Synthetic studies on formamidopyrimidines related to clofarabine

Degradation of clofarabine (3) in 0.9% saline solution at 100 degrees C afforded three degradation products which were determined to be formamidopyrimidines 4-6. Compounds 4 and 5 were assigned as C(1') anomers on the basis of one-dimensional and two-dimensional NMR experiments, whereas 6 was found to be the formamidopyrimidine lacking the sugar moiety. An improved procedure for the synthesis of formamidopyrimidines was developed, wherein benzoylated clofarabine (11) was treated with allyl chloroformate, followed by deprotection of the alloc group with catalytic Pd(PPh(3))(4) and dimedone. A synthesis of compound 6 from 4 is also described.     

Convenient Syntheses of 6-Methylpurine and Related Nucleosides

Abstract

Efficient methods for the synthesis of 6-methylpurine (3), 9-(2-deoxy-β-D-erythro-pentofuranosyl)-6-methylpurine (8), and 6-methyl-9-β-D-ribofuranosylpurine (5) are described. Methodology involving the (Ph₃P)₄Pd catalyzed cross-coupling reaction of CH₃ZnBr with several different 6-chloropurine derivatives is described in high yield. This methodology now provides a facile and high-yielding synthesis of 8, which is needed in significant amounts for studies in cancer gene therapy.     

Synthesis of 2′,3′-Dideoxy- and 3′-Azido-2′,3′-dideoxy-pyridazine Nucleosides as Potential Antiviral Agents

Abstract

The synthesis of 4-methoxy-, 4-amino-3-chloro-, and 4-amino-1-(2,3-dideoxy-B-D-glycero-pentofuranosyl)pyridazin-6-one nucleosides, 6,19 and 20 is described. The synthesis of 3,4-dichloropyridazin-6-one (10) was accomplished in 44% overall yield using bromomaleic anhydride (17) as the starting material. The condensation of the silylated base of 10 with the halogenose 12 in the presence of trimethylsilyl triflate as a catalyst afforded a mixture of3,4-dichloro-1-(3,5-di-O-p-toluoyl-2-deoxy-B-D-erythro-pentofuranosyl)pyrridazin-6-one (13) in 67% and its α-anomer 14 in 12% yield, respectively. A series of 3′-sulfonate esters were prepared to explore the synthesis of 3-chloro-4-hydroxy-1-(3-azido-2,3-dideoxy-B-D-erythro-pentofuranosyl) pyridazin-6-one (32) via 6,3-anhydronucleoside analogues. Compounds 15, 19 and 20 were evaluated against human immunodeficiency virus, human cytomegalovirus, and herpes simplex virus type 1 but were inactive.     

Acid-labile handles for Fmoc solid-phase synthesis of peptide N-alkylamides

Summary By analogy to established methodology for the preparation of C-terminal peptide amides by 9-fluorenylmethyl-oxycarbonyl (Fmoc) chemistry, in conjunction with the acidolyzable 5-(4-Fmoc-aminomethyl-3,5-dimethoxyphenoxy)valeric acid (PAL, 1) handle, the present paper reports on 5-(4-(N-Fmoc-N-alkyl)aminomethyl-3,5-dimethoxyphenoxy)valeric acid [(R)PAL, 2] handles that can be used for synthesis of peptide N-alkylamides. The key step in the preparation of these handles was the NaBH₃CN-mediated reductive amination (60 to 85% yields; R=CH₃, CH₃CH₂, C₆H₅CH₂CH₂, 4-NO₂C₆H₅) of 5-(4-formyl-3,5-dimethoxyphenoxy)valeric acid (4), an aldehyde precursor to PAL. The (R)PAL handles (2a and b) were applied to the preparation of LHRH analogues. After anchoring of handles to PEG-PS supports, peptide chain assemblies were carried out, and treatments with TFA-thioanisolephenol-1,2-ethanedithiol (87:5:5:3) for 90 min at 25 °C, followed by aqueous workups, provided the expected products in excellent yields and purities as supported by HPLC and mass spectrometric characterization.Taken in part from the Ph.D. Thesis of M.F. Songster, University of Minnesota, 1996. Preliminary reports of this work were presented at the 14th American Peptide Symposium, Columbus, OH, June 18–23, 1995 (poster P047), and at the Fourth International Symposium on Solid Phase Synthesis and Combinatorial Chemical Libraries, Edinburgh, Scotland, UK, September 12–16, 1995.     

A Simple Synthesis of 5-Amino-4-imidazolecarboxamide Riboside-5′-Tri-Phosphate: The Proposed Alarmone for 10-Formyl-tetrahydrofolate Deficiency

Abstract

A short synthesis of the title compound (1) from the nucleo-side, 5-amino-4-imidazolecarboxamide riboside (2), is reported, Treatment of 2 with phosphorus oxychloride (POCl₃) in trimethyl phosphate (PO(OCH₃)₃), followed by the addition of bis-tri-n-butylammonium pyrophosphate and finally hydrolysis, gave 1 in good overall yield. This synthesis confirms the structure of 1 as proposed and further demonstrates the utility of this triphosphorylation procedure.     

Rhodium(III) and iridium(III) complexes with 1,2-naphthoquinone-1-oximate as a bidentate ligand: synthesis,structure, and biological activity

The synthesis and characterization of three novel iridium(III) complexes and one rhodium(III) complex with 1-nitroso-2-naphthol (3) chelating as a 1,2-naphthoquinone-1-oximato ligand are described. The reaction of μ₂-halogenido-bridged dimers [(η⁵-C₅Me₅)IrX₂]₂ [X is Cl (1a), Br (1b), I (1c)] and [(η⁵-C₅Me₅)RhCl₂]₂ (2a) with 3 in CH₂Cl₂ yields the mononuclear complexes (η⁵-C₅Me₅)IrX(η²-C₁₀H₆N₂O) (4a, 4b, 4c) and (η⁵-C₅Me₅)RhCl(η²-C₁₀H₆N₂O) (5a). All compounds were characterized by their ¹H and ¹³C NMR, IR, and mass spectra, UV/vis spectra were recorded for 4a and 5a. The X-ray structure analyses revealed a pseudo-octahedral “piano-stool” configuration for the metals with bidentate coordination through oximato-N and naphthoquinone-O, forming a nearly planar five-membered metallacycle. The metal complexes 4a and 5a were evaluated in respect to their cytotoxicity and binding affinity toward double-stranded DNA. As determined in the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, both exerted a much stronger cytotoxic effect toward HeLa and HL60 cancer cell lines than did cisplatin. The remarkable cytotoxicity of the compounds tested may be attributed to necrosis, rather than to apoptosis, as it is evidenced by the caspase-3/7 activation assay. No clear evidence was found for interaction with double-stranded DNA. The melting experiments showed no significant differences between thermodynamic parameters of intact DNA and DNA incubated with 3, 4a, or 5a, although these derivatives altered DNA recognition by the BamHI restriction enzyme. Therefore, the screened iridium and rhodium complexes 4a and 5a may still be interesting as potential anticancer drugs owing to their high cytotoxicity toward cancer cell lines, whereas they do not modify DNA in a way similar to that of cisplatin.     

Ribosylation of the Base Residue of Inosine Derivatives by Phase-Transfer Catalysis

Abstract

Reaction of 2′,3′,5′-O-silylated inosine derivative 1 with 2, 3-O-isopropylidene-5-O-tritylribosyl chloride (3) in a two-phase (CH₂Cl₂-aq. NaOH) system in the presence of Bu₄NBr gave three products, i. e., 6-O-α-, 6-O-β-, and N ¹-β-isomers of glycosides 4, 5a, and 5b. A similar PTC reaction of 1 with 2, 3, 5-tri-O-benzylribosyl bromide (9) gave four regio- and stereo-isomers involving the N¹-β-glycoside 10. Reaction of 1 with 2, 3, 5-tri-O-benzoylribosyl bromide (11) afforded three products involving the desired N¹-β-glycoside 12b, which could be deprotected to give N ¹-ribosylinosine (15b) as a useful intermediate for the synthesis of cIDPR.

     

New κ-PNN′- and κ-PNN′O-polydentate ligands: Synthesis, coordination and structural studies

The three-step synthesis of new mixed P/N/N′/O-donor ligands C₆H₃(OH){2-NHC(O)CH₂NCHC₆H₄PPh₂}(4-CH₃) 3a·HH and C₆H₄(OH){3-NHC(O)CH₂NCHC₆H₄PPh₂} 3b·HH, by Schiff base condensation of the 1° amines C₆H₃(OH){2-NHC(O)CH₂NH₂}(4-CH₃) 2a or C₆H₄(OH){3-NHC(O)CH₂NH₂} 2b with C₆H₄(CHO)(2-PPh₂) in refluxing EtOH, is described. Reaction of 1 equiv. of 3a·HH or 3b·HH with MCl₂(cod) (M = Pt, Pd; cod = cycloocta-1,5-diene) affords the κ²-PN-chelate complexes MCl₂(3a·HH) (M = Pd 4a; M = Pt 4b) and MCl₂(3b·HH) (M = Pt 4c). The dichlorometal(II) complexes 4d and 4e, bearing instead a pendant 4-phenolic group, were similarly prepared (in >90% yield). Chloro-bridge cleavage of [Pd(μ-Cl)(η³-C₃H₅)]₂ with 3a·HH or 3b·HH gave the monocationic κ²-PN-chelate complexes [Pd(η³-C₃H₅)(3a·HH)]Cl 5a or [Pd(η³-C₃H₅)(3b·HH)]Cl 5b, respectively. Elimination of cod, and single CH₃ protonation, from Pt(CH₃)₂(cod) upon reaction with 1 equiv. of 3a·HH or 3b·HH in C₇H₈ at room temperature afforded the neutral complexes C₆H₃(OH){2-NC(O)CH₂NCHC₆H₄PPh₂Pt(CH₃)}(4-CH₃) 6a and C₆H₄(OH){3-NC(O)CH₂NCHC₆H₄PPh₂Pt(CH₃)} 6b, respectively bearing a monoanionic (3a·H⁻ or 3b·H⁻) κ³-PNN′-tridentate ligand. Amide and phenol deprotonation were readily achieved, using KO^tBu as base, to give high yields of the κ⁴-PNN′O-tetradentate complexes C₆H₃(O){2-NC(O)CH₂NCHC₆H₄PPh₂Pd}(4-CH₃) 7a and C₆H₃(O){2-NC(O)CH₂NCHC₆H₄PPh₂Pt}(4-CH₃) 7b bearing the dianionic ligand 3a²⁻. All new compounds have been characterised by multinuclear NMR, FTIR, mass spectroscopy and microanalysis. Single crystal X-ray studies have been performed on compounds 1b·1.5CH₂Cl₂, 3b·HH·0.5Et₂O, 6b·CHCl₃ and 7b·0.5Et₂O.     

New triterpene oligoglycosides from the Caribbean sponge Erylus formosus

Seven new triterpene glycosides, erylosides R₁ (1), T₁ (3), T₂ (4), T₃ (5), T₄ (6), T₅ (7), and T₆ (8) along with the known formoside (2) were isolated from the sponge Erylus formosus collected along the Caribbean coast of Mexico. Glycoside 1 was determined as a trisaccharide, glycoside 2 as a tetrasaccharide while glycosides 3–8 were hexasaccharide. Their carbohydrate chains were unprecedented and have never been found in oligosaccharides from other biological sources, except Erylus spp. Three carbohydrate chains in the glycosides 3 and 6, 4 and 7, 5 and 8 correspondingly are new. The glycosides 1–5 have penasterol as aglycone while glycosides 6–8 proved to be glycoconjugates of 24-methylene-14-carboxy-lanost-8(9)-en-3β-ol.     

A convenient method for the stereoselective preparation of 3-hydroxy-2-substituted propionaldehyde derivatives, C-terminal precursors for the synthesis of trans-alkene dipeptide isosteres

Summary (S)-3-hydroxy-2-substituted propionaldehyde dimethyl or diethyl acetals 3, which are versatile synthons in dipeptide isostere synthesis, were synthesized in 54–95% enantiomeric excess by reduction of (S,R)-acetalized acyloxazolidinones 7 with LiAlH₄.     

SYNTHESIS AND BIOLOGICAL EVALUATION OF SOME ACYCLIC α-(1H-PYRAZOLO[3,4-d]PYRIMIDIN-4-YL)THIOALKYLAMIDE NUCLEOSIDES

ABSTRACT

The chemical synthesis of some acyclic α-(1H-pyrazolo[3,4-d]pyrimidin-4-yl)thioalkylamide nucleosides (10–12)a–c is described. The treatment of 1H-pyrazolo[3,4-d]pyrimidin-4-thione 1 with compounds 2a–c gave, regioselectively, ethyl α-(1H-pyrazolo[3,4-d]pyrimidin-4-yl)thioalkylates 3a-c, respectively. These heterocycles were alkylated, separately, with alkylating agents 4, 5 and 6 to give, regioselectively, the N₁-acyclic nucleosides (7-9)a-c which were deprotected to afford the desired products (10-12)a-c. All synthetic compounds were characterized on the basis of their physical and spectroscopic properties. The products (10-12)a–c were evaluated for their inhibitory effects against the replication of HIV-1 (III_B), HIV-2 (ROD), various DNA viruses, a variety of tumor-cell lines and M. tuberculosis. No marked biological activity was found.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Synthesis and Absolute Configuration of Pyriculol

A total synthesis of optically active pyriculol is described. The Wittig reaction between an aldehyde 19 and a triphenylphosphonium ylide 12 gave an intermediate 20. Successive treatment of 20 with p-toluenesulfonic acid, active manganese dioxide, and potassium carbonate gave (3′R,4′S)-pyriculol (23), which was identical with natural pyriculol (1) in all respects. From this synthesis, the absolute stereochemistry of pyriculol (1) was determined to be 2-[(3′R,4′S)-3′,4′-dihydroxy- (1′E,5′E)-1′,5′-heptadienyl]-6-hydroxybenzaldehyde     

Screening of bromotyramine analogues as antifouling compounds against marine bacteria

Rapid and efficient synthesis of 23 analogues inspired by bromotyramine derivatives, marine natural products, by means of CuSO₄-catalysed [3+2] alkyne–azide cycloaddition is described. The final target was then assayed for anti-biofilm activity against three Gram-negative marine bacteria, Pseudoalteromonas ulvae (TC14), Pseudoalteromonas lipolytica (TC8) and Paracoccus sp. (4M6). Most of the synthesised bromotyramine/triazole derivatives are more active than the parent natural products Moloka’iamine (A) and 3,5-dibromo-4-methoxy-β-phenethylamine (B) against biofilm formation by the three bacterial strains. Some of these compounds were shown to act as non-toxic inhibitors of biofilm development with EC₅₀ < 200 μM without any effect on bacterial growth even at high concentrations (200 μM).     

SYNTHESIS AND BIOLOGICAL ACTIVITY OF 4′-C-HYDROXYMETHYL-2′-FLUORO- D-ARABINOFURANOSYLPURINE NUCLEOSIDES

A series of 4′-C-hydroxymethyl-2′-fluoro-D-arabinofuranosylpurine nucleosides was prepared and evaluated for cytotoxicity. The details of a convenient synthesis of the carbohydrate precursor 4-C-hydroxymethyl-3,5-di-O-benzoyl-2-fluoro-α-D-arabinofuranosyl bromide (13) are presented. Proof of the structure and configuration at all chiral centers of the sugars and the nucleosides were obtained by proton NMR. All five target nucleosides were evaluated for cytotoxicity in human tumor cell lines. The 4′-C-hydroxymethyl clofarabine analogue (16β) showed slight cytotoxicity in CCRF-CEM leukemia cells.     

New natural cholinesterase inhibiting and calcium channel blocking quinoline alkaloids

During this study, one new coumarin; 7-O-β-D-glucopyranoside-2H-1-benzopyran-2-one (1) and three quinoline alkaloids; 3-hydroxy, 2, 2, 6-trimethyl–3, 4, 5, 6-tetrahydro-2H-pyrano[3,2-c] quinoline 5-one (2), ribalinine (3) and methyl isoplatydesmine (4) were isolated from the aerial parts of Skimmia laureola and their structures established by spectroscopic studies. Compounds 2-4 were found to be linear mixed type inhibitors of acetylcholinesterase (K_i = 110.0, 30.0 and 30.0 μM, respectively). Compounds 2 and 3 were also found to be linear mixed type inhibitors of butyrylcholinesterase, while compound 4 was a noncompetitive inhibitor of the enzyme (K_i = 90.0, 70.0 and 19.0 μM, respectively). The inhibition of acetyl- and butyryl-cholinesterase enzymes persists as the most promising therapeutic strategy for activating the impaired cholinergic functions in Alzheimer's disease and related dementias.

Compound 4 also showed dose-dependent spasmolytic activity in the isolated rabbit jejunum intestinal preparation by relaxing the spontaneous (EC₅₀ = 0.1 mg/mL) and K⁺-induced contractions (EC₅₀ = 0.4 mg/mL), suggesting that the spasmolytic effect of compound 4 is mediated through the blockade of voltage-dependent Ca^{2 +} channels.     

Novel achiral titanocene anti-cancer drugs synthesised from bis-<Emphasis Type="Italic">N</Emphasis>,<Emphasis Type="Italic">N</Emphasis>-dimethylamino fulvene and lithiated heterocyclic compounds

Abstract From the carbolithiation of 6-bis-N,N-dimethylamino fulvene (3a) and different ortho-lithiated heterocycles (furan, thiophene and N-methylpyrrole), the corresponding lithium cyclopentadienide intermediate (4a–c) was formed. These three lithiated intermediates underwent a transmetallation reaction with TiCl₄ resulting in bis-N,N-dimethylamino-functionalised titanocenes 5a–c. When these titanocenes were tested against LLC-PK cells, the IC₅₀-values obtained were of 240, and 270 μM for titanocenes 5b and 5c, respectively. The most cytotoxic titanocene in this paper, 5a with an IC₅₀-value of 36 μM was found to be approximately six times less cytotoxic than its mono-N,N-dimethylamino substituted analogue Titanocene C (IC₅₀ = 5.5 μM) and almost ten times less cytotoxic than cisplatin, which showed an IC₅₀-value of 3.3 μM, when tested on the LLC-PK cell line. Graphical abstract Bis-(bis- (N,N-dimethylamino)-2-(N′-methylpyrrolyl)methylcyclopentadienyl) titanium (IV) dichloride, {η⁵-C₅H₄-CH[N(CH₃)₂]₂[C₅H₃NCH₃]}₂TiCl₂ was synthesised starting from 6-bis-(N,N-dimethylamino) fulvene and 2-N-methylpyrrolyl lithium. Herein, we present the synthesis and DFT structure of the titanocene and two further derivatives followed by MTT-based cytotoxicity tests on pig kidney epithelial (LLC-PK) cells. Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users.     

A Novel Imidazole Nucleoside Containing a Diaminodihydro-S-triazine as a Substituent: Inhibitory Activity Against the West Nile Virus NTPase/Helicase

The attempted synthesis of a ring-expanded guanosine (1) containing the imidazo[4,5-e][1,3]diazepine ring system by condensation of 1-(2′-deoxy-β-D-erythropentofuranosyl)-4-ethoxycarbonylimidazole-5-carbaldehyde (2) with guanidine resulted in the formation of an unexpected product, 1-(2′-deoxy-β-D-erythropentofuranosyl)-5-(2,4-diamino-3,6-dihydro-1,3,5-triazin-6-yl)imidazole-4-carboxamide (7). The structure as well as the pathway of formation of 7 was corroborated by isolation of the intermediate, followed by its conversion to the product. Nucleoside 7 showed promising in vitro anti-helicase activity against the West Nile virus NTPase/ helicase with an IC ₅₀ of 3-10 μg/mL.     

Manipulation of heterogeneity product in 4′-demethylepipodophyllotoxin biotransformation process by using yeast extract as nitrogen source

Manipulation of product heterogeneity was attempted by using yeast extract as nitrogen source in Alternaria alternata S-f6 transformation process of 4′-demethylepipodophyllotoxin. When the nitrogen source of NaNO₃ was replaced by yeast extract, the heterogeneity of biotransformation products was significantly varied from a single product (i.e., 4′-demethylpodophyllotoxone) to four podophyllum derivates. According to the kinetics of 4′-demethylepipodophyllotoxin biotransformation process by A. alternata S-f6, the starting substrate of 4′-demethylepipodophyllotoxin was preferentially transformed to produce 4′-demethylpodophyllotoxone (1) with an oxidation reaction. By the further comparison of products configuration, 4β-caprinoyl-4′-demethylepipodophyllotoxin (3) was produced from 4′-demethylpodophyllotoxone (1) instead of 4′-demethylisopicropodophyllone (2), which might be produced from 4′-demethylpodophyllotoxone (1) with the isomerization of lactone. Finally, 4′-demethylisopicropodophyllone (2) was hydrolyzed to produce 3α-hydroxymethyl-(6, 7)-dioxol-4-one-naphthalene (4). This work shows new information on the 4′-demethylepipodophyllotoxin biotransformation process by A. alternata S-f6 and provides a foundation for further studies on the structural diversification of a bioactive natural lead compound.     

Structure-activity study of phosphoramido acid esters as acetylcholinesterasf inhibitors

Phosphoramido acid esters (CH₃)₂NP(O)X(p-OC₆H₄-CH₃) (containing P-Cl (1), P-O (2), P-F (3), P-CN (5), and P-N (4,6) bonds, X for 2, 4 and 6 is OCH₃, (C₂H₅)₂N and morpholin) have been synthesized to investigate the structure-activity study of AChE enzyme inhibition, through the parameters logP, δ³¹P and IC₅₀. After their characterization by ³¹P, ³¹P{¹H}, ¹³C, ¹H NMR, IR and mass spectroscopy, the parameters logP and δ³¹P (³¹P chemical shift in NMR) were used to evaluated the lipophilicity and electronical properties. The ability of compounds to inhibit human AChE was predicted by PASS software (version 1.193), and experimentally evaluated by a modified Ellman's assay.