Localization and age-dependent expression of the inward rectifier K+ channel subunit Kir 5.1 in a mammalian reproductive system.

Kir 5.1 is a member of the inward rectifier potassium channel superfamily which does not form functional channels when expressed by itself in Xenopus laevis oocytes. rt-PCR reveals high levels of Kir 5.1 mRNA expression in testis but the function of this channel remains unknown. To determine the cell-specific expression of this channel in the testis we raised a polyclonal antibody against an external epitope of Kir 5.1 and tested its specificity in Xenopus oocytes expressing several cloned Kir subunits. Strong immunoreactivity for Kir 5.1 was found in seminiferous tubules of rat testis and, particularly, in spermatogonia, primary and secondary spermatocytes, spermatids and in the head and body of spermatozoa. The intensity of Kir 5.1 immunofluorescence, quantified using laser scanning microscopy, increased with age at every stage in the development of sperm from spermatogonia and reached a peak in 60-day-old rats. In contrast, the immunofluorescence decreased in 90-day-old animals and was detected mostly in spermatozoa. The results demonstrate that Kir 5.1 expression in the testis is localised to cells involved in spermatogenesis, showing a temporal pattern of expression during sexual maturity.     

Functional distinctions between the mitochondrial ATP-dependent K+ channel (mitoKATP) and its inward rectifier subunit (mitoKIR)

The ATP-sensitive potassium channel from the inner mitochondrial membrane (mitoK(ATP)) is a highly selective conductor of K(+) ions. When isolated in the presence of nonionic detergent and reconstituted in liposomes, mitoK(ATP) is inhibited with high affinity by ATP (K((1/2)) = 20-30 microM). We have suggested that holo-mitoK(ATP) is a heteromultimer consisting of an inwardly rectifying K(+) channel (mitoKIR) and a sulfonylurea receptor (Grover, G. J., and Garlid, K. D. (2000) J. Mol. Cell. Cardiol. 32, 677-695). Here, we show that a 55-kDa protein isolated by ethanol extraction and reconstituted in bilayer lipid membranes and liposomes is the mitoKIR. This protein, which lacks the sulfonylurea receptor subunit, is inhibited with low affinity by ATP, with K(1/2) approximately 550 microM. ATP inhibition of both mitoKIR and holo-mitoK(ATP) is reversed by UDP (K((1/2))1/2 = 10-15 microM). Holo-mitoK(ATP) is and diazoxide, and the opened by cromakalim flux through the open channel is inhibited by glibenclamide and 5-hydroxydecanoate. None of these agents has any effect upon mitoKIR. We have identified two compounds that act specifically on mitoKIR. p-diethylaminoethylbenzoate reverses inhibition of mitoKIR by ATP and ADP at micromolar concentrations and also opens mitoK(ATP) in isolated mitochondria. Tetraphenylphosphonium inhibits K(+) flux through both mitoKIR and mitoK(ATP) with the same apparent affinity. These findings support the hypothesis that the 55-kDa mitoKIR is the channel component of mitoK(ATP).     

The human ICAM2 gene maps to 17q23-25.

The intercellular adhesion molecules ICAM1 and ICAM2 are the cell-surface ligands for the lymphocyte function-associated antigen LFA-1 (CD11a/CD18) and are thought to mediate cell-cell adhesion interactions required by the immune system. However, differences in tissue distribution, inducibility of expression, and overall structure of the two ICAMs may point to their having distinct functional roles. We have used a panel of somatic cell hybrids and chromosome-mediated gene transfectants to establish the chromosomal location of the gene for ICAM2. Hybridization of an ICAM2 cDNA clone to Southern blots from this panel indicates that the human ICAM2 gene maps to chromosome 17 region q23-25.     

Identification of human Kir2.2 (KCNJ12) gene encoding functional inward rectifier potassium channel in both mammalian cells and Xenopus oocytes

Arginine residue at position 285 (R285) in the intracellular C-terminal domain of inward rectifier potassium channel Kir2.2 is conserved in many species, but missing in previously reported human Kir2.2 sequences. We here identified the human Kir2.2 gene in normal individuals, which contained R285 in the deduced amino-acid sequence (hKir2.2/R285). All 30 individuals we examined were homozygous for Kir2.2/R285 gene. The hKir2.2/R285 was electrophysiologically functional in both mammalian cells and Xenopus oocytes. However, the hKir2.2 missing R285 was functional only in Xenopus oocytes, but not in mammalian cells. Thus, R285 in Kir2.2 is important for its functional expression in mammalian cells.     

The human basic fibroblast growth factor gene (FGFB) is assigned to chromosome 4q25

In situ hybridization was used to localize a cDNA probe for the basic fibroblast growth factor gene (FGFB) to human metaphase and prometaphase chromosomes. In this communication we report the localization of this gene to 4q25.     

CO(2) inhibits specific inward rectifier K(+) channels by decreases in intra- and extracellular pH

Hypercapnia has been shown to affect cellular excitability by modulating K(+) channels. To understand the mechanisms for this modulation, four cloned K(+) channels were studied by expressing them in Xenopus oocytes. Exposures of the oocytes to CO(2) for 4-6 min produced reversible and concentration-dependent inhibitions of Kir1.1 and Kir2.3 currents, but had no effect on Kir2.1 and Kir6.1 currents. Intra- and extracellular pH (pH(i), pH(o)) dropped during CO(2) exposures. The inhibition of Kir2.3 currents was mediated by reductions in both intra- and extracellular pH, whereas the suppression of Kir1.1 resulted from intracellular acidification. In cell-free excised inside-out patches with cytosolic-soluble factors washed out, a decrease in pH(i) produced a fast and reversible inhibition of macroscopic Kir2.3 currents. The degree of this inhibition was similar to that produced by hypercapnia when compared at the same pH(i) level. Exposure of cytosolic surface of patch membranes to a perfusate bubbled with 15% CO(2) without changing pH failed to inhibit the Kir2.3 currents. These results therefore indicate that (1) hypercapnia inhibits specific K(+) channels, (2) these inhibitions are caused by intra- and extracellular protons rather than molecular CO(2), and (3) these effects are independent of cytosol-soluble factors.     

The human vitronectin (complement S-protein) gene maps to the centromeric region of 17q

Summary Vitronectin (complement S-protein, serumspreading factor, epibolin) is a multifunctional glycoprotein that mediates cell-to-substrate adhesion, inhibits the cytolytic action of the terminal complement cascade in vitro and binds to several serine protease inhibitors of the serpin family, viz. antithrombin III, plasminogen activator inhibitor I (PAI-1) and II (PAI-2), heparin cofactor II and protease nexin. Using high resolution fluorescence in situ hybridization, we mapped the vitronectin gene to the centromeric region of the long arm of chromosome 17 corresponding to 17q11. The location was confirmed by co-hybridization with the centromerespecific alphoid probe p17H8 (D17Z1) and by chromosome banding with 4,6-diamidino-2-phenylindole-dihydrochloride (DAPI). None of the previously mapped genes that are evolutionary related to vitronectin are located on the same chromosome.     

The gene for tissue inhibitor of metalloproteinases-2 is localized on human chromosome arm 17q25.

Tissue inhibitor of metalloproteinases-2 (TIMP2) is a natural inhibitor of several proteinases that are involved in the degradation of the extracellular matrix. By means of somatic cell hybrids segregating human chromosomes, the gene encoding this inhibitor was assigned to human chromosome 17. Fluorescence in situ hybridization confirmed this assignment and allowed mapping of the gene to the terminal region (17q25) of the chromosome.     

Van Buchem disease (hyperostosis corticalis generalisata) maps to chromosome 17q12-q21.

Van Buchem disease (hyperostosis corticalis generalisata; OMIM 239100 [http://www3.ncbi.nlm.nih. gov:80/htbin-post/Omim/dispmim?239100]) is an autosomal recessive disorder characterized by hyperostosis of the skull, mandible, clavicles, ribs, and diaphyseal cortices of the long bones. The most striking clinical features are the enlargement of the jaw and the thickness of the skull, which may lead to facial nerve palsy, hearing loss, and optic atrophy. Increased formation, by osteoblasts, of qualitatively normal bone has been proposed as the underlying pathological mechanism, but the molecular defect is unknown. We studied 11 van Buchem patients and their highly inbred family, who live in The Netherlands in a small ethnic isolate, that had a common ancestor approximately 9 generations ago. A genomewide search with highly polymorphic microsatellite markers showed linkage to marker D17S1299 on chromosome 17q12-21 (maximum LOD score of 8.82 at a recombination fraction [straight theta] of .01). Analysis of additional markers from that region delineated a candidate region of <1 cM, between markers D17S1787 and D17S934. Interestingly, the only marker not showing recombination with the disease locus was an intragenic marker of the thyroid-hormone receptor alpha1 (THRA1) gene, which generated a LOD score of 12.84 at straight theta=.00. Since thyroid hormones are known to stimulate bone resorption, the THRA1 gene might be involved in the etiology and pathogenesis of van Buchem disease. Unraveling the underlying mechanism for this disorder could contribute to the understanding of the regulatory processes conditioning bone density and the underlying pathological processes.     

The human tyrosine kinase gene (FER) maps to chromosome 5 and is deleted in myeloid leukemias with a del(5q)

A novel member of the SRC tyrosine kinase gene family was recently isolated and characterized (Hao et al., 1989). This FES/FPS-related gene, named FER, lacks the transmembrane and extracellular domains which characterize tyrosine kinases with receptor function. Expression of FER in a wide range of cell types indicates a general role in intracellular signalling or differentiation processes. We have now mapped FER to chromosome 5q14----q23 using in situ hybridization techniques and suggest a more precise location within bands 5q21----q22. This region lies adjacent to a complex domain of growth factors and receptors, many involved in regulation of haematopoiesis. FER maps within a critical segment frequently deleted from chromosome 5 in patients with acute myeloid leukemia or myelodysplastic syndromes and was shown to be deleted in two such patients. It also maps close to the familial polyposis coli locus at 5q22.     

A brain L-type calcium channel alpha 1 subunit gene (CCHL1A2) maps to mouse chromosome 14 and human chromosome 3.

A rat brain cDNA probe was used to localize a gene encoding the alpha 1 subunit of neuronal dihydropyridine-sensitive L-type calcium channels in the mouse and human genomes. Hybridization of the probe to Southern blots made with DNAs from a Chinese hamster x mouse somatic cell hybrid panel indicated that this gene maps to mouse chromosome 14 (Chr 14). Southern blot analysis of an intersubspecies cross demonstrated that the calcium channel alpha 1 subunit gene, termed Cchl1a2, can be positioned 7.5 cM proximal to Np-1. Similarly, segregation among human X rodent somatic cell hybrids indicated that CCHL1A2 maps to human chromosome 3. These assignments are consistent with a region of linkage homology between human chromosome 3p and a proximal region of mouse Chr 14.     

The gene for the cell adhesion molecule M-cadherin maps to mouse chromosome 8 and human chromosome 16q24.1-qter and is near the E-cadherin (uvomorulin) locus in both species.

A mouse myotube-derived cDNA encoding the Ca(2+)-dependent cell adhesion molecule M-cadherin was used to study the segregation of the corresponding gene Cdh3 in a mouse interspecific backcross. Cdh3 was found to be unlinked to the N-cadherin gene but linked to the E-cadherin (uvomorulin) locus on chromosome 8 in a region of conserved synteny with human chromosome 16q. The gene order cen-Junb-Um-Tat-(Cdh3/Aprt) was determined. The human homologue CDH3 was mapped to chromosome 16q24.1-qter by analyzing human/mouse somatic cell hybrids.     

The mouse neurological mutant weaver maps within the region of chromosome 16 that is homologous to human chromosome 21

Utilizing the backcross C57BL/6 wv/wv x (C57BL/6 wv/wv x MOLD/Rk), the mouse neurological mutation weaver (wv) was mapped less than 1 cM proximal to Ets-2 and Mx on mouse chromosome 16 (0.96 +/- 0.1% recombination). This region is known to include eight genes that are found on human chromosome 21 (HSA 21) and appears to be highly conserved between the two species. We therefore predict that the normal human homolog of wv will be located on HSA 21 and would be in dosage imbalance in individuals with Down syndrome.     

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.     

The lactase phlorizin hydrolase (LCT) gene maps to pig chromosome 15q13

A porcine 17kb genomic fragment was used as probe to map the lactase phlorizin hydrolase ( LCT ) gene to pig chromosome 15q13 by fluorescence in situ hybridization. Further, a threeallele TaqI RFLP was used to add the LCT gene to the proximal end of the chromosome 15 linkage map. Comparison of the human chromosome 2 gene map and the gene map of pig chromosome 15 indicates that the part of human chromosome 2 distal to the q13 band is homologous to pig chromosome 15.