytological Analysis of Anastomoses and Vegetative Incompatibility Reactions in <Emphasis Type="Italic">Helicobasidium monpa</Emphasis>

Our examination of the cytological characteristics of the vegetative incompatibility reaction in a filamentous basidiomycete, Helicobasidium monpa, by analyzing the fluorescence emitted by ethidium bromide and acridine orange stained nuclei is described. Hyphal anastomoses between strains belonging to different mycelium compatibility groups (MCG) were observed with cell death in fused hyphae, whose nuclei were intensified by ethidium bromide. In contrast, the nuclei in a living cell were not intensified by staining with ethidium bromide, but were intensified by staining with acridine orange. These results indicate that in H. monpa, ethidium bromide staining is a useful method for detecting dead cells. We also examined the relationships between the alternation of ploidy and hyphal anastomosis formation using the newly developed method on filamentous fungi. The tetraploid monokaryon strain derived from the original dikaryon strain by continuous subculture could not be fused to any wild type strains, but the original dikaryon strain could be fused without cell death to only the same MCG strain. In contrast, the haploid dikaryon strain derived from the original monokaryon strain fuses to several strains belonging to different MCGs without cell death. These results suggested that the cellular ploidy of this fungus is closely related to its mating system and, H. monpa may be a self-fertilizing fungus. Received: 13 June 2001 / Accepted: 8 August 2001     

Genetic diversity analysis of <Emphasis Type="Italic">Sclerotinia sclerotiorum</Emphasis> causing stem rot in chickpea using RAPD,ITS-RFLP,ITS sequencing and mycelial compatibility grouping

Sclerotinia sclerotiorum is one of the most devastating soil-inhabiting fungal plant pathogens infecting various crop plants including chickpea. Genetic diversity of 24 isolates of S. sclerotiorum representing 10 different states of India was determined by different molecular markers and mycelial compatibility grouping (MCG). The majority of the isolates showed more than 90% genetic similarity. Unweighted paired group method with arithmetic average cluster analysis of DNA profiles generated by 21 RAPD primers grouped the isolates into seven categories showing high magnitude of genetic homogeneity and showed partial correlation with geographical origin of the isolates. Identical ITS-RFLP profiles were generated in all the isolates. Limited variability was observed among the nucleotide sequences of ITS region of the isolates. The phylogenetic tree generated from bootstrap neighbor-joining analysis indicated that 50% of Indian populations were distinct and grouped separately. The isolates were variable in mycelial compatibility and they were grouped into seven MCGs, namely, MCG A, MCG B, MCG C, MCG D, MCG E, MCG F and MCG G.     

Vegetative compatibility groups of Japanese isolates ofVerticillium dahliae

Japanese isolates ofVerticillium dahliae were examined for vegetative compatibility relationships using nitrate-nonutilizing mutants. Four levels of vegetative compatibility were differentiated according to the degree of compatibility between the tester mutants ofnit1 and NitM. Wild-type growth with a complementation line greater than 5 mm wide was defined as “strong reaction (++)”, i.e., compatible. Ten out of 15 isolates showed compatibility and were separated into three groups, provisionally designated as VCGJ1, VCGJ2, and VCGJ3, depending upon their reactions. This method was used to estimate, genetic diversity within a local population ofV. dahliae. Another 12 isolates from Gunma Pref. were paired with tester isolates of the three vegetative compatibility groups proposed. Eight Gunma isolates were assigned to VCGJ1 or VCGJ2. Two isolates were incompatible with all testers. The remaining 2 isolates were self-incompatible. Thus, 18 out of 27 Japanese isolates ofV. dahliae were assigned to VCGs: 8 to VCGJ1, 7 to VCGJ2, and 3 to VCGJ3. VCGJ1 was compatible with both VCGJ2 and VCGJ3, but VCGJ2 and VCGJ3 showed a weak reaction with each other. Japanese isolates ofV. dahliae were thus demonstrated to form a VC group comprising three subgroups.