Quantitation and mapping of aflatoxin B1-induced DNA damage in genomic DNA using aflatoxin B1-8,9-epoxide and microsomal activation systems

Aflatoxin B1 (AFB1) is a mutagenic and carcinogenic mycotoxin which may play a role in the etiology of human liver cancer. In vitro studies have shown that AFB1 adducts form primarily at the N7 position of guanine. Using quantitative PCR (QPCR) and ligation-mediated PCR (LMPCR), we have mapped total AFB1 adducts in genomic DNA treated with AFB1-8,9-epoxide and in hepatocytes exposed to AFB1 activated by rat liver microsomes or human liver and enterocyte microsomal preparations. The p53 gene-specific adduct frequencies in DNA, modified in cells with 40-400 microM AFB1, were 0.07-0.74 adducts per kilobase (kb). In vitro modification with 0. 1-4 ng AFB1-8,9-epoxide per microgram DNA produced 0.03-0.58 lesions per kb. The adduct patterns obtained with the epoxide and the different microsomal systems were virtually identical indicating that adducts form with a similar sequence-specificity in vitro and in vivo. The lesions were detected exclusively at guanines with a preference towards GpG and methylated CpG sequences. The methods utilizing QPCR and LMPCR thus provide means to assess gene-specific and sequence-specific AFB1 damage. The results also prove that microsomally-mediated damage is a suitable method for avoiding manipulations with very unstable DNA-reactive metabolites and that this damage can be detected by QPCR and LMPCR.     

A comparison of the DNA binding,cytotoxicity and repair synthesis induced in human fibroblasts by reactive derivatives of aromatic amide carcinogens

The cytotoxicity of three structurally-related direct-acting carcinogens, N-acetoxy-2-acetylaminofluorene, N-acetoxy-2-acetylaminophenanthrene and N-acetoxy-4-acetylaminobiphenyl, was compared in normal cells and in excision repair deficient xeroderma pigmentosum cells (XP12BE). All three proved significantly more cytotoxic to the XP cells than to the normal cells. At equicytoxic levels, substantially more residues were initially bound to the DNA of the normal cells than to the XP cells, suggesting that the former are able to remove a large percentage of the DNA bound residues before these can result in cell death. The ability of these cell strains to remove bound residues from DNA, to incorporate thymidine into parental strands of DNA during repair replication, and to recover from potentially lethal damage if held in the non-replicating, density-inhibited G_o state was compared as a function of dose and time. The XP12BE cells proved virtually incapable of excision repair of DNA damage induced by these carcinogens and of recovery. In contrast, normal cells recovered from the potentially lethal effects of these three compounds and did so at a rate comparable to their rate of removal of bound residues and of repair synthesis. In the excision-deficient XP12BE cells, DNA adducts induced by N-acetoxy-2-acetylaminophenanthrene proved 3- to 6-fold more cytotoxic than adducts induced by the other two carcinogens.     

Postreplication repair of DNA in human fibroblasts after UV irradiation or treatment with metabolites of benzo(a)pyrene

We have examined the ability of normal fibroblasts and of excision-deficient xeroderma pigmentosum (XP) and XP variant fibroblasts to perform postreplication DNA repair after increasing doses of either ultraviolet (UV) irradiation or mutagenic benzo(a)pyrene derivatives. XP cells defective in the excision of both UV-induced pyrimidine dimers and guanine adducts induced by treatment with the 7,8-diol-9,10-epoxides of benzo(a)pyrene were partially defective in their ability to synthesize high molecular weight DNA after the induction of both classes of DNA lesions. This defect was more marked in XP variant cells, despite their ability to remove by excision repair both pyrimidine dimers and the diol epoxide-induced lesions to the same degree as observed in normal cells. The benzo(a)pyrene 9,10-oxide had no effect in any of the 3 cell lines. The response of the excision and postreplication DNA repair mechanisms operating in human fibroblasts treated with benzo(a)pyrene 7,8-diol-9,10-epoxides, therefore, appears to resemble closely that seen after the induction of pyrimidine dimers by UV irradiation.     

Mapping the binding site of aflatoxin B1 in DNA: systematic analysis of the reactivity of aflatoxin B1 with guanines in different DNA sequences

The mutagenic and carcinogenic chemical aflatoxin B1 (AFB1) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB1 oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB1 oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB1 oxide prefers to react with guanines in some sequence contexts more than in others and has been referred to as "sequence specificity of binding". Herein, data on the reaction of AFB1 oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determined by high-pressure liquid chromatography. These results reveal that for AFB1 oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. The reactivities of 190 guanines were determined quantitatively and considered in a pentanucleotide context, 5'-WXGYZ-3', where the central, underlined G represents the reactive guanine and W, X, Y, and Z can be any of the nucleotide bases. Methods are developed to determine that the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. The influence of the bases in the 5'-position (X) is 5'-G (1.0) greater than C (0.8) greater than A (0.3) greater than T (0.2), while the influence of the bases in the 3'-position (Y) is 3'-G (1.0) greater than T (0.8) greater than C (0.4) greater than A (0.3). These rules in conjunction with molecular modeling studies (to be published elsewhere) were used to assess the binding sites that might be utilized by AFB1 oxide in its reaction with DNA.     

Sensitivity and single-strand DNA break repair in Chinese hamster mutants exposed to the carcinogen aflatoxin B1 epoxide and its dichloride model.

Aflatoxin B1 (AFB1) is a potent carcinogen and mutagen. It requires metabolic activation to be converted to the DNA-binding product aflatoxin B1 epoxide (AFB1-epoxide). A model of this epoxide is aflatoxin B1 dichloride (AFB1Cl2). Both react at the N7 position of guanine to form large adducts. The major adduct formed can either be rapidly removed to leave an apurinic site or can undergo ring opening of the imidazole ring to form a chemically stable adduct. A number of Chinese hamster DNA repair-deficient mutants have been screened for their sensitivity to AFB1-epoxide and AFB1Cl2. Some of the mutants screened belong to different UV complementation groups. Human genes involved in nucleotide excision-repair correct deficiencies found in these complementation groups. The mutants which were found to be most sensitive to AFB1 (V-C4 and V-H1) were further investigated. Alkaline elution was used to measure AFB1-induced DNA single-strand break repair in the mutants. V-H1 repaired completely in 24 h whereas V-C4 displayed only partial repair.     

Restricted repair of aflatoxin B1 induced damage in alpha DNA of monkey cells

We have investigated the processing of adducts formed by covalent binding of aflatoxin B1 (AFB1) to DNA in confluent cultures of African green monkey cells. Repair synthesis elicited by AFB1 adducts was deficient in alpha DNA sequences compared to that in bulk DNA, although the initial levels of modification were the same for these DNAs. The removal of the primary initial adduct, AFB1-N7-Guanine, was deficient in alpha DNA and the kinetics of its loss resembled those previously reported for removal from total DNA in xeroderma pigmentosum cells of complementation group A. Spontaneous loss of the AFB1 moiety or the concomitant loss of the guanine to yield an apurinic site account for these results. The formation of the more chemically stable secondary product, AFB1-triamino-Pyrimidine, occurred more rapidly and to a greater extent in alpha DNA than in bulk DNA, probably because of slower removal of the primary product. The excision repair patch size for AFB1 adducts in alpha DNA was only 10 nucleotides compared to 20 nucleotides for repair of AFB1 adducts in bulk DNA. Irradiation of cells with low doses of UV prior to or immediately after treatment with AFB1 increased the rate and extent of removal of AFB1 adducts from alpha DNA to the levels found in the bulk DNA, indicating that the formation of pyrimidine dimers or their repair may alter the chromatin structure of alpha DNA sufficiently to facilitate its repair.     

A viral genome containing an unstable aflatoxin B1-N7-guanine DNA adduct situated at a unique site.

A problem that has hindered the study of the biological properties of certain DNA adducts, such as those that form at the N7 atoms of purines, is their extreme chemical lability. Conditions are described for the construction of a single-stranded genome containing the chemically and thermally labile 8,9-dihydro-8- (N7-guanyl)-9-hydroxyaflatoxin B1 (AFB1-N7-Gua) adduct, the major DNA adduct of the potent liver carcinogen aflatoxin B1 (AFB1). A 13mer oligonucleotide, d(CCTCTTCGAACTC), was allowed to react with the exo-8,9-epoxide of AFB1 to form an oligonucleotide containing a single AFB1-N7-Gua (at the underlined guanine). This modified 13mer was 5'-phosphorylated and ligated into a gap in an M13 bacteriophage genome generated by annealing a 53mer uracil-containing scaffold to M13mp7L2 linearized by EcoRI. Following ligation, the scaffold was enzymatically removed with uracil DNA glycosylase and exonuclease III. The entire genome construction was complete within 3 h and was carried out at 16 degrees C, pH 6.6, conditions determined to be optimal for AFB1-N7-Gua stability. Characterization procedures indicated that the AFB1-N7-Gua genome was approximately 95% pure with a small (5%) contamination by unmodified genome. This construction scheme should be applicable to other chemically or thermally unstable DNA adducts.     

DNA excision-repair processes in human cells can eliminate the cytotoxic and mutagenic consequences of ultraviolet irradiation

The ability of DNA excision-repair processes in diploid human fibroblasts to eliminate potentially cytotoxic and mutagenic lesions induced by UV radiation (254 nm) was demonstrated in two ways: (1) Cells with normal rates of excision were compared with cells with an intermediate rate of excision (XP2BE) and cells with an excision rate less than or equal to 1% that of normal (XP12BE) for sensitivity to the killing and mutagenic action of UV radiation. The normal cells proved resistant to doses of UV which reduced the survival of the XP cells to 14% and 0.7%, respectively, and increased the frequency of mutations to 8-azaguanine resistance in the XP cells 5- to 10-fold over background. (2) Cells in confluence were irradiated with cytotoxic and mutagenic doses of UV and allowed to carry out excision repair. After various lengths of time they were replated at lower densities to allow for expression of mutations to 6-thioguanine resistance and/or at cloning densities to assay survival. Normal cells and XP cells with reduced rates of excision repair (from complementation groups C and D) exhibited a gradual increase in survival from an initial level of 15--20% to 100% if held approximately 20 h in confluence. In contrast, XP12BE cells showed no increase from an initial survival of 20% even when held for 7 days. Normal cells irradiated in confluence but prevented from replicating for 7 days exhibited background mutation frequencies, whereas the mutation frequency in XP12BE cells did not change with the time in confluence.     

DNA damage by mycotoxins

Mycotoxins are toxic fungal metabolites which are structurally diverse, common contaminants of the ingredients of animal feed and human food. To date, mycotoxins with carcinogenic potency in experimental animal models include aflatoxins, sterigmatocystin, ochratoxin, fumonisins, zearalenone, and some Penicillium toxins. Most of these carcinogenic mycotoxins are genotoxic agents with the exception of fumonisins, which is currently believed to act by disrupting the signal transduction pathways of the target cells. Aflatoxin B1 (AFB1), a category I known human carcinogen and the most potent genotoxic agent, is mutagenic in many model systems and produces chromosomal aberrations, micronuclei, sister chromatid exchange, unscheduled DNA synthesis, and chromosomal strand breaks, as well as forms adducts in rodent and human cells. The predominant AFB1-DNA adduct was identified as 8, 9-dihydro-8-(N7-guanyl)-9-hydroxy-AFB1 (AFB1-N7-Gua), which derives from covalent bond formation between C8 of AFB1-8,9-epoxides and N7 of guanine bases in DNA. Initial AFB1-N7-guanine adduct can convert to a ring-opened formamidopyrimidine derivative, AFB1-FAPY. The formation of AFB1-N7-guanine adduct was linear over the low-dose range in all species examined, and liver, the primary target organ, had the highest level of the adduct. Formation of initial AFB1-N7-guanine adduct was correlated with the incidence of hepatic tumor in trout and rats. The AFB1-N7-guanine adduct was removed from DNA rapidly and was excreted exclusively in urine of exposed rats. Several human studies have validated the similar correlation between dietary exposure to AFB1 and excretion of AFB1-N7-guanine in urine. Replication of DNA containing AFB1-N7-guanine adduct-induced G-->T mutations in an experimental model. Activation of ras protooncogene has been found in AFB1-induced tumors in mouse, rat, and fish. More strikingly, the relationship between aflatoxin exposure and development of human hepatocellular carcinoma (HHC) was demonstrated by the studies on the p53 tumor suppressor gene. High frequency of p53 mutations (G-->T transversion at codon 249) was found to occur in HHC collected from populations exposed to high levels of dietary aflatoxin in China and Southern Africa. Furthermore, AFB1-induced DNA damage and hepatocarcinogenesis in experimental models can be modulated by a variety of factors including nutrients, chemopreventive agents, and other factors such as food restriction and viral infection, as well as genetic polymorphisms.     

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.     

The repair of large DNA adducts in mammalian cells.

This paper describes experiments involving the measurement of DNA damage and repair after treatment with 4-nitroquinoline 1-oxide (4NQO) or aflatoxin B1 (AFB1) epoxide in a number of mammalian cell cultures primarily associated with defects in the excision repair of UV-induced DNA damage. The results with transformed derivatives of XP cells belonging to different complementation groups showed that the extent of repair of 4NQO adducts at the N2 or C8 of guanosine did not correlate to the extent of repair reported by others after UV-irradiation. An examination of 4NQO repair in rodent UV-sensitive cell lines from different ERCC groups indicated that again there was little correlation between the extent of 4NQO and UV repair. However, regardless of complementation group those mutants that were defective in the repair of pyrimidine dimers and 6,4-photoproducts did exhibit a reduced ability to repair the 4NQO N2 guanosine adduct, whereas those mutants defective in pyrimidine dimer repair alone were able to repair this lesion as normal. In all of these cell lines there was a normal capacity to repair the 4NQO C8 guanosine adduct. Less extensive experiments involving AFB1 epoxide showed an XPC-transformed cell line was able to repair 40% of lesions after 6 h, whereas only 20% of repair is seen after UV. The rodent mutant V-C4 which belongs to the same ionising radiation group as irs2, was partially defective in repairing AFB1-induced damage. These experiments highlight the fact that although there are many commonalities between the repair of UV damages and lesions classed as large DNA adducts differences clearly exist, the most striking example here being the repair of the C8 guanosine 4NQO adduct which rarely correlates with a defect in UV repair.     

Preferential carcinogen-DNA adduct formation at codons 12 and 14 in the human K-ras gene and their possible mechanisms

In the ras gene superfamily, codon 12 (-TGGTG-) of the K-ras gene is the most frequently mutated codon in human cancers. Recently, we have found that bulky chemical carcinogens preferentially form DNA adducts at codons 12 and 14 (-CGTAG-) in the K-ras gene in normal human bronchial epithelial (NHBE) cells. Furthermore, DNA adducts formed at codon 12 of the K-ras gene are poorly repaired compared with those at other codons including codon 14. These results suggest that targeted carcinogen-DNA adduct formation is a major reason for the observed high mutation frequency at codon 12 of the K-ras gene in human cancers. This preferential carcinogen-DNA adduct formation at codons 12 and 14 could result from effects of (1) primary sequences of these codons and their surrounding codons in the K-ras gene, (2) the chromatin structure, and/or (3) epigenetic factors such as C5 cytosine methylation or other DNA modifications at these codons and their surrounding codons. To distinguish these possibilities, we have introduced modifications with benzo[a]pyrene diol epoxide, N-hydroxy-2-aminofluorene, and aflatoxin B1 8,9-epoxide in (1) naked intact genomic DNA isolated from NHBE cells, (2) fragmented genomic DNA digested by restriction enzymes, and (3) in vitro synthesized DNA fragments containing the K-ras gene exon 1 sequence with or without methylation of the cytosines at CpG sites and the cytosines pairing with the guanines of codons 12 and 14. The distribution of carcinogen-DNA adducts in the K-ras gene was mapped at the nucleotide sequence level using the UvrABC nuclease incision method with or without the ligation-mediated polymerase chain reaction technique. We have found that carcinogens preferentially form adducts at codons 12 and 14 in the K-ras gene exon 1 in intact as well as in fragmented genomic DNA. In contrast, this preferential DNA adduct formation at codons 12 and 14 was not observed in PCR-amplified DNA fragments containing the K-ras gene exon 1 sequence. Methylation of the cytosine at the CpG site of codon 14, or the cytosine pairing with guanine of codon 14, greatly enhanced carcinogen-DNA adduct formation at codon 14 but did not affect carcinogen-DNA adduct formation at codon 12. Methylation of the cytosine pairing with the guanine of codon 12 also did not enhance carcinogen-DNA adduct formation at codon 12. Furthermore, we found that the cytosine at the CpG site of codon 14 is highly methylated in NHBE cells. These results suggest that cytosine methylation at the CpG site is the major reason for the preferential DNA damage at codon 14 and that epigenetic modification(s) other than cytosine methylation may contribute to the preferential DNA damage at codon 12 of the K-ras gene.     

Ability of adducts formed in a shuttle vector by reactive metabolites of 1-nitropyrene and benzo(a)pyrene to induce mutations when the plasmid replicates in human cells

An SV40-based shuttle vector, pZ189, carrying a bacterial suppressor tRNA target gene (supF), was treated with radiolabeled polycyclic aromatic carcinogens and the number of covalently bound residues (adducts) per plasmid was determined. The plasmids were transfected into human cell line 293, allowed to replicate, and the progeny plasmids rescued and assayed for the frequency of supF mutants. The agents tested were the 7,8-diol-9,10-epoxide of benzo(a)pyrene (BPDE) and 1-nitrosopyrene (1-NOP). With each agent there was a linear increase in the frequency of supF mutants as a function of the number of DNA adducts formed, reaching frequencies 15 to 25 times higher than the background frequency of 1.4 x 10(-4). When compared on the basis of adducts formed per plasmid BPDE, which forms its principal DNA adduct at the N2 position of guanine, was approximately four times more mutagenic than 1-NOP, which binds principally at the C8 position of guanine. This difference in mutagenic effectiveness may reflect intrinsic differences in the nature of the adducts and their location in the DNA molecule, but it could also reflect a difference in the rate of removal of particular adducts by nucleotide excision repair since the 293 host cell line excised BPDE-induced adducts from genomic DNA at least three times slower than 1-NOP-induced adducts. Agarose gel electrophoresis and DNA sequencing analysis of mutants derived from untreated plasmids showed that the majority (70%) involved deletions, insertions, or altered gel mobility (gross rearrangements). In contrast, the majority of those derived from carcinogen-treated plasmids were base substitutions. DNA sequencing of 86 unequivocally independent mutants derived from BPDE-treated plasmid and 60 from 1-NOP-treated plasmid indicated that 70% to 80% contained a single base substitution, 5%-10% had two base substitutions, and 4%-10% had small insertions or deletions (one or two basepairs). The majority (83%) of the base substitutions in mutants from BPDE- or 1-NOP-treated plasmid were transversions, mainly G.C----T.A. Each carcinogen produced its own spectrum of mutations.     

Mutagenic activity and DNA adduct formation by 1, 2-epoxy-3-(p-nitrophenoxy)propane, an HIV-1 protease inhibitor and GST substrate.

Acid protease inhibitor 1,2-epoxy-3-(p-nitrophenoxy)propane (ENPP) is commonly used in research as a substrate for glutathione-S-transferase activity (GST) and recently was found to inhibit human immunodeficiency virus 1 (HIV-1) protease. The question of DNA-adduct formation and mutagenicity was investigated and found that ENPP causes DNA damage and acts directly to induce mutagenicity in Salmonella. Using HPLC analysis, ENPP was shown to bind covalently to guanine residues. The Salmonella mutagenicity assay indicated that ENPP enhanced the mutation frequencies in the base-substitution strain TA00 by more than 20 times above the background. Its mutagenic potency was comparable to that of well-known carcinogens, N-methyl-N-nitrosourea (MNU) and aflatoxin B(1)-8,9-epoxide (AFB(1)-8,9-epoxide). The results suggest that ENPP should be classified as a mutagenic compound and a potential carcinogen.     

Relationship between excision repair and the cytotoxic and mutagenic effect of the ‘anti’ 7,8-diol-9,10-epoxide of benzo[a]pyrene in human cells

The cytotoxic and mutagenic effect of (±)-7β,8α-dihydroxy-9α,10α-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (anti BPDE) in normally excision diploid human cells treated just prior to onset of S was compared with that of cells allowed ～ 16 h for excision repair before onset of S and with that observed in excision-deficient serodema pigmentosum (SP12BE) cells. The cells were synchronized by release from density inhibition of cell replication. DNA synthesis began ～ 22 h after the cells were plated at lower density (i.e., 1.4 × 10⁴ cells/cm²). The frequency of thioguanine-resistant mutants induced in normal cells treated just prior to onset of S was ～ 12- to 16-fold higher than that observed in cells treated in early G₁ or treated in G₀ (confluence) and then plated at lower density. The frequency approximated that expected for XP12BE cells from extrapolation of data obtained at lower doses. The frequency of mutants measured in normal cells treated in exponential growth was also much higher than that in the cells treated in early G₁ or in G₀, No such difference could be seen in XP12BE cells treated in exponential growth or in G₀. In contrast to the mutagenicity data in the normal cells, there was no significant difference in the slope of the survival curve of normal cells treated at various times prior to S phase at low densities. However, normal cells treated even at the onset of S exhibited survival equal to XP12BE cells give a 4- to 5-fold lower dose. The data support the hypothesis that DNA synthesis is the cellular event which converts unexcised DNA lesions into mutations. However, they indicate that S is not the event primarily responsible for translating DNA damage into cell death. Accompanying studies on the rate of excision of anti BPDE adducts from the normal cells during the period priot to S support the conclusions.     

DNA replication-blocking properties of adducts formed by aflatoxin B1-2,3-dichloride and aflatoxin B1-2,3-oxide

The carcinogen aflatoxin B1 (AFB1), upon activation to a hypothesized AFB1-2,3-oxide (AFB1-oxide), reacts with DNA guanines. Aflatoxin B1-2,3-dichloride (AFB1-Cl2) was originally synthesized as an electronic analog for the putative AFB1-oxide, which has never been isolated due to presumed reactivity. We have previously shown that AFB1-oxide reacts with base-paired DNA guanines in a sequence-specific manner, as revealed by an alkali-degradation analysis. On the basis of a replication-block analysis, we have shown that AFB1-Cl2 reacts with single-stranded DNA preferentially at inverted repeat sequences, which were suggested to be capable of forming intrastrand base-paired structures. Here, we present data to show the following. Both AFB1-oxide and AFB1-Cl2 react with guanines in double-stranded DNA to induce similar sequence-specific, alkali-labile sites. Reactivity with partial DNA duplexes as well as the use of single-strand specific chemical probes directly demonstrates that AFB1-Cl2, like AFB1-oxide, prefers base-paired guanines over non-base-paired guanines. DNA replication block patterns induced by AFB1-oxide are essentially similar to those induced by AFB1-Cl2. Unexpectedly, and unlike other tested DNA lesions, Mn2+ does not appear to affect the template blocking properties of the adduct formed by AFB1-Cl2 or AFB1-oxide. The sites for replication stoppage as well as the lack of a Mn2+ effect on adducted templates have implications for the mechanisms of mutagenesis by activated AFB1.     

Comparing the frequency and spectra of mutations induced when an SV-40 based shuttle vector containing covalently bound residues of structurally-related carcinogens replicates in human cells

An SV40-based shuttle vector, pZ189, carrying a bacterial suppressor tRNA target gene (supF) was treated with radiolabeled polycyclic aromatic carcinogens and the number of covalently bound residues (adducts) per plasmid was determined. The plasmids were transfected into the human embryonic kidney cell line 293 and allowed to replicate. The progeny plasmids were rescued and assayed for the frequency of supF mutants by being used to transform indicator bacteria carrying an amber mutation in the beta-galactosidase gene. The agents tested were the 7,8-diol-9,10-epoxide of benzo[a]pyrene (BPDE); 1-nitrosopyrene (1-NOP); N-acetoxy-2-acetylaminofluorene (N-AcO-AAF); and its trifluoro-derivative (N-AcO-F3-AAF) which yields deacetylated adducts. With each agent there was a linear increase in the frequency of supF mutants as a function of the number of DNA adducts formed, reaching frequencies as high as 20 x 10(-4) to 40 x 10(-4), with a background frequency of 1.4 x 10(-4). When compared on the basis of adducts formed per plasmid, BPDE, which forms its principal DNA adduct at the N2 position of guanine, was approximately 4 times more mutagenic than 1-NOP, N-AcO-AAF and N-AcO-F3-AAF, which bind principally or exclusively to the C8 position of guanine. This difference in mutagenic effectiveness may reflect intrinsic differences in the nature of the adducts and their location in the DNA molecule. It could also reflect a difference in the rate of removal of particular adducts by nucleotide excision repair since the 293 host cell line excised BPDE-induced adducts from genomic DNA at least 3 times slower than 1-NOP-induced adducts. Agarose gel electrophoresis and DNA sequencing analysis of 35 mutants derived from untreated plasmids showed that the majority (70%) involved deletions, insertions, or altered gel mobility (gross rearrangements). In contrast, the majority of those derived from carcinogen-treated plasmids were base-substitutions. DNA-sequencing of 86 unequivocally independent mutants derived from BPDE-treated plasmids and 60 from 1-NOP-treated plasmids indicated that 60% and 80%, respectively, contained a single base-substitution, 5-10% had two base-substitutions, and 4-10% had small insertions or deletions (one or two base pairs).(ABSTRACT TRUNCATED AT 400 WORDS)     

Excision repair of UV- or benzo[a]pyrene diol epoxide-induced lesions in xeroderma pigmentosum variant cells is 'error free'

It is known that cells from one class of xeroderma pigmentosum (XP) patients, called XP variants, carry out excision repair of UV-induced DNA damage at a normal rate and are only slightly more sensitive than normal cells to the cytotoxic effect of UV radiation, but are much more sensitive to the mutagenic effect of UV. To see if this hypermutability were the result of an 'error-prone', excision repair process, we irradiated fibroblasts derived from an XP variant patient, XP4BE, under conditions that allowed the cells various lengths of time for excision repair before the onset of DNA synthesis (S phase) and assayed the frequency of 6-thioguanine (TG)-resistant mutants. Cells synchronized by release from confluence (G0 state) and irradiated just prior to S phase showed a dose-dependent increase in mutants at very high frequencies; cells irradiated in early G1, approximately 12 h before the onset of S phase, showed frequencies 4 times lower. Cells irradiated in the G0 state and allowed 24 h or 48 h for excision repair before the onset of S phase showed still lower frequencies. A comparison of the relative rates of decrease in mutant frequency with time for excision repair before the onset of S phase in XP variant cells and normal human fibroblasts after a dose of 4 or 6 J/m2 showed that these were equal. However, for every time point, the frequency of mutants induced per dose of UV was significantly higher in the XP variant population than in the normal, suggesting that the XP variant cells have an abnormally error-prone process of replicating DNA on a template containing unexcised lesions or normal cells are by-passing many of such lesions using an error-free process. A similar comparative study in synchronized populations of XP4BE cells and normal cells, using the anti 7,8-diol-9,10-epoxide of benzo[a]pyrene, showed that excision repair prior to the onset of S phase also decreased the frequency of mutants induced in XP variant cells by this agent. But for every dose and time point, the frequencies induced in XP4BE cells and normal cells were identical. Thus, the hypermutability of the XP4BE cells was specific to UV radiation-induced DNA lesions.     

Excision repair of DNA base damage in human cells treated with the chemical carcinogen 4-nitroquinoline 1-oxide.

Excision repair of DNA damage produced by 4-nitroquinoline 1-oxide (4NQO), a potent chemical carcinogen, was compared in a normal human amnion FL cell line and a xeroderma pigmentosum (XP) cell line unable to repair ultraviolet-induced pyramidine dimers. The main objective of this study was to investigate, by a direct assay of the loss of damage from DNA, whether DNA damage induced by 4NQO in human cells is repaired by the excision-repair system as in Escherichia coli cells. DNA was extracted from FL and XP cells treated with [³H]4NQO, hydrolyzed and subjected to radiochromatographic analysis in order to quantitate the initial formation of 4NQO damage and subsequent disappearance during post-incubation. Two peaks of stable 4NQO-quanine adducts appeared on the chromatogram, together with one peak of stable 4NQO-adenine adduct and a peak due to 4-aminoquinoline 1-oxide (4AQO) released from a labile fraction of 4NQO-guanine adduct during hydrolysis. The three kinds of stable 4NQO-purine adduct disappeared from DNA of the FL cells at almost the same rate of about 60% during 24-h post-incubation in culture medium, and 4AQO disappeared somewhat faster. In the XP cells, however, the stable adducts did not disappear from DNA, whereas about 40% of the 4AQO-releasing adduct disappeared from DNA. These findings at the molecular level quantitatively parallel the previous findings at the cellular level that the XP cells are several times as sensitive as normal cells to killing by 4NQO. These results lead to the conclusion that in human cells 4NQO-induced lethality is mainly due to the four kinds of 4NQO-purine adduct as it is in E. coli, and that the adducts are excisable by the same excision-repair mechanism that works on pyramidine dimers.     

Simulating structural and thermodynamic properties of carcinogen-damaged DNA

A pair of stereoisomeric covalent adducts to guanine in double-stranded DNA, derived from the reaction of mutagenic and tumorigenic metabolites of benzo[a]pyrene, have been well characterized structurally and thermodynamically. Both high-resolution NMR solution structures and an array of thermodynamic data are available for these 10S (+)- and 10R (-)-trans-anti -[BP]-N(2)-dG adducts in double-stranded deoxyoligonucleotides. The availability of experimentally well-characterized duplexes containing these two stereoisomeric guanine adducts provides an opportunity for evaluating the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) method for computing thermodynamic properties from molecular dynamics ensembles. We have carried out 3-ns molecular dynamics simulations, using NMR solution structures as the starting models for the 10S (+)- and 10R (-)-trans-anti-dG adducts in a DNA duplex 11-mer using AMBER 6.0. We employed the MM-PBSA method to compute the free energies, enthalpies, and entropies of the two adducts. Our complete thermodynamic analysis agrees quite well with the full experimental thermodynamic characterization of these adducts, showing essentially equal stabilities of the two adducts. We also calculated the nuclear Overhauser effect (NOE) distances from the molecular dynamics trajectories, and compared them against the experimental NMR-derived NOE distances. Our results showed that the simulated structures are in good agreement with the NMR experimental NOE data. Furthermore, the molecular dynamics simulations provided new structural and biological insights. Specifically, the puzzling observation that the BP aromatic ring system in the 10S (+)-trans-anti-dG adduct is more exposed to the aqueous solvent than the 10R (-)-trans-anti-dG adduct, is rationalized in terms of the adduct structures. The structural and thermodynamic features of these stereoisomeric adducts are also discussed in relation to their reported low susceptibilities to nucleotide excision repair.