Nontemplate polymerization of free nucleotides into genetic elements by thermophilic DNA polymerase in vitro

DNA synthesis is the cornerstone of all life forms and is required to replicate and restore the genetic information. Usually, DNA synthesis is carried out only by DNA polymerases semiconservatively to copy preexisting DNA templates. We report here that DNA strands were synthesized ab initio in the absence of any DNA or RNA template by thermophilic DNA polymerases at (a) a constant high temperature (74°C), (b) alternating temperatures (94°C/60°C/74°C), or (c) physiological temperatures (37°C). The majority of the ab initio synthesized DNA represented short sequence blocks, repeated sequences, intergenic spacers, and other unknown genetic elements. These results suggest that novel DNA elements could be synthesized in the absence of a nucleic acid template by thermophilic DNA polymerases in vitro. Biogenesis of genetic information by thermophilic DNA polymerase-mediated nontemplate DNA synthesis may explain the origin of genetic information and could serve as a new way of biosynthesis of genetic information that may have facilitated the evolution of life.     

Creation of genetic information by DNA polymerase of the thermophilic bacterium Thermus thermophilus.

Genetic information encoded in a template of a genome is replicated in a complementary way by DNA polymerase or RNA polymerase with high fidelity; no creation of information occurs in this reaction unless an error occurs. We report here that DNA polymerase of the thermophilic bacterium Thermus thermophilus can synthesize up to 200 kb linear double-stranded DNA in vitro in the complete absence of added primer and template DNAs, indicating that genetic information is actively created by protein. This ab initio DNA synthesis occurs at 74 degrees C and requires magnesium ion. There is a lag time of approximately 1 h and then the reaction proceeds linearly. The synthesized DNAs have a variety of sequences; they are mostly tandem repetitive sequences, e.g. (CATGTATA) n , (TGTATGTATACATACATA) n and (TATACGTA) n . Some degenerate sequences of these basic repeat units are also found. The similar repetitive sequences are found in many natural genes. These results, together with similar results found using DNA polymerase of archaeon Thermococcus litoralis , suggest that creative, non-replicative synthesis of DNA by protein was a driving force for diversification of genetic information at a certain stage of the evolution of life on the early earth.     

Creation of genetic information by DNA polymerase of the archaeon Thermococcus litoralis: influences of temperature and ionic strength.

DNA polymerase of the archaeon Thermococcus litoralis can synthesize a long stretch of linear double-stranded DNA in the complete absence of added primer and template DNAs. This finding suggests that genetic information can potentially be created by protein. We report here the effects of temperature, ionic strength and pH on this ab initio DNA synthesis by the protein in vitro . When the temperature of the reaction was changed, the sequence of the product DNA changed markedly. For instance, the reaction products were (TAAT) n at 69 degrees C, (TATCCGGA) n at 84 degrees C and (TATCGCGATAGCGATCGC) n at 89 degrees C. The ionic strength of the reaction condition also affected the sequence: it was (TATCTAGA) n with 0 mM KCl, (TATATACG) n with 50 mM KCl and (TATAGTTATAAC) n with 100 mM KCl at 74 degrees C. When the pH of the reaction condition was changed from 6.8 to 10.8, the size of the product DNA decreased, but its sequence did not. These results demonstrate that DNA synthesized ab initio by DNA polymerase of T.litoralis is markedly influenced by the reaction conditions. The results also suggest that genetic information that might have been created by protein on the early earth is strongly influenced by environmental factors.     

Mechanisms of Dealing with DNA Damage-Induced Replication Problems

During every S phase, cells need to duplicate their genomes so that both daughter cells inherit complete copies of genetic information. Given the large size of mammalian genomes and the required precision of DNA replication, genome duplication requires highly fine-tuned corrective and quality control processes. A major threat to the accuracy and efficiency of DNA synthesis is the presence of DNA lesions, caused by both endogenous and exogenous damaging agents. Replicative DNA polymerases, which carry out the bulk of DNA synthesis, evolved to do their job extremely precisely and efficiently. However, they are unable to use damaged DNA as a template and, consequently, are stopped at most DNA lesions. Failure to restart such stalled replication forks can result in major chromosomal aberrations and lead to cell dysfunction or death. Therefore, a well-coordinated response to replication perturbation is essential for cell survival and fitness. Here we review how this response involves activating checkpoint signaling and the use of specialized pathways promoting replication restart. Checkpoint signaling adjusts cell cycle progression to the emergency situation and thus gives cells more time to deal with the damage. Replication restart is mediated by two pathways. Homologous recombination uses homologous DNA sequence to repair or bypass the lesion and is therefore mainly error free. Error-prone translesion synthesis employs specialized, low fidelity polymerases to bypass the damage.     

Pressure enhances thermal stability of DNA polymerase from three thermophilic organisms

DNA polymerases derived from three thermophilic microorganisms, Pyrococcus strain ES4, Pyrococcus furiosus, and Thermus aquaticus, were stabilized in vitro by hydrostatic pressure at denaturing temperatures of 111°C, 107.5°C, and 100°C (respectively). Inactivation rates, as determined by enzyme activity measurements, were measured at 3, 45, and 89 MPa. Half-lives of P. strain ES4, P. furiosus, and T. aquaticus DNA polymerases increased from 5.0, 6.9, and 5.2 minutes (respectively) at 3 MPa to 12, 36, and 13 minutes (respectively) at 45 MPa. A pressure of 89 MPa further increased the half-lives of P. strain ES4 and T. aquaticus DNA polymerases to 26 and 39 minutes, while the half-life of P. furiosus DNA polymerase did not increase significantly from that at 45 MPa. The decay constant for P. strain ES4 and T. aquaticus polymerases decreased exponentially with increasing pressure, reflecting an observed change in volume for enzyme inactivation of 61 and 73 cm³/mol, respectively. Stabilization by pressure may result from pressure effects on thermal unfolding or pressure retardation of unimolecular inactivation of the unfolded state. Regardless of the mechanism, pressure stabilization of proteins could explain the previously observed extension of the maximum temperature for survival of P. strain ES4 and increase the survival of thermophiles in thermally variable deep-sea environments such as hydrothermal vents. Received: September 12, 1997 / Accepted: February 24, 1998     

A DNA polymerase from a thermoacidophilic archaebacterium: evolutionary and technological interests

The archaebacteria constitute a group of prokaryotes with an intermediate phylogenetic position between eukaryotes and eubacteria. The study of their DNA polymerases may provide valuable information about putative evolutionary relationships between prokaryotic and eukaryotic DNA polymerases. As a first step towards this goal, we have purified to near homogeneity a DNA polymerase from the thermoacidophilic archaebacterium Sulfolobus acidocaldarius. This enzyme is a monomeric protein of 100 kDa which can catalyze DNA synthesis using either activated calf thymus DNA or oligonucleotide-primed single-stranded DNA as a template. The activity is optimal at 70 degrees C and the enzyme is thermostable up to 80 degrees C; however, it can still polymerize up to 200 nucleotides at 100 degrees C. These remarkable thermophilic properties and thermostability permit examination of the mechanism of DNA synthesis under conditions of decreased stability of the DNA helix. Furthermore, these properties make S. acidocaldarius DNA polymerase a very efficient enzyme to be used in DNA amplification by the recently developed polymerase chain reaction method (PCR) as well as in the Sanger DNA sequencing technique.     

Coordinated leading and lagging strand synthesis during SV40 DNA replication in vitro requires PCNA

Proliferating cell nuclear antigen (PCNA) is a cell cycle and growth regulated protein required for replication of SV40 DNA in vitro. Its function was investigated by comparison of the replication products synthesized in its presence or absence. In the completely reconstituted replication system that contains PCNA, DNA synthesis initiates at the origin and proceeds bidirectionally on both leading and lagging strands around the template DNA to yield duplex, circular daughter molecules. In contrast, in the absence of PCNA, early replicative intermediates containing short nascent strands accumulate. Replication forks continue bidirectionally from the origin, but surprisingly, only lagging strand products are synthesized. Thus two stages of DNA synthesis have been defined, with the second stage requiring PCNA for coordinated leading and lagging strand synthesis at the replication fork. We suggest that during eukaryotic chromosome replication there is a switch to a PCNA-dependent elongation stage that requires two distinct DNA polymerases.     

DNA polymerases β and λ as potential participants of TLS during genomic DNA replication on the lagging strand

The main strategy used by pro-and eukaryotic cells for replication of damaged DNA is translesion synthesis (TLS). Here, we investigate the TLS process catalyzed by DNA polymerases β and λ on DNA substrates using mono-or dinucleotide gaps opposite damage located in the template strand. An analog of a natural apurinic/apyrimidinic site, the 3-hydroxy-2-hydroxymetylthetrahydrofuran residue (THF), was used as damage. DNA was synthesized in the presence of either Mg²⁺ or Mn²⁺. DNA polymerases β and λ were able to catalyze DNA synthesis across THF only in the presence of Mn²⁺. Moreover, strand displacement synthesis was not observed. The primer was elongated by only one nucleotide. Another unusual aspect of the synthesis is that dTTP could not serve as a substrate in all cases. dATP was a preferential substrate for synthesis catalyzed by DNA polymerase β. As for DNA polymerase λ, dGMP was the only incorporated nucleotide out of four investigated. Modified on heterocyclic base photoreactive analogs of dCTP and dUTP showed substrate specificity for DNA polymerase β. In contrast, the dCTP analog modified on the exocyclic amino group was a substrate for DNA polymerase λ. We also observed that human replication protein A inhibited polymerase incorporation by both DNA polymerases β and λ on DNA templates containing damage.     

Thermostable DNA polymerases can perform translesion synthesis using 8-oxoguanine and tetrahydrofuran-containing DNA templates

The translesion synthesis (TLS) capacity of the thermostable DNA polymerases Taq, Tte and Tte-seq utilizing a synthetic abasic site, tetrahydrofuran (THF), and an 8-oxoguanine-containing DNA template was investigated. Measurements with human DNA polymerase beta were used as a "positive control". Thermostable DNA polymerases were observed to perform TLS with different specificities on both substrates. With a THF-containing template, dGMP was preferentially inserted by all the DNA polymerases. In the presence of Mn(II) as a cofactor, all the polymerases incorporated dCMP opposite 8-oxoguanine whereas, in the presence of Mg(II) ions, dAMP was incorporated. It was found that none of the thermophilic DNA polymerases utilized dTTP with either an 8-oxoguanine or a THF-containing template. In all cases, DNA duplex containing THF as damage was processed to full length less effectively than DNA duplex containing 8-oxoguanine.     

Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.     

De novo DNA synthesis by human DNA polymerase lambda, DNA polymerase mu and terminal deoxyribonucleotidyl transferase

DNA polymerases (pols) catalyse the synthesis of DNA. This reaction requires a primer-template DNA in order to grow from the 3'OH end of the primer along the template. On the other hand terminal deoxyribonucleotidyl transferase (TdT) catalyses the addition of nucleotides at the 3'OH end of a DNA strand, without the need of a template. Pol lambda and pol micro are ubiquitous enzymes, possess both DNA polymerase and terminal deoxyribonucleotidyl transferase activities and belong to pol X family, together with pol beta and TdT. Here we show that pol lambda, pol micro and TdT, all possess the ability to synthesise in vitro short fragments of DNA in the absence of a primer-template or even a primer or a template in the reaction. The DNA synthesised de novo by pol lambda, pol micro and TdT appears to have an unusual structure. Furthermore we found that the amino acid Phe506 of pol lambda is essential for the de novo synthesis. This novel catalytic activity might be related to the proposed functions of these three pol X family members in DNA repair and DNA recombination.     

Eukaryotic error-prone DNA polymerases: The presumed roles in replication, repair, and mutagenesis

A number of error-prone DNA polymerases have been found in various eukaryotes, ranging from yeasts to mammals, including humans. According to partial homology of the primary structure, they are grouped into families B, X, and Y. These enzymes display a high infidelity on an intact DNA template, but they are accurate on a damaged template. Error-prone DNA polymerases are characterized by probabilities of base substitution or frameshift mutations ranging from 10^?3 to 7.5 · 10^?1 in an intact DNA, whereas the spontaneous mutagenesis rate per replicated nucleotide varies between 10^?10 and 10^?12. Low-fidelity polymerases are terminal deoxynucleotidyl transferase (TdT) and DNA polymerases β, ζ, κ, η, ι, λ, μ, and Rev1. The main characteristics of these enzymes are reviewed. None of them exhibits proofreading 3′ → 5′ exonuclease (PE) activity. The specialization of these polymerases consists in their capacity for synthesizing opposite DNA lesions (not eliminated by the numerous repair systems), which is explained by the flexibility of their active centers or a limited ability to express TdT activity. Classic DNA polymerases α, δ, ε, and γ cannot elongate primers with mismatched nucleotides at the 3′-end (which leads to replication block), whereas some specialized polymerases can catalyze this elongation. This is accompanied by overcoming the replication block, often at the expense of an increased mutagenesis rate. How can a cell exist under the conditions of this high infidelity of many DNA polymerase activities? Not all tissues of the body contain a complete set of low-fidelity DNA polymerases, although some of these enzymes are vitally important. In addition, cells “should not allow” error-prone DNA polymerases to work on undamaged DNA. After a lesion on the DNA template is bypassed, the cell should switch over from DNA synthesis catalyzed by specialized polymerases to the synthesis catalyzed by relatively high-fidelity DNA polymerases δ and ? (with an error frequency of 10^?5 to 10^?6) as soon as possible. This is done by forming complexes of polymerase δ or ? with proliferating cell nuclear antigen (PCNA) and replication factors RP-A and RF-C. These highly processive complexes show a greater affinity to correct primers than specialized DNA polymerases do. The fact that specialized DNA polymerases are distributive or weakly processive favors the switching. The fidelity of these polymerases is increased by the PE function of DNA polymerases δ and ε, as well as autonomous 3′ → 5′ exonucleases, which are widespread over the entire phylogenetic tree of eukaryotes. The exonuclease correction decelerates replication in the presence of lesions in the DNA template but increases its fidelity, which decreases the probability of mutagenesis and carcinogenesis.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Highly accurate synthesis of the fully 2′-fluoro-modified oligonucleotide by Therminator DNA polymerases

Oligonucleotides composed of natural nucleotides are inapplicable for biotechnical and therapeutic use due to its instability under biological conditions. Therminator DNA polymerases, mutant DNA polymerases of thermophilic marine archaea, show that they can efficiently synthesize fully 2′-fluoro-modified (2′F-) oligonucleotides. Furthermore, the sequence analysis reveals that the oligonucleotide sequence is highly accurate, especially the fidelity of a 2′F-oligonucleotide synthesized by Therminator II is more accurate than that of natural RNA synthesized by conventional RNA polymerase. These finding would be helpful for the synthesis of chemically modified oligonucleotides, for the use of biotechnical or medical applications.     

The eukaryotic replisome tolerates leading‐strand base damage by replicase switching

The high‐fidelity replicative DNA polymerases, Pol ε and Pol δ, are generally thought to be poorly equipped to replicate damaged DNA. Direct and complete replication of a damaged template therefore typically requires the activity of low‐fidelity translesion synthesis (TLS) polymerases. Here we show that a yeast replisome, reconstituted with purified proteins, is inherently tolerant of the common oxidative lesion thymine glycol (Tg). Surprisingly, leading‐strand Tg was bypassed efficiently in the presence and absence of the TLS machinery. Our data reveal that following helicase–polymerase uncoupling a switch from Pol ε, the canonical leading‐strand replicase, to the lagging‐strand replicase Pol δ, facilitates rapid, efficient and error‐free lesion bypass at physiological nucleotide levels. This replicase switch mechanism also promotes bypass of the unrelated oxidative lesion, 8‐oxoguanine. We propose that replicase switching may promote continued leading‐strand synthesis whenever the replisome encounters leading‐strand damage that is bypassed more efficiently by Pol δ than by Pol ε.     

The hyperthermophilic euryarchaeota Pyrococcus abyssi likely requires the two DNA polymerases D and B for DNA replication

DNA polymerases carry out DNA synthesis during DNA replication, DNA recombination and DNA repair. During the past five years, the number of DNA polymerases in both eukarya and bacteria has increased to at least 19 and multiple biological roles have been assigned to many DNA polymerases. Archaea, the third domain of life, on the other hand, have only a subset of the eukaryotic-like DNA polymerases. The diversity among the archaeal DNA polymerases poses the intriguing question of their functional tasks. Here, we focus on the two identified DNA polymerases, the family B DNA polymerase B (PabpolB) and the family D DNA polymerase D (PabpolD) from the hyperthermophilic euryarchaeota Pyrococcus abyssi. Our data can be summarized as follows: (i) both Pabpols are DNA polymerizing enzymes exclusively; (ii) their DNA binding properties as tested in gel shift competition assays indicated that PabpolD has a preference for a primed template; (iii) PabPolD is a primer-directed DNA polymerase independently of the primer composition whereas PabpolB behaves as an exclusively DNA primer-directed DNA polymerase; (iv) PabPCNA is required for PabpolD to perform efficient DNA synthesis but not PabpolB; (v) PabpolD, but not PabpolB, contains strand displacement activity; (vii) in the presence of PabPCNA, however, both Pabpols D and B show strand displacement activity; and (viii) we show that the direct interaction between PabpolD and PabPCNA is DNA-dependent. Our data imply that PabPolD might play an important role in DNA replication likely together with PabpolB, suggesting that archaea require two DNA polymerases at the replication fork.     

Multiple interlinked mechanisms to circumvent DNA replication roadblocks

DNA replication is a fragile process, since unavoidable lesions in the template DNA cause replicative polymerases to stall, posing a serious threat to genome integrity. Homologous recombination, translesion DNA synthesis and de novo reinitiation of DNA synthesis ensure robust replication by navigating it passed damaged DNA. In this review, we highlight the relationship between these three processes.     

Pyrosequencing for the quantitative assessment of 8-oxodG bypass DNA synthesis

Translesion synthesis (TLS) with specialized DNA polymerases allows dealing with a base lesion on the template strand during DNA replication; a base is inserted opposite the lesion, correctly or incorrectly, depending on the lesion, the involved DNA polymerase(s) and the sequence context. The major oxidized DNA base 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG) is highly mutagenic due to its ability to pair with either cytosine or adenine during DNA synthesis, depending on its conformation and involved DNA polymerases. To measure the correct or mutagenic outcome of lesion bypass, an original quantitative pyrosequencing method was developed and analytically validated. The method was applied to the study of DNA synthesis fidelity through an 8-oxodG or an undamaged guanine. After an in vitro primer-extension through 8-oxodG in the presence of the four deoxynucleotides triphosphates and a total nuclear protein extract, obtained from normal human intestinal epithelial cells (FHs 74 Int cell line), the reaction products were amplified by polymerase chain reaction and analyzed by pyrosequencing to measure nucleotides inserted opposite the lesion. The 8-oxodG bypass fidelity of FHs 74 Int cells nuclear extract is about 85.3%. We calculated within-day and total precisions for both 8-oxodG (2.8% and 2.8%, respectively) and undamaged templates (1.0% and 1.1%, respectively). We also demonstrated that only cytosine is incorporated opposite a normal guanine and that both cytosine and adenine can be incorporated opposite an 8-oxodG lesion. The proposed method is straightforward, fast, reproducible and easily adaptable to other sequences and lesions. It thus has a wide range of applications in the biological field, notably to elucidate TLS mechanisms and modulators.