Synthesis of Modified Oligonucleotides and Production of Duplexes With Covalently Linked Chains

Abstract

A method has been devised to synthesize a DNA-duplex with covalently connected strands. Primary amino group located on one strand is linked to a carboxyl group of the other strand through the agency of a water soluble carbodiimide condensing agent. Conditions for the reaction between chains of a duplex composed of the modified oligonucleotides [1] were optimized. The thermal and hydrolytic stability of the cross linked duplex was examined.     

Synthesis and Properties of New Fluorescein-Labeled Oligonucleotides

Abstract

2,4-Dinitroaniline is an efficient intramolecular fluorescence-quencher for fluorescein - labeled oligonucleotides and interacts with the heterocyclic bases on duplex formation. Consequently, intramolecular fluorescence quenching is disturbed in double labeled oligonucleotides of this type, and fluorescein shows strong fluorescence in a duplex form. There is a substential increase of the fluorescence-quantum yield when the marker and quencher is attached to a single guanosine residue. Two kinds of doubly labeled oligonucleotides have been synthesized, using the NPE/NPEOC strategy.     

Conformational Study of DNA-RNA Duplexes Containing MMI Substituted Phosphodiester Linkages by FTIR Spectroscopy

Abstract

Six methylene(methylimino) (MMI, Bhat et al. J. Org. Chem., 61, 8186, 1996) linked oligonucleotides a-f (* = MMI linkage; 5′-GCGT*TT*TT*TT*TT*TGCG-3′) containing various combinations of 2′-O-methyl and 2′-fluoro substituent were synthesized as a model to study the global conformational change upon hybridization to the complement RNA. Fourier transform infrared (FTIR) spectroscopic technique has been used to study and compare the influence of these modifications on the solution conformation of 2′-modified MMI DNA-RNA duplexes. FTIR analysis of the single-stranded RNA (5′-CGCAAAAAAAAAACGC-3′) and the modified oligonucleotides a-f showed that all sugar residues adopted a C3′-endo conformation (North-type). Stable duplexes were formed when oligonucleotides a-f were hybridized to the complement RNA. These duplexes retained the original C3′-endo conformation for all sugar residues, hallmark of an A-form of duplex. We postulate that the observed preorganization of the sugar residues and oligonucleotides containing 2′-modified MMI modifications may play an important role in both improving the recognition of RNA target and enhancing the stability of duplex formation with RNA.     

Synthesis of Triple Helix Forming Oligonucleotides with a Stretched Phosphodiester Backbone

Abstract

Total synthesis of novel DMT-phosphoramidites of thymidine (11 and 15) and 2′-deoxyguanosine (8 and 20) have been accomplished. The utility of these modified building blocks in the preparation of triple helix forming oligodeoxyribonucleotides with a stretched phosphodiester backbone has been evaluated. It was found that the oligonucleotides with extended backbones were unable to enhance the binding to duplex targets containing CG or TA base pairs.     

Synthesis of Oligonucleotides Bearing Polyamine Groups for Recognition of DNA Sequences

Abstract

A 2-sperminoguanosine nucleotide has been synthesized and incorporated into oligonucleotides which showed increased duplex melting termperature.     

α-LNA (α-D-Configured Locked Nucleic Acid)

Abstract

Two pyrimidine α-LNA nucleoside monomers have been synthesised and incorporated into α-configured oligonucleotides. A fully modified mixed α-LNA sequence displays unprecedented parallel stranded hybridisation with complementary RNA and a remarkable selectivity for RNA over DNA. Modelling shows α-LNA : RNA to form an extended duplex with a very broad major groove.     

Approaches to Enhance the Binding Affinity and Nuclease Stability of Triplex Forming Oligonucleotides

Abstract

The ability of simple azole nucleosides to promote antiparallel triplex formation at non-homopurine duplex targets was explored. It was also shown that spermidine-cholesterol conjugation is effective in enhancing cellular uptake and stability of oligonucleotides.     

Synthesis of 2′-Spiro Ribo- and Arabinonucleosides

Abstract

Four conformationally restricted bicyclic 2′-spiro nucleosides were synthesised and incorporated into oligonucleotides. These spiro nucleotides induced decreased duplex thermostabilities.     

The Design and Synthesis of N 4-Anthraniloyl-2′-dC,the Improved Syntheses of N 4-Carbamoyl-and N4- Ureidocarbamoyl-2′-dC,Incorporation into Oligonucleotides and Triplex Formation Testing

Abstract

Three modified nucleosides were designed with the aim of achieving triplet formation with the CG base pair of duplex DNA. Direct anthraniloylation of 2′-deoxycytidine, using isatoic anhydride, afforded the novel N ⁴-anthraniloyl-2′-deoxycytidine. Much improved preparations of N ⁴-carbamoyl-2′-deoxycytidine and of N ⁴-ureidocarbonyl-2′-deoxycytidine were accomplished. The modified nucleosides were incorporated into oligonucleotides. Thermal denaturation studies and gel mobility shift analysis suggest that these nucleosides do not form base triplets with any of the four base pairs of DNA.     

Transition Metal Ligands as Novel DNA-Base Substitutes

Abstract

The base modified nucleoside dBP, carrying a non-hydrogen-bonding non-shape complementary base was incorporated into oligonucleotides (Brotschi, C.; Häberli, A.; Leumann C.J. Angew. Chem. Int. Ed. 2001, 40, 3012–3014). This base was designed to coordinate transition metal ions into well defined positions within a DNA double helix. Melting experiments revealed that the stability of a dBP: dBP base couple in a DNA duplex is similar to a dG: dC base pair even in the absence of transition metal ions. In the presence of transition metal ions, melting experiments revealed a decrease in duplex stability which is on a similar order for all metal ions (Mn²⁺, Cu²⁺, Zn²⁺, Ni²⁺) tested.     

SITE-DIRECTED ALKYLATION TO CYTIDINE WITHIN DUPLEX BY THE OLIGONUCLEOTIDES CONTAINING FUNCTIONAL NUCLEOBASES

We have previously described that oligonucleotides (ODN) containing phenylsulfoxide derivative of 2-amino-6-vinylpurine nucleoside analog (1) are activated within duplex to form cross-link toward cytidine selectively at the target site. In this paper, we wish to report the search for more stable precursor susceptible for activation within duplex.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Autoligation of Oligonucleotides via Nucleophilic Substitution Reaction

Abstract

A Fast and efficient template - driven autoligation reaction between oligonucleotides derivatized with bromoacetyl and thiol groups at their opposing termini is described. The product of reaction is capable of forming a stable duplex with a complementary DNA strand.     

Synthesis and Enzymatic Studies of Modified Oligonucleotides with Abiological Monomer Units

Abstract

The synthesis and the enzymatic studies of modified oligonucleotides containing a PNA modified PNA-DNA dimer block and a new acyclic racemic serinol nucleoside is described. We show that both, the PNA-DNA dimer block¹ and the modified PNA-spacer (acyclic serinol nucleoside)² can be used as modified templates for the enzymatic generation of single stranded DNA. Degradation studies of the oligonucleotides containing the PNA-DNA dimer block with snake venom phosphodiesterase show that the modified oligonucleotides are stable towards exonucleolytic degradation.     

Hoogsteen-Duplex DNA: Synthesis and Base Pairing of Oligodeoxynucleotides Containing 1-Deaza-2′-deoxyadenosine

Abstract

Solid-phase synthesis of oligonucleotides containing 1-deazaadenine was carried out employing phosphonate and phosphoramidite chemistry. Hoogsteen base pairing was established for the duplex d(c¹A₂₀)·d(T₂₀).     

Novel Hoogsteen-like Bases for Recognition of the C-G Base Pair by DNA Triplex Formation

Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides that bind duplex A-T or G-C base pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C⁺ ·G-C triplets. Here we report the successful modelling of novel unnatural nucleosides that recognize the C-G DNA base pair by Hoogsteen-like major groove interaction. These novel Hoogsteen nucleotides are examined within model A-type and B-type conformation triplex structures since the DNA triplex can be considered to incorporate A-type and/or B-type configurational properties. Using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration, a triplet comprised of a C-G base pair and the novel Hoogsteen nucleotide, Y2, replaces the central T·A-T triplet in the triplex. The presence of any structural or energetic perturbations due to the central triplet in the energy-minimized triplex is assessed with respect to the unmodified energy minimized (T·A-T)₁₁ starting structures. Incorporation of this novel triplet into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets.     

Pyrene is highly emissive when attached to the RNA duplex but not to the DNA duplex: the structural basis of this difference

Through binding and fluorescence studies of oligonucleotides covalently attached to a pyrene group via one carbon linker at the sugar residue, we previously found that pyrene-modified RNA oligonucleotides do not emit well in the single-stranded form, yet the attached pyrene emits with a significantly high quantum yield upon binding to a complementary RNA strand. In sharp contrast, similarly modified pyrene–DNA probes exhibit very weak fluorescence both in the double-stranded and single-stranded forms. The pyrene-modified RNA oligonucleotides therefore provide a useful tool for monitoring RNA hybridization. The purpose of this paper is to present the structural basis for the different fluorescence properties of pyrene-modified RNA/RNA and pyrene-modified DNA/DNA duplexes. The results of absorption, fluorescence anisotropy and circular dichroism studies all consistently indicated that the pyrene attached to the RNA duplex is located outside of the duplex, whereas the pyrene incorporated into the DNA duplex intercalates into the double helix. ¹H NMR measurements unambiguously confirmed that the pyrene attached to the DNA duplex indeed intercalates between the base pairs of the duplex. Molecular dynamics simulations support these differences in the local structural elements around the pyrene between the pyrene–RNA/RNA and the pyrene–DNA/DNA duplexes.     

Oligonucleotide analogues containing the internucleotide linker C3′-NH-CO-CH<Subscript>2</Subscript>-N(CH<Subscript>3</Subscript>)-C5′

Oligonucleotide analogues were synthesized whose internucleoside linker contains an amide bond and a methylamino group (C3′-NH-CO-CH₂-N(CH₃)-C5′). Melting curves for duplexes formed by modified oligonucleotides and natural oligonucleotides complementary to them were measured, and the melting temperatures and thermodynamic parameters of duplex formation were calculated. The introduction of one modified dinucleoside linker into the oligonucleotide only slightly decreases the melting temperatures of these duplexes compared with unmodified ones. The CD spectra of modified duplexes were studied, and their spatial structures are discussed.     

Synthesis and Stability of Oligonucleotide Duplexes Containing N4 Aralkyl-Substituted Cytosine Bases

Abstract

N4 aralkyl-substituted cytosine nucleosides, available dxectly by displacement of the PfpO group at C4 of 5′-O-DMT-protected nucleoside 4, were efficiently incorporated into short oligonucleotides. Aralkyl substitution at the N4 of cytosine was entropically stabilising but offset by loss in enthalpy resulting overall in duplex destabilisation.     

Inhibition of Tumor Necrosis Factor Alpha (TNFα) Expression and Function In Vitro by Modified Antisense Oligonucleotides

Abstract

Antisense oligonucleotides containing C-5 hexynyl/propynyl modified pyrimidines were synthesized using solid phase phosphoramidite chemistry. These modified oligonucleotides were found to have significant inhibitory activity against TNFα production in vitro.