New SINE families from rice, OsSN, with poly(A) at the 3' ends

A database search of the sequences flanking a member of rice retrotransposon RIRE7 revealed that a 298-bp sequence in the region downstream of the member is a repetitive sequence interspersed in the genome of Oryza sativa cv. Nipponbare. Most of the repetitive sequences were flanked by a direct repeat of a target-site sequence, about 14 bp in length. The consensus sequence, 293 bp in length, had no regions encoding any proteins but had sequence motifs of an internal promoter of RNA polymerase III. These indicate that the sequence is a retroposon SINE, designated OsSN1 (Oryza sativa SINE1). OsSN1 is a new rice SINE, because it has no homology with any of the three p-SINE families previously identified from rice, and because it has a stretch of A at the 3' end, unlike p-SINE and any other Gramineae SINEs which have a stretch of T at the 3' end. The Nipponbare genome was found to have many members related to OsSN1, forming two additional new SINE families (designated OsSN2 and OsSN3). OsSN2 and OsSN3 are highly homologous to the 3' and 5' regions of OsSN1, respectively. This suggests that OsSN1 has a mosaic structure, which is generated by sequence exchange (or shuffling) between ancestral OsSN2 and OsSN3. Despite the absence of homology in the 3' regions between OsSN1 (or OsSN2) and OsSN3, a sequence, 5'-TTCTC-3', is commonly present in the region preceding the A stretch at the 3' end. This sequence together with the A stretch and a stem-loop structure found in the region near the A stretch are assumed to be important for retroposition. OsSN members were present in strains of Oryza species, as were p-SINE members. Some of the members showed insertion polymorphism at the respective loci among the rice strains. p-SINE had such polymorphic members, which are useful for classification and phylogenetic analysis of various strains of Oryza species. The polymorphic members of OsSN were more frequently found than those of p-SINE, and therefore, such members are likely to be useful for extensive taxonomic and phylogenetic studies on various rice strains.     

A new family of repetitive, retroposon-like sequences in the genome of the rainbow trout

We have identified a new family of interspersed, moderately repetitive DNA elements, termed the RSg-1 family, in the genome of the rainbow trout. Two of the elements examined here are situated upstream of sequences which code for trout nuclear proteins; a protamine gene (p101) and the clustered histone H4 gene. Sequence comparison of various RSg-1 elements indicated a high degree of nucleotide sequence homology between different members of the family. These repetitive elements exhibit well defined 3' ends which contain poly(A) segments preceded by the consensus polyadenylation signal AATAAA. Sequences flanking the 3' end of the poly(A) tract also conform to a consensus sequence. A similar sequence is also found flanking the 5' terminus of the element in the protamine clone p101, and thus may represent a target-site duplication generated upon insertion of the element into the genome. These characteristics, together with the heterogeneous nature of the 5' ends of the elements, are reminiscent of processed pseudogenes and retroposons such as the mammalian L1 family of interspersed repetitive elements.     

Characterization of a SINE species from vicuna and its distribution in animal species including the family Camelidae

Twenty-six sequences of a short interspersed repetitive element (SINE) with a size of approximately 150 base pairs (bp) were isolated from the genomic DNA of Vicugna vicugna (vicuna). RNA polymerase III split promoter sequence was observed in most of them, and many had direct repeats flanking to SINEs as well as a poly(A)-like structure. The SINE sequences were designated as ``vic-1' sequences. Comparison of the vic-1 consensus sequence with sequences registered in the DNA database (DDBJ/EMBL/GENBANK) revealed that the vic-1 sequence had a 79% homology with mouse ala-tRNA gene. In addition, the tRNA-related region of the consensus sequence was folded into a cloverleaf structure as with mouse ala-tRNA. These findings strongly indicated that vic-1 was a retroposon derived from ala-tRNA gene. The vic-1 sequences were used as a probe for dot-blot hybridization to examine the distribution of their homologous sequences in the genomes of various animal species spanning 14 orders, of which, homologous sequences were found only in the Camelidae family. In order to examine the phylogenetical relationship among vicuna, llama, and camel, vic-1 insertion analysis and homology analysis of vic-1 sequences were performed at each locus. The analyses indicated that vic-1 sequences were generated in a common ancestor of the animal species, and that camels first branched off from the clade Camelidae, followed by vicunas and llamas. Received: 5 July 2000 / Accepted: 14 November 2000     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

Empty and occupied insertion site of the truncated LINE-1 repeat located in the mouse serum albumin-encoding gene

Taking advantage of the polymorphism created by the presence or the absence of a LINE-1 repeat in intron 12 of the mouse serum albumin-encoding gene, we sequenced the repeat (Alb-L1Md), as well as the flanking regions in BALB/c DNA. The empty insertion site in a wild-type mouse of the same species Mus domesticus was amplified using PCR and sequenced. The Alb-L1Md was truncated at its 5' end and bordered by two 14-bp repeats, which represented the duplication of the empty insertion site. The absence of mutations in the two direct repeats as well as in the poly(dA) tail suggests that the Alb-L1Md sequence had been inserted very recently. On the basis of the insertion sequence of intron 12 and of the sequence of the consensus L1Md repeat, 5' of the insertion, we discuss a model of integration of full-length L1Md-RNA leading to the truncation of the inserted repeat.     

Targeted identification of short interspersed nuclear element families shows their widespread existence and extreme heterogeneity in plant genomes

Short interspersed nuclear elements (SINEs) are non-long terminal repeat retrotransposons that are highly abundant, heterogeneous, and mostly not annotated in eukaryotic genomes. We developed a tool designated SINE-Finder for the targeted discovery of tRNA-derived SINEs. We analyzed sequence data of 16 plant genomes, including 13 angiosperms and three gymnosperms and identified 17,829 full-length and truncated SINEs falling into 31 families showing the widespread occurrence of SINEs in higher plants. The investigation focused on potato (Solanum tuberosum), resulting in the detection of seven different SolS SINE families consisting of 1489 full-length and 870 5' truncated copies. Consensus sequences of full-length members range in size from 106 to 244 bp depending on the SINE family. SolS SINEs populated related species and evolved separately, which led to some distinct subfamilies. Solanaceae SINEs are dispersed along chromosomes and distributed without clustering but with preferred integration into short A-rich motifs. They emerged more than 23 million years ago and were species specifically amplified during the radiation of potato, tomato (Solanum lycopersicum), and tobacco (Nicotiana tabacum). We show that tobacco TS retrotransposons are composite SINEs consisting of the 3' end of a long interspersed nuclear element integrated downstream of a nonhomologous SINE family followed by successfully colonization of the genome. We propose an evolutionary scenario for the formation of TS as a spontaneous event, which could be typical for the emergence of SINE families.     

The bacteriophage Mu transposase protein can form high-affinity protein-DNA complexes with the ends of transposable elements of the Tn 3 family

The 37 kb transposable bacteriophage Mu genome encodes a transposase protein which can recognize and bind to a consensus sequence repeated three times at each extremity of its genome. A subset of this consensus sequence (5'-PuCGAAA(A)-3') is found in the ends of many class II prokaryotic transposable elements. These elements, like phage Mu, cause 5 bp duplications at the site of element insertion, and transpose by a cointegrate mechanism. Using the band retardation assay, we have found that crude protein extracts containing overexpressed Mu transposase can form high-affinity protein-DNA complexes with Mu att R and the ends of the class II elements Tn 3 (right) and IS101. No significant protein-DNA complex formation was observed with DNA fragments containing the right end of the element IS102, or a non-specific pBR322 fragment of similar size. These results suggest that the Mu transposase protein can specifically recognize the ends of other class II transposable elements and that these elements may be evolutionarily related.     

Comparative evolution history of SINEs in Arabidopsis thaliana and Brassica oleracea: evidence for a high rate of SINE loss

Brassica oleracea and Arabidopsis thaliana belong to the Brassicaceae(Cruciferae) family and diverged 16 to 19 million years ago. Although the genome size of B. oleracea (approximately 600 million base pairs) is more than four times that of A. thaliana (approximately 130 million base pairs), their gene content is believed to be very similar with more than 85% sequence identity in the coding region. Therefore, this important difference in genome size is likely to reflect a different rate of non-coding DNA accumulation. Transposable elements (TEs) constitute a major fraction of non-coding DNA in plant species. A different rate in TE accumulation between two closely related species can result in significant genome size variations in a short evolutionary period. Short interspersed elements (SINEs) are non-autonomous retroposons that have invaded the genome of most eukaryote species. Several SINE families are present in B. oleracea and A. thaliana and we found that two of them (called RathE1 and RathE2) are present in both species. In this study, the tempo of evolution of RathE1 and RathE2 SINE families in both species was compared. We observed that most B. oleracea RathE2 SINEs are "young" (close to the consensus sequence) and abundant while elements from this family are more degenerated and much less abundant in A. thaliana. However, the situation is different for the RathE1 SINE family for which the youngest elements are found in A. thaliana. Surprisingly, no SINE was found to occupy the same (orthologous) genomic locus in both species suggesting that either these SINE families were not amplified at a significant rate in the common ancestor of the two species or that older elements were lost and only the recent (lineage-specific) insertions remain. To test this latter hypothesis, loci containing a recently inserted SINE in the A. thaliana col-0 ecotype were selected and characterized in several other A. thaliana ecotypes. In addition to the expected SINE containing allele and the pre-integrative allele (i.e. the "empty" allele), we observed in the different ecotypes, alleles with truncated portions of the SINE (up to the complete loss of the element) and of the immediate genomic flanking sequences. The absence of SINEs in orthologous positions between B. oleracea and A. thaliana and the presence in recently diverged A. thaliana ecotypes of alleles containing severely truncated SINEs suggest a very high rate of SINE loss in these species.     

Insertion sites and the terminal nucleotide sequences of the Tn4 transposon.

The nucleotide sequences at the ends of the Tn4 transposon (mercury spectinomycin and sulfonamide resistance) have been determined. They are inverted repeated sequences of 38 nucleotides with three mismatched base pairs. These sequences are strongly homologous with the terminal sequences of Tn501 (mercury resistance) but less so with those of Tn3 (ampicillin resistance). The Tn4 transposon generates pentanucleotide members (Tn3, Tn1000, Tn501, Tn551, IS2) with the exception of Tn1721 and bacteriophage Mu. Among the three Tn4 insertion sites examined here, two of them occurred near a nonanucleotide sequence in perfect homology with part of the terminal inverted-repeat sequence of Tn4 and the third insertion occurred near a sequence of partial homology to one end of Tn4. All three insertions were in the same orientation such that IRb is proximal to its homologous sequence on the recipient DNA.     

An analysis of retroposition in plants based on a family of SINEs from Brassica napus

The identification of a family of SINE retroposons dispersed in the genome of oilseed rape Brassica napus has provided the basis for an evolutionary analysis of retroposition in plants. The repetitive elements (called S1_Bn) are 170 by long and occupy roughly 500 loci by haploid genome. They present characteristic features of SINE retroposons such as a 3 terminal A-rich region, two conserved polymerase III motifs (box A and B), flanking direct repeats of variable sizes, and a primary and secondary sequence homology to several tRNA species. A consensus sequence was made from the alignment of 34 members of the family. The retroposon population was divided into five subfamilies based on several correlated sets of mutations from the consensus. These precise separations in subfamilies based on diagnostic mutations and the random distribution of mutations observed inside each subfamily are consistent with the master sequence model proposed for the dispersion of mammalian retroposons. An independent analysis of each subfamily provides strong evidence for the coexpression of at least three subfamily master sequences (SMS). In contrast to mammalian retroposition, diagnostic positions are not shared between SMS. We therefore propose that SMS were all derived from a general master sequence (GMS) and independently activated for retroposition after a variable period of random drift. Possible models for plant retroposition are discussed.Abbreviations SMS subfamily master sequence - GMS general master sequence Correspondence to: J.-M. Deragon     

The F-type 5' motif of mouse L1 elements: a major class of L1 termini similar to the A-type in organization but unrelated in sequence

It has previously been shown that the L1 family in the mouse (L1Md) contains two alternative 5' ends called the A- and F-type sequences (1,2). We show here that the F-type element is a major class of murine L1 elements and report on the details of organization of the 5' motif of these F-type elements. Although the A- and F-type 5' sequences share no detectable sequence homology the organization of an F-type 5' end is strikingly similar to that of an A-type. That is, the F-type 5' sequences consist of a tandem array of a small number of 206 bp monomers while the A-type 5' motif consists of a tandem array of 208 bp monomers. All of the A-type elements characterized to date have a truncated monomer at the 5' end of the array. Many of the F-type elements are also terminated at the 5' end by a truncated copy but unlike the A-type elements some F-type elements terminate with a monomer which is within a few nucleotides of being complete. In addition the F-type consensus sequence, in contrast to the A-type sequence, shows homology (70%) to the body of the L1Md starting at the position where the monomer joins the rest of the L1 element.     

Sequencing and expression of the second allele of the interleukin-1beta1 gene in rainbow trout (Oncorhynchus mykiss): identification of a novel SINE in the third intron

A lambda clone containing a rainbow trout IL-1beta1 gene was isolated by a PCR screening strategy from a genomic library cloned in lambda GEM-11, and an EcoRI fragment from this clone was fully sequenced, and contained 1680 bp 5'-flanking sequence, the whole IL-1beta1 gene open reading frame, and the 3'-flanking region with two potential poly A signals and poly A sites. This clone encoded a protein that shared 99.8% identity to the previously published trout IL-1beta1 cDNA sequence, with only three base substitutions. The main difference was that this clone had an additional complete HpaI SINE insertion in the 3rd intron making intron III 211 bp larger (834 bp via 623 bp). Thus this sequence was designated as allele B (Big intron III) of IL-1beta1 and the previously reported sequence as allele S (Short intron III). Three lines of evidence (allele specific PCR, cloning and sequencing, and direct sequencing of PCR products) revealed that allele B was constitutively expressed and could respond to stimulation with lipopolysaccharide or trout recombinant IL-1beta. Searching of the GenBank database with the HpaI SINE sequence resulted in three additional HpaI loci being identified in rainbow trout. Another SINE retroposition was also identified in the same intron of both alleles of IL-1beta1 by comparison with the trout IL-1beta2 gene. This novel SINE sequence, sharing high homology with the HpaI SINE at the 3'-end region, is present in EST databases of several species including human, mouse and fish. The consensus of this novel SINE shares 57 to 61% identities to tRNA-Leu from different species. Another older retroposition event in the same intron of IL-1beta1 has also been hypothesised, recognised as six adenines, that may function as a RNA polIII terminator. A model for the IL-1beta1 allele formation is proposed. Following the earliest retroposition into one of the two IL-1beta genes that resulted from a genome duplication in salmonids, the proper environment for successive PV SINE retroposition was created. A recent retroposition of the HpaI SINE in IL-1beta1 resulted in the formation of the two alleles of IL-1beta1. Examination of the SINEs insertion and their host gene microenvironments revealed that the SINE retroposition does not appear random, both in the site selection and the direction of insertion. The mechanism governing this outcome is discussed.