Putative promoter region of rRNA operon from archaebacterium Halobacterium halobium.

The 100 bp sequence from the beginning of the 16S rRNA gene of archaebacterium Halobacterium halobium and the adjacent 800 bp upstream sequence were determined. Four long (80 bp) direct repeats were found in the region preceeding the structural gene of the 16S rRNA. These repeats are proposed to constitute the promoter region of the rRNA operon of H. halobium.     

Nucleic acid studies on halophilic archaebacteria

DNA-16S rRNA hybridization studies of archaebacterial halophiles revealed nine major groups. High (greater than 45%) DNA-DNA homologies were found only within DNA-rRNA groups. The DNA-DNA homology between the type strains of Halobacterium halobium, Hb. salinarium and Hb. cutirubrum was greater than 70%. The implications for the taxonomy of the extreme halophiles are discussed.     

DNA sequence of the 16S rRNA/23S rRNA intercistronic spacer of two rDNA operons of the archaebacterium Methanococcus vannielii

The DNA sequence of the spacer (plus flanking) regions separating the 16S rRNA and 23S rRNA genes of two presumptive rDNA operons of the archaebacterium Methanococcus vannielii was determined. The spacers are 156 and 242 base pairs in size and they share a sequence homology of 49 base pairs following the 3' terminus of the 16S rRNA gene and of about 60 base pairs preceding the 5' end of the 23S rRNA gene. The 242 base pair spacer, in addition contains a sequence which can be transcribed into tRNAAla, whereas no tRNA-like secondary structure can be delineated from the 156 base pair spacer region. Almost complete sequence homology was detected between the end of the 16S rRNA gene and the 3' termini of either Escherichia coli or Halobacterium halobium 16S rRNA, whereas the putative 5' terminal 23S rRNA sequence shared partial homology with E. coli 23S rRNA and eukaryotic 5.8S rRNA.     

The number, physical organization and transcription of ribosomal RNA cistrons in an archaebacterium: Halobacterium halobium.

Because it is now clear that archaebacteria may be as distinct from eubacteria as either group is from eukaryotic cells, and because a specifically archaebacterial ancestry has been proposed for the nuclear-cytoplasmic component of eukaryotic cells, we undertook to characterize, for the first time, the ribosomal RNA cistrons of an archaebacterium (Halobacterium halobium). We found these cistrons to be physically linked in the order 16S-23S-5S, and obtained evidence that they are also transcribed from a common promoter(s) in the order 5'-16S-23S-5S-3'. We showed that, although slightly larger immediate precursors of 16S and 23S are readily seen, no common precursor of both 16S and 23S can be easily detected in vivo. In all these respects the archaebacterium H. halobium is like a eubacterium and unlike the nuclear-cytoplasmic component of eukaryotic cells. We found, however, that it differs from eubacteria of comparable (large) genome size in having only one copy of the rRNA gene cluster per genome.     

Cloning of the gene for ribosomal protein HS4 in the archaebacterium Halobacterium halobium

Using a synthetic oligonucleotide probe, a gene of the ribosomal protein HS4 from an archaebacterium Halobacterium halobium has been cloned and partly sequenced. The translation initiation region contains a sequence complementary to the 3' end of the 16S rRNA.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

Sequence analysis of the peptide-elongation factor EF-2 gene, downstream from those of ribosomal proteins H-S12 and H-S7, from the archaebacterial extreme halophile, Halobacterium halobium

The gene for the peptide-elongation factor 2 (EF-2) was cloned from the archaebacterial extreme halophile Halobacterium halobium and sequenced. The 1013 nucleotides upstream from this gene was two open reading frames similar to ribosomal proteins S12 and S7 from Escherichia coli. Sequence alignment studies showed the halobacterial elongation factor 2 to be equivalent to eukaryotic EF-2 and eubacterial EF-G. Sequence similarity to the eukaryotic elongation factor was much higher than to the eubacterial factor. Conserved sequence regions were present within the factor and are likely to constitute functionally important domains. These include the sites of GTP binding and ADP ribosylation by diphtheria toxin.     

Characterization of a superoxide dismutase gene from the archaebacterium Methanobacterium thermoautotrophicum

A gene encoding superoxide dismutase (SOD) was cloned from the archaebacterium Methanobacterium thermoautotrophicum, the first example from an anaerobic bacterium. The deduced amino acid sequence showed overall similarity to sequences of known Mn- and Fe-SODs from aerobic organisms. Judging from a detailed sequence comparison, the cloned SOD gene is classified as Mn-SOD. By comparison of Mn-SOD sequences among various species it was suggested that archaebacterial superoxide dismutase is a direct descendant of a primordial enzyme. Between a putative promoter and the start codon there is an inverted repeat sequence which is also found in the counterpart of Halobacterium halobium.     

Polyadenylated RNA isolated from the archaebacterium Halobacterium halobium.

Polyadenylated [poly(A)+] RNA has been isolated from the halophilic archaebacterium Halobacterium halobium by binding, at 4 degrees C, to oligo(dT)-cellulose. H. halobium contains approximately 12 times more poly(A) per unit of RNA than does the methanogenic archaebacterium Methanococcus vannielii. The 3' poly(A) tracts in poly(A)+ RNA molecules are approximately twice as long (average length of 20 nucleotides) in H. halobium as in M. vannielii. In both archaebacterial species, poly(A)+ RNAs are unstable.     

Characterization of the 7S RNA and its gene from halobacteria.

The 7S RNA is an abundant nonribosomal RNA in H. halobium and other halobacteria. A specific 7S RNA gene probe shows high homology to genomic DNA of all halobacteria tested but not to those of several other archaebacteria, eubacteria and eukaryotes. All halobacterial genomes seem to carry a single copy of the 7S RNA gene. The coding region of the 7S RNA gene is highly G+C rich whereas the 5'- and 3'-noncoding regions possess a rather low G+C content. An extended double stranded structure for the 7S RNA is deduced from its nucleotide sequence. The 7S RNA of H. halobium (304 nucleotides) resembles in size and structure the 7S-L RNA from mammalian cells and shares with it a sequence homology of about 50% when arranged in a colinear fashion. The similarities in sequence are found particularly at the 3'- and 5'-termini. No similarity was detected between the 7S RNA from H. halobium and the nonribosomal 6S RNA from Escherichia coli.     

The primary structure of rat ribosomal protein L35

The amino acid sequence of the rat 60S ribosomal subunit protein L35 was deduced from the sequence of nucleotides in a recombinant cDNA and confirmed from the NH2-terminal amino acid sequence of the protein. Ribosomal protein L35 has 122 amino acids (the NH2-terminal methionine is removed after translation of the mRNA) and has a molecular weight of 14,412. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 15-17 copies of the L35 gene. The mRNA for the protein is about 570 nucleotides in length. Rat L35 is related to the archaebacterial ribosomal proteins Halobacterium marismortui L33 and Halobacterium halobium L29E; it is also related to Escherichia coli L29 and to other members of the prokaryotic ribosomal protein L29 family. The protein contains a possible internal duplication of 11 residues.     

The halobacterial H+-translocating ATP synthase relates to the eukaryotic anion-sensitive H+-ATPase

The H+-translocating ATP synthase of Halobacterium halobium (Y. Mukohata and M. Yoshida (1987) J. Biochem. 102, 797-802) includes a catalytic moiety of 320 kDa which is isolated as an azide-insensitive ATPase (T. Nanba and Y. Mukohata (1987) J. Biochem. 102, 591-598). The polyclonal antibody against this archaebacterial ATPase cross-reacts with the anion-sensitive H+-ATPase of red beet, Beta vulgaris, tonoplast as well as with another archaebacterial ATPase from Sulfolobus acidocaldarius. The affinity is much higher than to F1-ATPase from spinach chloroplasts or to Ca2+-ATPase from sarcoplasmic reticulum of rabbit skeletal muscle.     

Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms

The nucleotide sequence of ribosomal 5 S RNA from a halophilic bacterium, Halobacterium cutirubrum, grown in 4 M sodium chloride is U-U-A-A-G-G-C-G-G-C-C-A-U-A-G-C-G-G-U-G-G-G-G-U-U-A-C-U-C-C-C-G-U-A-C-C-C-A-U-C-C-C-G-A-A-C-A-C-G-G-A-A-G-A-U-A-A-G-C-C-C-G-C-C-U-G-C-G-U-U-C-C-G-G-U-C-A-G-U-A-C-U-G-G-A-G-U-G-C-G-A-G-C-C-U-C-U-G-G-G-A-A-A-U-C-C-G-G-U-U-C-G-C-C-G-C-C-U-A-C-U. This nucleotide sequence is the longest prokaryotic 5 S rRNA to be reported and unlike other 5 S species does not contain a terminal mononucleoside diphosphate residue at its 5'-end. When compared to other 5 S rRNA's, the sequence homology is greatest (about 68%) with Bacillus subtilis; there is a lower but similar degree of homology (about 58%) with either Escherichia coli or human 5 S RNA. The comparisons further indicate that among 5 S RNA's, eleven of the nucleotide residues are unique to H. cutirubrum. Estimates of the secondary structure of the H. cutirubrum 5 S RNA molecule contain one additional stable hairpin loop which is not found in other 5 S rRNA species; this unusual structure is probably an adaptation to the high salt environment within H. cutirubrum cells.     

Isolation of a gene that encodes a new retinal protein, archaerhodopsin, from Halobacterium sp. aus-1

We have cloned and sequenced the gene that encodes archaerhodopsin, a light-driven H+ pump in Halobacterium sp. aus-1 (Mukohata, Y., Sugiyama, Y., Ihara, K., and Yoshida, M. (1988) Biochem. Biophys. Res. Commun. 151, 1339-1345). The nucleotide sequence of this gene contained an open reading frame which corresponded to a protein of 260 amino acids with a molecular mass of 27,851 daltons, including a precursor sequence of 6 amino acids at the amino terminus and 2 amino acids at the carboxyl terminus. The deduced amino acid sequence of archaerhodopsin exhibited 59 and 32% homology to the sequences of bacteriorhodopsin and halorhodopsin, respectively, from Halobacterium halobium. Three charged residues (Asp-121, Asp-218, and Lys-222) are conserved in the transmembrane segments among the three retinal proteins. Residues Asp-91 and Asp-102 which, it has been suggested, may be essential for the pumping of protons (Mogi, T., Stern, L. J., Marti, T., Chao, B. H., and Khorana, H. G. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,4148-4152) are conserved between archaerhodopsin and bacteriorhodopsin.